ID: 945922579

View in Genome Browser
Species Human (GRCh38)
Location 2:215770754-215770776
Sequence CACCAGCAGCAGTGGCTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945922579_945922586 25 Left 945922579 2:215770754-215770776 CCCATGAGCCACTGCTGCTGGTG No data
Right 945922586 2:215770802-215770824 TTCCTGATTACCATGTGACGTGG No data
945922579_945922584 2 Left 945922579 2:215770754-215770776 CCCATGAGCCACTGCTGCTGGTG No data
Right 945922584 2:215770779-215770801 CCATAGACAACTGTCCTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945922579 Original CRISPR CACCAGCAGCAGTGGCTCAT GGG (reversed) Intergenic
No off target data available for this crispr