ID: 945921114

View in Genome Browser
Species Human (GRCh38)
Location 2:215755464-215755486
Sequence TTCGCTGATGTCACCGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945921105_945921114 11 Left 945921105 2:215755430-215755452 CCTCCTGGGGCCAGTGGCCCAGG No data
Right 945921114 2:215755464-215755486 TTCGCTGATGTCACCGGAGGTGG No data
945921110_945921114 -6 Left 945921110 2:215755447-215755469 CCCAGGTAAACTTGGATTTCGCT No data
Right 945921114 2:215755464-215755486 TTCGCTGATGTCACCGGAGGTGG No data
945921111_945921114 -7 Left 945921111 2:215755448-215755470 CCAGGTAAACTTGGATTTCGCTG No data
Right 945921114 2:215755464-215755486 TTCGCTGATGTCACCGGAGGTGG No data
945921107_945921114 8 Left 945921107 2:215755433-215755455 CCTGGGGCCAGTGGCCCAGGTAA No data
Right 945921114 2:215755464-215755486 TTCGCTGATGTCACCGGAGGTGG No data
945921109_945921114 1 Left 945921109 2:215755440-215755462 CCAGTGGCCCAGGTAAACTTGGA No data
Right 945921114 2:215755464-215755486 TTCGCTGATGTCACCGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945921114 Original CRISPR TTCGCTGATGTCACCGGAGG TGG Intergenic
No off target data available for this crispr