ID: 945919257

View in Genome Browser
Species Human (GRCh38)
Location 2:215738676-215738698
Sequence TTTAAGTTATTAGTTGCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945919257_945919262 14 Left 945919257 2:215738676-215738698 CCCAAAGCAACTAATAACTTAAA No data
Right 945919262 2:215738713-215738735 ATTCATTTCCCTTGAAAAAATGG No data
945919257_945919265 28 Left 945919257 2:215738676-215738698 CCCAAAGCAACTAATAACTTAAA No data
Right 945919265 2:215738727-215738749 AAAAAATGGTGAACGAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945919257 Original CRISPR TTTAAGTTATTAGTTGCTTT GGG (reversed) Intergenic
No off target data available for this crispr