ID: 945942668

View in Genome Browser
Species Human (GRCh38)
Location 2:215965470-215965492
Sequence CAGGGGATACAGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 962
Summary {0: 1, 1: 0, 2: 8, 3: 84, 4: 869}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945942668 Original CRISPR CAGGGGATACAGAGGGAGGA AGG Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900118746 1:1039806-1039828 CGGGGGATGCCCAGGGAGGAGGG + Intronic
900142258 1:1143604-1143626 CAGGGGATGCCCAGGAAGGACGG - Intergenic
900293917 1:1939229-1939251 GGGGGGAGAGAGAGGGAGGATGG + Intronic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900438374 1:2641901-2641923 CAGAGGACACAGAGAGAGGCAGG + Intronic
900701238 1:4049781-4049803 AGGGGGAGAAAGAGGGAGGAAGG + Intergenic
900829008 1:4950683-4950705 GAGGGGCTGCAGGGGGAGGATGG + Intergenic
900875522 1:5340035-5340057 AAGGAGATTCAGAGGGAGCAGGG + Intergenic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
901269566 1:7941457-7941479 CATGGGTGACAGAGGGAGGAAGG + Intronic
901445801 1:9307399-9307421 CAGGGGCTGGGGAGGGAGGATGG - Intronic
901798962 1:11696215-11696237 AAGGGGAGACAGAGGGAGTAAGG - Intronic
902553350 1:17232343-17232365 CAGGGGGTGAAGTGGGAGGATGG - Intronic
902658243 1:17884199-17884221 CAGGGGCTGCAGAGGTAGGCAGG + Intergenic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
903224168 1:21885492-21885514 CTGGGGATGCCCAGGGAGGATGG - Intronic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
903844756 1:26272297-26272319 CAGGAGAGTCAGTGGGAGGAAGG + Intronic
904644878 1:31958185-31958207 CAGTGGAGACAGAGGGGAGAGGG - Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904883780 1:33720444-33720466 AAGGGGATTCAGAAGGATGAAGG + Intronic
905030160 1:34876880-34876902 CAGTGGATACAGAGAGAAGTGGG - Intronic
905361074 1:37420836-37420858 CTGTGGATACTGAGGGATGATGG - Intergenic
905780041 1:40700888-40700910 AAGGGGACACAGTGGGAGGATGG - Intronic
905788751 1:40778922-40778944 GAGGAGACACAGAGGGAGAAAGG - Intergenic
905875218 1:41427881-41427903 GCGGGGAGAGAGAGGGAGGAGGG - Intergenic
906662137 1:47590573-47590595 CTGAGGATAGAGAGGGAGGCTGG + Intergenic
906764803 1:48418856-48418878 GAGGGGAAGGAGAGGGAGGAAGG + Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907998664 1:59658545-59658567 CATAGGATACAGAGTGAGGAGGG + Intronic
908151871 1:61310787-61310809 CAGGAAATTCAGAGGAAGGAAGG - Intronic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
909183690 1:72457785-72457807 GAGGGGAGAGGGAGGGAGGAAGG - Intergenic
909296364 1:73954286-73954308 GACGGGAGACAGAGGAAGGAAGG - Intergenic
909561834 1:77016181-77016203 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561842 1:77016205-77016227 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561850 1:77016229-77016251 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561858 1:77016253-77016275 GAGGAGATACAGGAGGAGGAGGG - Intronic
