ID: 945940000

View in Genome Browser
Species Human (GRCh38)
Location 2:215939334-215939356
Sequence CCACCTGGTCACAAGATTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 80}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945940000 Original CRISPR CCACCTGGTCACAAGATTAT GGG (reversed) Intergenic
900521477 1:3107360-3107382 CCACCTGGGCACAAAATCAATGG - Intronic
902235644 1:15055741-15055763 CCACCTGGTCACACAACTCTAGG - Intronic
907166219 1:52413860-52413882 CCAACTGGAAACAAGATGATTGG - Exonic
908559335 1:65289577-65289599 GCACCTAGTCATAAGTTTATTGG + Intronic
910027957 1:82680979-82681001 CAACCTGGTCACAACTATATTGG + Intergenic
1065703059 10:28444239-28444261 CCACCAGGGCACCAGATTTTAGG + Intergenic
1070817440 10:79333925-79333947 CTACCTTCTCACATGATTATTGG + Intergenic
1071256394 10:83875693-83875715 CCACCTGGTCACCAGCATATAGG - Intergenic
1071786627 10:88907830-88907852 TCATCTGATCACAAGGTTATAGG - Intronic
1073233626 10:101994344-101994366 CCTCCTTTTCACAAGATTAGGGG - Intronic
1076924725 10:133476592-133476614 TGACCTGGGCACAAGATTCTGGG - Intergenic
1079882796 11:25946804-25946826 CCACCTAGTAACATGATAATAGG + Intergenic
1081200696 11:40211659-40211681 ACACCTGGGTACAAGATTCTGGG - Intronic
1090535345 11:127635231-127635253 CTACCTTGTATCAAGATTATGGG - Intergenic
1090587759 11:128232984-128233006 CTACCTGGACACAATATTCTTGG - Intergenic
1092055447 12:5504929-5504951 GCCCCAGGTCACATGATTATCGG - Intronic
1095635177 12:44424260-44424282 CCAACTGGTAGCAAGATTGTTGG + Intergenic
1099924296 12:88998718-88998740 CCAGTTGCTCTCAAGATTATGGG - Intergenic
1101814393 12:108134522-108134544 CCAGCTGGTCACAAGCAGATCGG + Intronic
1107462495 13:40617516-40617538 TTACCTGGTCACAAGAATGTGGG - Intronic
1109859227 13:68175155-68175177 CTATCTGGTCACAAAATTAATGG + Intergenic
1113819395 13:113202171-113202193 ACACCTGGGCACAGGATTACTGG - Intronic
1116077574 14:40130834-40130856 GCACCTCTTCACAAGATGATAGG - Intergenic
1118347519 14:64950793-64950815 CCACCTGGTCCCAAGATTTCAGG + Intronic
1119822261 14:77627215-77627237 CAACCTGAACACAAGATTTTCGG - Intergenic
1122113785 14:99517895-99517917 CCAGCAGGTCACAAGATGCTGGG + Intronic
1127612643 15:60651890-60651912 CCACCTGGTGACATGCTTAACGG - Intronic
1130985054 15:88839285-88839307 CCACCGGATCACAGGATTCTTGG - Intronic
1131055809 15:89374140-89374162 CCACATCGACACATGATTATGGG + Intergenic
1132257943 15:100393859-100393881 TTACCTGGTGATAAGATTATGGG + Intergenic
1133687311 16:8178554-8178576 CCACCTGGTCATGATATTTTGGG + Intergenic
1141238003 16:82238160-82238182 GCACCTGGTACCCAGATTATGGG + Intergenic
1144305675 17:13967335-13967357 CCACCTGGTAAAAGGAATATTGG - Intergenic
1151059390 17:71073714-71073736 CCTCCTGTTCCCAAGATTGTTGG + Intergenic
1156814644 18:41295123-41295145 CCACATGGTCACTAGATCAAGGG + Intergenic
1157005247 18:43575173-43575195 CCACCTGGTAGCAAGATGATGGG + Intergenic
1159753898 18:72339379-72339401 CCAGCTGATCACCAAATTATTGG - Intergenic
1163347539 19:16753237-16753259 GCACCTGGTCACAGAAATATGGG - Intronic
925014261 2:509946-509968 CCACACGGTCACAGGATTATAGG - Intergenic
935455382 2:103261520-103261542 CCTCCTGTTCACAGCATTATTGG + Intergenic
937799658 2:126068045-126068067 CAACCTGCTCACAATGTTATTGG - Intergenic
938087853 2:128413084-128413106 TCACCTGCACTCAAGATTATGGG + Intergenic
