ID: 945918295

View in Genome Browser
Species Human (GRCh38)
Location 2:215728034-215728056
Sequence CACAGATGTGGTTTTAGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945918290_945918295 14 Left 945918290 2:215727997-215728019 CCAGAGATGAGCAAGAGCATGGC No data
Right 945918295 2:215728034-215728056 CACAGATGTGGTTTTAGGTCAGG No data
945918287_945918295 23 Left 945918287 2:215727988-215728010 CCTATTTACCCAGAGATGAGCAA No data
Right 945918295 2:215728034-215728056 CACAGATGTGGTTTTAGGTCAGG No data
945918288_945918295 15 Left 945918288 2:215727996-215728018 CCCAGAGATGAGCAAGAGCATGG No data
Right 945918295 2:215728034-215728056 CACAGATGTGGTTTTAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945918295 Original CRISPR CACAGATGTGGTTTTAGGTC AGG Intergenic