ID: 945928482

View in Genome Browser
Species Human (GRCh38)
Location 2:215830375-215830397
Sequence GAAGCTGTGTCTTTGCGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945928482_945928487 7 Left 945928482 2:215830375-215830397 CCACCTCGCAAAGACACAGCTTC No data
Right 945928487 2:215830405-215830427 CTTCACTGTGTAACGGCAGAAGG No data
945928482_945928486 0 Left 945928482 2:215830375-215830397 CCACCTCGCAAAGACACAGCTTC No data
Right 945928486 2:215830398-215830420 CCAGTAGCTTCACTGTGTAACGG No data
945928482_945928488 8 Left 945928482 2:215830375-215830397 CCACCTCGCAAAGACACAGCTTC No data
Right 945928488 2:215830406-215830428 TTCACTGTGTAACGGCAGAAGGG No data
945928482_945928489 18 Left 945928482 2:215830375-215830397 CCACCTCGCAAAGACACAGCTTC No data
Right 945928489 2:215830416-215830438 AACGGCAGAAGGGTCCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945928482 Original CRISPR GAAGCTGTGTCTTTGCGAGG TGG (reversed) Intergenic
No off target data available for this crispr