ID: 945936513

View in Genome Browser
Species Human (GRCh38)
Location 2:215907801-215907823
Sequence GCTCTGTGTTCCCAAGCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945936507_945936513 20 Left 945936507 2:215907758-215907780 CCTGTCCATCCACATCTCCCAAA No data
Right 945936513 2:215907801-215907823 GCTCTGTGTTCCCAAGCTAATGG No data
945936510_945936513 3 Left 945936510 2:215907775-215907797 CCCAAAGCCATCATCTTTGATAC No data
Right 945936513 2:215907801-215907823 GCTCTGTGTTCCCAAGCTAATGG No data
945936508_945936513 15 Left 945936508 2:215907763-215907785 CCATCCACATCTCCCAAAGCCAT No data
Right 945936513 2:215907801-215907823 GCTCTGTGTTCCCAAGCTAATGG No data
945936506_945936513 21 Left 945936506 2:215907757-215907779 CCCTGTCCATCCACATCTCCCAA No data
Right 945936513 2:215907801-215907823 GCTCTGTGTTCCCAAGCTAATGG No data
945936509_945936513 11 Left 945936509 2:215907767-215907789 CCACATCTCCCAAAGCCATCATC No data
Right 945936513 2:215907801-215907823 GCTCTGTGTTCCCAAGCTAATGG No data
945936512_945936513 -4 Left 945936512 2:215907782-215907804 CCATCATCTTTGATACTGTGCTC No data
Right 945936513 2:215907801-215907823 GCTCTGTGTTCCCAAGCTAATGG No data
945936511_945936513 2 Left 945936511 2:215907776-215907798 CCAAAGCCATCATCTTTGATACT No data
Right 945936513 2:215907801-215907823 GCTCTGTGTTCCCAAGCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945936513 Original CRISPR GCTCTGTGTTCCCAAGCTAA TGG Intergenic
No off target data available for this crispr