ID: 945936891

View in Genome Browser
Species Human (GRCh38)
Location 2:215911727-215911749
Sequence TGGAAGGGCTAGAATCGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945936891_945936899 24 Left 945936891 2:215911727-215911749 CCACTGCGATTCTAGCCCTTCCA No data
Right 945936899 2:215911774-215911796 ATCGTCCCTCAGGAGCTCCTTGG No data
945936891_945936902 30 Left 945936891 2:215911727-215911749 CCACTGCGATTCTAGCCCTTCCA No data
Right 945936902 2:215911780-215911802 CCTCAGGAGCTCCTTGGATCTGG No data
945936891_945936898 14 Left 945936891 2:215911727-215911749 CCACTGCGATTCTAGCCCTTCCA No data
Right 945936898 2:215911764-215911786 TTTCTGTGCTATCGTCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945936891 Original CRISPR TGGAAGGGCTAGAATCGCAG TGG (reversed) Intergenic
No off target data available for this crispr