909883118 1:80905187-80905209 CAGTGGATAAAGAGAGTGGAAGG + Intergenic
910092413 1:83480746-83480768 AAGGGCATACAGAGGGAGACTGG - Intergenic
910220051 1:84880822-84880844 CAGAGGGTACAGAAGAAGGAAGG + Intronic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910628892 1:89337074-89337096 CTGTGGATTCAGAGGGTGGAAGG + Intergenic
910634800 1:89395189-89395211 AAGGGGAGAGAGAGAGAGGAAGG + Intergenic
910731145 1:90398766-90398788 CAGGAGAGAGAGAGGGAGCAAGG + Intergenic
911121283 1:94299742-94299764 TAAGGGAGCCAGAGGGAGGAAGG + Intergenic
911519271 1:98909103-98909125 AAGGAGGGACAGAGGGAGGAAGG + Intronic
913109712 1:115647002-115647024 CTGGGGCTAGAGAAGGAGGAGGG + Intronic
913234423 1:116767645-116767667 CAGTGGCTCCAGAGGGAGGTAGG - Intronic
913255639 1:116950695-116950717 CAGTGGAGACAGAGGGGGCAGGG + Intronic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
914784742 1:150818056-150818078 GAGGGGGTGGAGAGGGAGGAAGG + Intronic
915346707 1:155201249-155201271 CAGGGAAAATATAGGGAGGAGGG - Intronic
915553427 1:156647970-156647992 GATGGGATACCTAGGGAGGAAGG - Exonic
915572034 1:156750086-156750108 GAGTGGGTACAGAGCGAGGAAGG + Intronic
915652901 1:157332211-157332233 CAGGGGAGGCAGAGGGAGACAGG - Intergenic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
915734446 1:158075909-158075931 CATGGGTCTCAGAGGGAGGAAGG + Intronic
915815749 1:158963009-158963031 CTGAGGATTCATAGGGAGGAGGG - Intronic
915820730 1:159021245-159021267 CAGGGGAAAGAGTGGGAGGGGGG - Intronic
916058549 1:161083993-161084015 CAGGGGATACTGATGGAGAAAGG - Intronic
916167689 1:161978368-161978390 CTGGGGATACAGAAGGCAGAGGG - Intergenic
916303492 1:163302598-163302620 CAAGGGAGCCAGAGGTAGGAGGG - Intronic
916427946 1:164699630-164699652 CAGGGGATGGAGAGGACGGAGGG + Intronic
916502205 1:165396681-165396703 CAGGGTATACAGCGAGAGGGAGG - Intergenic
916645195 1:166777860-166777882 CAGGAGAGAGAGAGAGAGGAAGG - Intergenic
916841950 1:168609862-168609884 CTGAGGAGACAGAGGGGGGAGGG + Intergenic
916996051 1:170302427-170302449 CAGTGGTTATAGAGTGAGGAAGG - Intergenic
917041242 1:170808474-170808496 CAGAGGAGAGACAGGGAGGAGGG + Intergenic
917337300 1:173938772-173938794 CAGAGGACCCTGAGGGAGGAGGG - Exonic
917408078 1:174730435-174730457 CAGGGGATACATATGCAGGTCGG - Intronic
917539566 1:175899694-175899716 TAAAGGAGACAGAGGGAGGATGG + Intergenic
918204341 1:182295900-182295922 CAAGAGAGACAGAGGAAGGAAGG - Intergenic
918313726 1:183305311-183305333 CAGGGGATAGAGTGGAAGGTGGG + Intronic
918682021 1:187367595-187367617 CAGAGGAGAGAGAGGCAGGAAGG + Intergenic
918807746 1:189071323-189071345 CAGGGGAAGCAAAGGGAGTAGGG + Intergenic
919613511 1:199776674-199776696 AAAGGAATAAAGAGGGAGGAAGG - Intergenic
920440761 1:205979092-205979114 GAGGGGAGACACAGGGAAGAAGG - Intronic
920771753 1:208892992-208893014 GAGGGGTTACAGCTGGAGGACGG + Intergenic
920780904 1:208990181-208990203 GAGGGGAAACAGAGGGAGAGGGG + Intergenic
921139174 1:212289262-212289284 CAGGAGATACACAGGGATTAAGG - Intronic
