ID: 945935787

View in Genome Browser
Species Human (GRCh38)
Location 2:215901661-215901683
Sequence CCTTGGGTTAGGAGTGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945935780_945935787 2 Left 945935780 2:215901636-215901658 CCAGGCAACCAGTGATACCTCGA No data
Right 945935787 2:215901661-215901683 CCTTGGGTTAGGAGTGAAGAAGG No data
945935781_945935787 -6 Left 945935781 2:215901644-215901666 CCAGTGATACCTCGAGACCTTGG No data
Right 945935787 2:215901661-215901683 CCTTGGGTTAGGAGTGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945935787 Original CRISPR CCTTGGGTTAGGAGTGAAGA AGG Intergenic
No off target data available for this crispr