ID: 945897031

View in Genome Browser
Species Human (GRCh38)
Location 2:215495042-215495064
Sequence GAATCTCATTCATTGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945897026_945897031 7 Left 945897026 2:215495012-215495034 CCAAAGGCTAGCCAGGATGTGGA No data
Right 945897031 2:215495042-215495064 GAATCTCATTCATTGCTGGTGGG No data
945897028_945897031 -4 Left 945897028 2:215495023-215495045 CCAGGATGTGGAACAACAGGAAT No data
Right 945897031 2:215495042-215495064 GAATCTCATTCATTGCTGGTGGG No data
945897022_945897031 24 Left 945897022 2:215494995-215495017 CCAAAACATTGACAACACCAAAG No data
Right 945897031 2:215495042-215495064 GAATCTCATTCATTGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945897031 Original CRISPR GAATCTCATTCATTGCTGGT GGG Intergenic
No off target data available for this crispr