921320529 1:213934209-213934231 GAGGGGATAAAGAGGCAGCAGGG - Intergenic
921711249 1:218375761-218375783 TACGGGATATTGAGGGAGGAGGG + Intronic
922353009 1:224750286-224750308 CATGGGAGACAGAAGGAAGAGGG - Intergenic
922876058 1:228940700-228940722 CAGGGGACCCAGTGGGACGAGGG - Intergenic
922888117 1:229036242-229036264 CAGGGGAATCAGAGGAGGGAAGG - Intergenic
923321923 1:232842785-232842807 CAAAGGAAACAGATGGAGGATGG + Intergenic
923482570 1:234397715-234397737 GAGGGGGAAGAGAGGGAGGAGGG + Intronic
923543682 1:234908591-234908613 CAGGGGATAGAGGGGAAGCAAGG + Intergenic
924199930 1:241648063-241648085 CAGGGGACAAAGAGGTAGGCAGG - Intronic
924445622 1:244127784-244127806 CTGGGGATACAGAGGAAGGTGGG - Intergenic
924909994 1:248499647-248499669 CAGGGGATAGAGTGGAAGTAGGG + Intergenic
924914110 1:248548408-248548430 CAGGGGATAGAGTGGAAGTAGGG - Intergenic
1063187342 10:3663418-3663440 AAGGGGCTAGAGATGGAGGAAGG - Intergenic
1063362376 10:5469001-5469023 CAGGGGAAACAGACCCAGGAGGG + Intergenic
1063691884 10:8295568-8295590 AAGGGGAGAGAGAGGAAGGAAGG - Intergenic
1064209632 10:13351340-13351362 CAGAGGAGACACAGGGAAGATGG + Intergenic
1064392974 10:14957486-14957508 CCGGGGCTACAGAGGAAGGAGGG + Intergenic
1064504703 10:16015825-16015847 GAAGGGAGAGAGAGGGAGGATGG + Intergenic
1065813096 10:29460430-29460452 TAGTGAATACACAGGGAGGATGG + Intronic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1065995412 10:31055532-31055554 CAGGAGAGACAGAGTGAGGGGGG + Intergenic
1066076298 10:31881044-31881066 AGGGGGATAGAGATGGAGGAGGG - Intronic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1067337898 10:45379279-45379301 GAGGGGCTGGAGAGGGAGGAAGG - Intronic
1067460406 10:46454056-46454078 AAGGGAAGAGAGAGGGAGGATGG + Intergenic
1067546015 10:47193172-47193194 CAGGGGAAACAGAGGGCAGGAGG + Intergenic
1067626786 10:47930547-47930569 AAGGGAAGAGAGAGGGAGGATGG - Intergenic
1067908608 10:50320757-50320779 AAGTGGAGATAGAGGGAGGAAGG - Intronic
1068092917 10:52454996-52455018 GAGGGGGCACAGAGGGAGCAAGG - Intergenic
1068208839 10:53893790-53893812 CGGGGGACAGAGTGGGAGGAAGG + Intronic
1068850354 10:61731749-61731771 GAGGGAGGACAGAGGGAGGAAGG + Intronic
1068876462 10:62001665-62001687 AAGGGAAGACAGAGAGAGGAAGG + Intronic
1069726107 10:70580152-70580174 GATGGGAGACAGAAGGAGGAAGG - Intergenic
1069729760 10:70602946-70602968 CAGGGCACACAGGCGGAGGAGGG + Intergenic
1069859435 10:71461293-71461315 CAGGGGACTCCGAGGGAGAAAGG - Intronic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1071160687 10:82742109-82742131 CAGACGAGAGAGAGGGAGGAAGG - Intronic
1071249025 10:83796938-83796960 GAGGGGACAGGGAGGGAGGAGGG + Intergenic
1071295768 10:84218124-84218146 CAAGGGATGGAGAGGGAGAATGG + Intronic
1071895045 10:90057109-90057131 CAGGGGAAAAGGTGGGAGGAAGG + Intergenic
1072306092 10:94108636-94108658 CAGGGGAAGCAGGGGGTGGAGGG - Intronic
