ID: 945935787 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:215901661-215901683 |
Sequence | CCTTGGGTTAGGAGTGAAGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
945935780_945935787 | 2 | Left | 945935780 | 2:215901636-215901658 | CCAGGCAACCAGTGATACCTCGA | No data | ||
Right | 945935787 | 2:215901661-215901683 | CCTTGGGTTAGGAGTGAAGAAGG | No data | ||||
945935781_945935787 | -6 | Left | 945935781 | 2:215901644-215901666 | CCAGTGATACCTCGAGACCTTGG | No data | ||
Right | 945935787 | 2:215901661-215901683 | CCTTGGGTTAGGAGTGAAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
945935787 | Original CRISPR | CCTTGGGTTAGGAGTGAAGA AGG | Intergenic | ||
No off target data available for this crispr |