ID: 945922586

View in Genome Browser
Species Human (GRCh38)
Location 2:215770802-215770824
Sequence TTCCTGATTACCATGTGACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945922583_945922586 0 Left 945922583 2:215770779-215770801 CCATAGACAACTGTCCTTTGAGG No data
Right 945922586 2:215770802-215770824 TTCCTGATTACCATGTGACGTGG No data
945922579_945922586 25 Left 945922579 2:215770754-215770776 CCCATGAGCCACTGCTGCTGGTG No data
Right 945922586 2:215770802-215770824 TTCCTGATTACCATGTGACGTGG No data
945922580_945922586 24 Left 945922580 2:215770755-215770777 CCATGAGCCACTGCTGCTGGTGG No data
Right 945922586 2:215770802-215770824 TTCCTGATTACCATGTGACGTGG No data
945922582_945922586 17 Left 945922582 2:215770762-215770784 CCACTGCTGCTGGTGGACCATAG No data
Right 945922586 2:215770802-215770824 TTCCTGATTACCATGTGACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945922586 Original CRISPR TTCCTGATTACCATGTGACG TGG Intergenic
No off target data available for this crispr