1072465047 10:95655977-95655999 CAGGGGATAATGATGGGGGAAGG + Intronic
1072730687 10:97844261-97844283 CAGGGCAAACAGAGAGGGGATGG - Intergenic
1073181192 10:101584574-101584596 CAGGGGCTAGAGTGGGAGGAGGG - Intronic
1073240672 10:102055930-102055952 GAGGGGAGAGGGAGGGAGGACGG - Intronic
1074509737 10:114101295-114101317 CAAAGGATGCAGAGCGAGGAGGG - Intergenic
1074532224 10:114305549-114305571 GAGGGGACACAGATGCAGGAGGG + Intronic
1074824090 10:117202150-117202172 CAGGGGTTGCAGAGAGAGGCTGG + Intronic
1074825866 10:117215597-117215619 CAGGGGATGGAGTGGGAGCATGG - Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075190566 10:120303368-120303390 CATGGGATTTAGAGGCAGGAGGG + Intergenic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075546188 10:123356621-123356643 CCGGTGACAGAGAGGGAGGATGG + Intergenic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1075805791 10:125187926-125187948 GTGGGGCTAAAGAGGGAGGAGGG - Intergenic
1075963025 10:126585560-126585582 CAGGAGAAAGAGAGGAAGGAAGG + Intronic
1076070000 10:127481828-127481850 CATGGGGTACAGAGAGTGGAAGG - Intergenic
1076667676 10:132102402-132102424 CATGGGGTACAGAGGGAGGAAGG - Intergenic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077467363 11:2739796-2739818 CAGGGGACAGAGAGAGGGGAGGG + Intronic
1077532518 11:3103867-3103889 ATGGGGCTACAGAGGCAGGAAGG - Intronic
1077543486 11:3158680-3158702 CAGGAGAGAGGGAGGGAGGAAGG + Intronic
1078173047 11:8944419-8944441 AAGGGGTTAGAGAAGGAGGAGGG - Intergenic
1078714740 11:13829104-13829126 GTGGGGAGACAGAGGGAGAAGGG - Intergenic
1079003354 11:16775588-16775610 CAGGGGTTAGAGAGAGAGGGAGG + Intergenic
1079400507 11:20103059-20103081 CAGGGGATGCAGAGTGGGCATGG - Intronic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1079601425 11:22316346-22316368 CAGGGGAGAGAGAGAGAGGCGGG - Intergenic
1079601533 11:22316748-22316770 CAGGGGAGAGAGAGAGAGGCAGG - Intergenic
1079964399 11:26963213-26963235 CAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1080480488 11:32644322-32644344 CAGGGCCTACTGAGGGTGGAGGG + Intronic
1080559830 11:33452778-33452800 CAGGGGACACACAGGGGCGAGGG - Intergenic
1080627418 11:34043075-34043097 CAGGAGAGACAGAGTGAGGGTGG + Intergenic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1081737836 11:45416717-45416739 CATGGGGAAGAGAGGGAGGAAGG - Intergenic
1081946835 11:47003357-47003379 GAGGGGACAGAGAGGAAGGAAGG + Intronic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1083670080 11:64294887-64294909 CAGGGCAGAGAGAGGGAGGGAGG + Intronic
1083888415 11:65583906-65583928 CAGGGCATCCTGAGAGAGGAGGG - Intronic
1084421849 11:69064279-69064301 CGGGGGATAGGGAGGGGGGAGGG - Intronic
1084913365 11:72409122-72409144 CAGGGGCTAGAGAGGCAGGGTGG + Intronic
1085010498 11:73137694-73137716 CAGGTGAAAAAGTGGGAGGAAGG + Intronic
1085071193 11:73547552-73547574 CTTGGGATGCAGAGGCAGGAGGG + Intronic
1085510697 11:77086704-77086726 CAGGGGATGGAGTGGGAGGAGGG - Intronic
