ID: 945929395

View in Genome Browser
Species Human (GRCh38)
Location 2:215840016-215840038
Sequence GCTGATGGGCAGCCACAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945929395_945929400 2 Left 945929395 2:215840016-215840038 CCAAGTTGTGGCTGCCCATCAGC No data
Right 945929400 2:215840041-215840063 TTCCCTGGAGTTGCCCCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945929395 Original CRISPR GCTGATGGGCAGCCACAACT TGG (reversed) Intergenic
No off target data available for this crispr