ID: 945933539

View in Genome Browser
Species Human (GRCh38)
Location 2:215880597-215880619
Sequence CAACCCCATGGGCAGCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945933534_945933539 -4 Left 945933534 2:215880578-215880600 CCTCAGCAAAGCCTTCTGCCAAC No data
Right 945933539 2:215880597-215880619 CAACCCCATGGGCAGCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945933539 Original CRISPR CAACCCCATGGGCAGCTCTG TGG Intergenic
No off target data available for this crispr