1085919714 11:80938178-80938200 CAGGGGAATCAGTGAGAGGAGGG - Intergenic
1086114239 11:83230387-83230409 TAGGGGAGTCAGAGGGAGGTAGG - Intronic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1086719323 11:90100882-90100904 CAGGGGACAGAAAGGAAGGATGG + Intergenic
1087576524 11:99996793-99996815 CAGGAGAGAGAGAGGGAGCATGG + Intronic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1088327657 11:108617283-108617305 GAGAGGATAAGGAGGGAGGATGG + Intergenic
1088576730 11:111279443-111279465 CAGAGGCTCCAGAGGGAGCATGG - Intronic
1088920266 11:114255477-114255499 ACGGGGAGCCAGAGGGAGGAGGG - Intergenic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090386036 11:126358002-126358024 CAGGGGATGGAGAGGGAGCTTGG + Intronic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1090716509 11:129436616-129436638 AAGGAGGTACAGATGGAGGAAGG - Intronic
1090949868 11:131464096-131464118 GAGGGGCTGCTGAGGGAGGAGGG + Intronic
1091113810 11:132995462-132995484 AAGGAGAGACAGAGGGAAGAAGG - Intronic
1091250740 11:134141756-134141778 CAAGGGGCACAGAGGGAGGCAGG + Intronic
1091284779 11:134402521-134402543 CAGGTGTAACAGAGGGAGGTGGG - Intronic
1091637234 12:2206230-2206252 AAGGAGATCCAGAGGGAAGAAGG + Intronic
1091691723 12:2601761-2601783 CAAGGGATGCTGTGGGAGGAAGG + Intronic
1091831820 12:3555491-3555513 CAGGGATCAGAGAGGGAGGAGGG + Intronic
1092041047 12:5384672-5384694 CATGGGATACAGAGAGAAGCAGG - Intergenic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092776056 12:11946103-11946125 GAGTGGGTACAGAGGAAGGATGG + Intergenic
1093411824 12:18877126-18877148 CAGGGCATAGGGATGGAGGAAGG + Intergenic
1094466850 12:30762501-30762523 CAGAGGAGACACAGGGAAGAAGG + Intergenic
1096245855 12:49985737-49985759 CAAGAGTTACAGAGGGAGAAAGG + Intronic
1096255328 12:50058737-50058759 GAGGGGATCCTGGGGGAGGAGGG - Exonic
1096421885 12:51465741-51465763 AAGGGGCTACAATGGGAGGAAGG - Intronic
1096748646 12:53744893-53744915 CAGGGGAAGCAGAGAGAGAATGG - Intergenic
1097232441 12:57520853-57520875 CAGGGGACACCGAGGGTGGTGGG + Intronic
1097607577 12:61774663-61774685 CGGGGGAAAGAGTGGGAGGATGG + Intronic
1097746749 12:63311634-63311656 CTGGGCTTACAGAGGGAGAAAGG + Intergenic
1098281719 12:68868692-68868714 GACAGGATACAGTGGGAGGAGGG - Intronic
1098285540 12:68903789-68903811 AAGGAGAGACAGAGGGAGGGAGG - Intronic
1098469090 12:70823759-70823781 CGGAGGATTCAGAGGCAGGAAGG + Intronic
1100103428 12:91138639-91138661 AATGGGAGACAGAGGGAGTAAGG + Intergenic
1100619104 12:96254859-96254881 CAGGGTAGACAGGGAGAGGAAGG + Intronic
1100792254 12:98143404-98143426 CAGGAACTAGAGAGGGAGGAGGG + Intergenic
1100935503 12:99660843-99660865 GGTGGGATACAGAGGGAGGTAGG - Intronic
1101075899 12:101129598-101129620 CAGGGGAAACGGTGGAAGGAGGG + Intergenic
1101286039 12:103313717-103313739 CAGGAGCTACAGAGGGAGAGAGG - Intronic
1101638305 12:106565878-106565900 AAGGGGGTAGGGAGGGAGGAAGG + Intronic
