ID: 945912096

View in Genome Browser
Species Human (GRCh38)
Location 2:215661158-215661180
Sequence GTAGAGCCCTTGGGAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945912093_945912096 -1 Left 945912093 2:215661136-215661158 CCAGCTTTTACTGAGTAGCAATG No data
Right 945912096 2:215661158-215661180 GTAGAGCCCTTGGGAAAAACAGG No data
945912092_945912096 20 Left 945912092 2:215661115-215661137 CCATCAGTATGCAGACTGACACC No data
Right 945912096 2:215661158-215661180 GTAGAGCCCTTGGGAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945912096 Original CRISPR GTAGAGCCCTTGGGAAAAAC AGG Intergenic
No off target data available for this crispr