ID: 945897033

View in Genome Browser
Species Human (GRCh38)
Location 2:215495054-215495076
Sequence TTGCTGGTGGGGATGCAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7562
Summary {0: 18, 1: 268, 2: 1080, 3: 2335, 4: 3861}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945897026_945897033 19 Left 945897026 2:215495012-215495034 CCAAAGGCTAGCCAGGATGTGGA No data
Right 945897033 2:215495054-215495076 TTGCTGGTGGGGATGCAAAACGG 0: 18
1: 268
2: 1080
3: 2335
4: 3861
945897028_945897033 8 Left 945897028 2:215495023-215495045 CCAGGATGTGGAACAACAGGAAT No data
Right 945897033 2:215495054-215495076 TTGCTGGTGGGGATGCAAAACGG 0: 18
1: 268
2: 1080
3: 2335
4: 3861

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945897033 Original CRISPR TTGCTGGTGGGGATGCAAAA CGG Intergenic
Too many off-targets to display for this crispr