1101731360 12:107429025-107429047 CAGGGGAAAGAGAGGGAGAGAGG + Intronic
1102074363 12:110048254-110048276 CAGGGGATAGAGTGGGGAGATGG - Intronic
1102393294 12:112567077-112567099 CAGGAGAGAAAGAGCGAGGAGGG - Intergenic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1102655804 12:114481333-114481355 CTGGCGCTGCAGAGGGAGGAAGG + Intergenic
1102736504 12:115165608-115165630 CAGGGGAGATAGAGAGAGGTTGG - Intergenic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103147744 12:118610245-118610267 CAGGTGATGCAGAGTGAGGCAGG - Intergenic
1103367687 12:120394957-120394979 TTGGGGATGCAGAGGCAGGAAGG + Intergenic
1103610908 12:122123805-122123827 CTGGGGAGACTGAGGCAGGAAGG - Intronic
1104074988 12:125381023-125381045 CAAGAGATACAGAGAGAGAAAGG + Intronic
1104437488 12:128767385-128767407 CAGGGGGGAGGGAGGGAGGAAGG + Intergenic
1104846123 12:131847870-131847892 CAGGGGACAGAGGGGGAGCAGGG - Intronic
1105265322 13:18809839-18809861 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1105510140 13:21044835-21044857 CATGGGATGCTGAGGCAGGAGGG - Intronic
1105607665 13:21940133-21940155 TTGGGGATACAGAGGGGGCATGG + Intergenic
1105865054 13:24451691-24451713 CAGGGGCCACAGAGGCAGGCAGG + Intronic
1105887713 13:24656452-24656474 GAGGGGAGAGAGAGGAAGGAGGG - Intergenic
1106286742 13:28324505-28324527 CCGGGGTTGCAGAGGGAGGCAGG + Intronic
1106602485 13:31199944-31199966 CGGCGGAGACGGAGGGAGGAGGG + Exonic
1106728865 13:32517848-32517870 CAGGGGAGACAGAGGTGGGGAGG - Exonic
1106953245 13:34907715-34907737 AGGGGAATACAGAGGGAAGAAGG - Intergenic
1107527291 13:41245880-41245902 ACAGGGATAAAGAGGGAGGAAGG - Intronic
1107655417 13:42588282-42588304 CAGGGGAGACCCAGGGAAGAAGG + Intronic
1108032517 13:46250031-46250053 CACGGAATAATGAGGGAGGAAGG - Intronic
1108087131 13:46805128-46805150 CAGGAGAGACAGAGAGAGAAGGG - Intergenic
1109006603 13:56885492-56885514 CATGGAACAGAGAGGGAGGAAGG + Intergenic
1109617766 13:64859152-64859174 CAGGGGAAAGAGTGGGAGTAGGG - Intergenic
1110282011 13:73704807-73704829 CTGGGGATACAGTGGTAAGAAGG - Intronic
1111057221 13:82967177-82967199 CATGGGATACAAAGGGAAGGAGG + Intergenic
1111736476 13:92146657-92146679 TGGGGGAAACAGTGGGAGGAGGG - Intronic
1112201865 13:97284257-97284279 CAGGGGCTTCAGAGGGAGCGTGG - Intronic
1112219196 13:97470843-97470865 GTGGGGATACAGAGGCAGGTTGG + Intergenic
1112306031 13:98274404-98274426 CAGAAGAGACTGAGGGAGGAAGG + Intronic
1112368967 13:98778158-98778180 AAGGGGATACAGACGGAAGGTGG + Intergenic
1112497532 13:99916534-99916556 TGGGGGATGAAGAGGGAGGAAGG - Intergenic
1112638525 13:101245143-101245165 CAGGGGCTGCAGACTGAGGAGGG - Intronic
1113433318 13:110268834-110268856 CAGGTGAGACACAAGGAGGAGGG + Intronic
1113615156 13:111675333-111675355 CAGGGGCTTCCGAGGGAGCAGGG - Intergenic
1113620623 13:111760246-111760268 CAGGGGCTTCCGAGGGAGCAGGG - Intergenic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114525323 14:23364490-23364512 AAGAGAAGACAGAGGGAGGAGGG - Intronic