939081956 2:137673430-137673452 CCACCTGGGCACAGGATGACTGG + Intronic
941890459 2:170575692-170575714 CCTCTGGGTAACAAGATTATAGG + Intronic
945940000 2:215939334-215939356 CCACCTGGTCACAAGATTATGGG - Intergenic
948887495 2:240891505-240891527 CCTCCTGGTCACAAGGTTCTTGG - Intronic
1172391804 20:34570338-34570360 GCACGTGATCAGAAGATTATAGG + Intronic
1172588306 20:36100336-36100358 CCACCTTGTCCCCAGATTAGAGG + Intronic
1173884170 20:46442173-46442195 CCAGCTGGTGTCCAGATTATTGG - Intergenic
1176932913 21:14834351-14834373 CCACCTGGTCAAAACATTAAGGG - Intergenic
1182166569 22:28180507-28180529 GCATCTGGTCACAAGCTTACTGG - Intronic
1183829440 22:40409985-40410007 CCACCTCCTCACAAGGTTTTTGG - Exonic
1184587195 22:45455878-45455900 CCACAGGGTCACAAGAAAATGGG + Intergenic
952899455 3:38099894-38099916 CCACCAGGTCACTAGATTAGGGG - Intronic
967610417 3:191499470-191499492 ACACCTGGGCAAAAGTTTATGGG - Intergenic
971352603 4:25866486-25866508 CCAGCTGGTCACAAACTTCTGGG - Intronic
971508033 4:27387736-27387758 CCACCTGTCCAGAAGATTGTGGG - Intergenic
974213504 4:58813911-58813933 AAACTTGTTCACAAGATTATAGG + Intergenic
977796988 4:101178188-101178210 CCACCTAGTGAGAAGATCATTGG - Intronic
985759087 5:1735613-1735635 CCACATGGTCACATGGTCATGGG - Intergenic
985986196 5:3518612-3518634 CCACCTGGTCACCAGGACATTGG - Intergenic
986910285 5:12547613-12547635 CCAGCTGGTCATAAGATTGCTGG - Intergenic
990663725 5:58048575-58048597 TCACCTGGTAGCAAGATGATGGG + Intergenic
1000020199 5:157311645-157311667 CCACCTGGGTAGAAAATTATGGG - Exonic
1008376201 6:50794953-50794975 CCAGCTGGTCACATTTTTATGGG - Intergenic
1012005217 6:93705510-93705532 GCACCTGGTAACAAGATTGCTGG - Intergenic
1014248341 6:119091513-119091535 CAACATGGGCACAAGACTATGGG - Intronic
1017344114 6:153359548-153359570 TCACTTGGTAACAAGGTTATGGG - Intergenic
1023114894 7:36853148-36853170 CCACATGGTCACAAAATGAATGG + Intergenic
1023496526 7:40803413-40803435 CCACATGCTCACATGATTTTAGG - Intronic
1027768394 7:82375433-82375455 CACCCTGATCACAAGAGTATGGG + Intronic
1028795994 7:94905354-94905376 CCATGTGGTCACAAGGTTAGAGG - Intergenic
1036227675 8:6973508-6973530 CCACCTGTTCACAAGTGTCTTGG + Intergenic
1036230128 8:6992667-6992689 CCACCTGTTCACAAGTGTCTTGG + Intergenic
1036232580 8:7011770-7011792 CCACCTGTTCACAAGTGTCTTGG + Intronic
1038259263 8:25978992-25979014 CCTCCGTGTCACAAGATTAAGGG - Intronic
1045903072 8:107308413-107308435 CAACCTGGTCACAAGATAGCTGG + Intronic
1053283943 9:36838655-36838677 CCACTTGGTCCAAATATTATTGG + Exonic
1053626688 9:39878569-39878591 GCACCTTGTCACATGCTTATTGG + Intergenic
1054217199 9:62372134-62372156 GCACCTTGTCACATGCTTATTGG - Intergenic
1054947950 9:70816558-70816580 CCACCTGCTGCCAAGATTACTGG + Intronic
1055913282 9:81374963-81374985 CCACGTGGTCACCAGATAAATGG + Intergenic
1057400971 9:94723391-94723413 CAACCTGGTCACAATATCCTTGG + Intergenic
1058394309 9:104532750-104532772 CCACCTGGAAACCAGATAATGGG - Intergenic
1059209856 9:112503441-112503463 CCAGCTGGTCTCAAACTTATGGG - Intronic
1062315035 9:135962962-135962984 CCACCTGGTCACACCGTTAGTGG - Intergenic
1192674482 X:73182057-73182079 ACACCTGGTGCAAAGATTATAGG + Intergenic
1196571847 X:117274816-117274838 CCAGCTGGTCTCAAGCTTCTGGG - Intergenic
1198930686 X:141856095-141856117 CCACATGTTCACAAGATGATGGG - Intronic