1116198643 14:41761269-41761291 CAGGAGAAAGAGAGGAAGGAAGG + Intronic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117834341 14:59786624-59786646 TATAGGATAAAGAGGGAGGATGG + Intronic
1118615150 14:67569928-67569950 CAGGGGAAACAAGGGCAGGAGGG - Exonic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119065871 14:71525917-71525939 AACGCAATACAGAGGGAGGAAGG - Intronic
1119140316 14:72261377-72261399 CAGGTCATACAAAAGGAGGAGGG + Intronic
1119191714 14:72687552-72687574 TAGGGGATGCAGAGGAAAGATGG - Intronic
1119611347 14:76065493-76065515 CAAGGGAGAGAGAGGAAGGATGG - Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1120716200 14:87843510-87843532 GAGGGGAGAAGGAGGGAGGAAGG - Intronic
1120953860 14:90064340-90064362 CAGTGGGCACAGAGGCAGGAAGG + Intronic
1121003090 14:90465976-90465998 CAGGGGAGAGAGAGGGAGACTGG + Intergenic
1121308923 14:92924232-92924254 AAGGGGATACCGAGGTAAGAAGG + Exonic
1121409268 14:93737969-93737991 CAGGGGATGCTGAGGGAGGAAGG + Intronic
1121409351 14:93738434-93738456 AAGGGGATGATGAGGGAGGAAGG + Intronic
1121497343 14:94402983-94403005 CAGGGGAAAGAAAGGAAGGAAGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122153096 14:99735062-99735084 TAGGGGATGCGGAGGGACGAGGG + Intergenic
1122168752 14:99853343-99853365 CAGTGGAAACAGGGGCAGGAGGG + Intronic
1122171051 14:99876130-99876152 CAGAGGAGACAGAGAGGGGAAGG + Intronic
1122246284 14:100405511-100405533 CAGGGGATGGGGAGGGAGGCTGG + Intronic
1122257001 14:100485703-100485725 CATGTGTTCCAGAGGGAGGAGGG + Intronic
1122348281 14:101073636-101073658 CTGGGGCTGCAGAGGGAGGCCGG - Intergenic
1122672331 14:103382256-103382278 AAGGGGAAAAAGAGAGAGGAAGG + Intergenic
1122917935 14:104867354-104867376 CAGGGAACACAGAGGCAGGGCGG - Intronic
1202833170 14_GL000009v2_random:58277-58299 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1124587623 15:31024324-31024346 CAAGGGATAAGGTGGGAGGATGG - Intronic
1125135532 15:36336957-36336979 CAGGGGAGAAAGAGGTAGGCTGG - Intergenic
1125236843 15:37524618-37524640 CAGAGGCTCCAGAGGGAGCATGG - Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125510414 15:40289675-40289697 CAGGGGATGAAGAGGGAGTGAGG - Intronic
1125668576 15:41452627-41452649 CAGAGGCTAAAGTGGGAGGATGG + Intronic
1126045460 15:44635496-44635518 CTGGGGATGCTGAGGCAGGAGGG + Intronic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127399624 15:58573078-58573100 GAAGGGATTGAGAGGGAGGAGGG - Intergenic
1127633547 15:60848373-60848395 TAAGGGAAAAAGAGGGAGGAAGG + Intronic
1128396198 15:67228979-67229001 GAGGGGAGACAGTAGGAGGAGGG + Intronic
1128690534 15:69721436-69721458 AAGGGGAGACAGAGAGAGGGAGG - Intergenic
1129604452 15:77018030-77018052 CAGGGGAGATGGAGGCAGGAGGG + Intronic
1129876450 15:78978789-78978811 CAGGGCACACAGAGGAGGGAGGG - Intronic
1129901669 15:79156361-79156383 GAGGGGAGACAGAGAGATGAGGG - Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130172657 15:81531692-81531714 CAGTGGGCACTGAGGGAGGAGGG - Intergenic
1130403459 15:83578272-83578294 CAGGGGCTCCGGAGGGAGGCAGG - Intronic
1130894380 15:88158969-88158991 CAAGGGATAGAGAGGGAGAAGGG + Intronic
1130941302 15:88511561-88511583 CAGTGGAGACAGATGAAGGAAGG - Intronic
1131074488 15:89486722-89486744 CAGGTGAGCCTGAGGGAGGAGGG - Intronic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131646635 15:94351983-94352005 CAGAGGAAACTGAGGAAGGATGG - Intronic
1131947887 15:97647961-97647983 TAGGGGAAACTGAGGGAGGGGGG + Intergenic
1132226997 15:100150571-100150593 GAGGAGGGACAGAGGGAGGAAGG - Intronic
1132358446 15:101191406-101191428 CAGGGGTTACAGGGGAAGGAAGG + Intronic
1132537335 16:489025-489047 CACGGGAAGAAGAGGGAGGAGGG - Intronic
1132758161 16:1495998-1496020 CAGGGAAAACAGAGCGAGCATGG - Intronic
1132997912 16:2832896-2832918 AAGTGGAGACAAAGGGAGGAGGG + Intronic
1133037739 16:3043809-3043831 TAGGGGATAAAGTGGGATGAGGG - Intergenic
1133103942 16:3494881-3494903 CAGAGGAGACAGCGGGAGGGTGG + Intronic
1133221824 16:4322148-4322170 CAGGGGATCCTGAGGAAGGGGGG + Intronic
1133313592 16:4867737-4867759 CAGAGGATGCAGTGAGAGGAAGG + Intronic
1133342714 16:5047137-5047159 AGGGGGAGACAGAGAGAGGAAGG - Intronic
1133507030 16:6422389-6422411 GAGGGGAAAGACAGGGAGGAGGG - Intronic
1133589574 16:7229640-7229662 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589602 16:7229747-7229769 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589611 16:7229783-7229805 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589620 16:7229819-7229841 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589625 16:7229837-7229859 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589634 16:7229873-7229895 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589639 16:7229891-7229913 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589644 16:7229909-7229931 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589649 16:7229927-7229949 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589654 16:7229945-7229967 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589659 16:7229963-7229985 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589664 16:7229981-7230003 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133720364 16:8488966-8488988 GGGGGGAGGCAGAGGGAGGAAGG + Intergenic
1133771009 16:8867274-8867296 CAGGGGTCACAGAGGGAGTGGGG - Intronic
1134692038 16:16197493-16197515 CAGAGGGAAGAGAGGGAGGACGG + Intronic
1135179373 16:20259547-20259569 CAGGGGGTAAAAAGGGAGGGAGG + Intergenic
1135224925 16:20647468-20647490 TAGGGGTTACAGAAGGATGAAGG - Intronic
1135495022 16:22943821-22943843 AGGGGGATACAGAAGGATGAGGG + Intergenic
1135628997 16:24021376-24021398 CAGGTGAGAGAGATGGAGGAGGG - Intronic
1135920023 16:26641541-26641563 CAGGGGAGGGAGATGGAGGATGG - Intergenic
1137396363 16:48118276-48118298 CAGAGAAAACCGAGGGAGGAGGG - Intronic
1137421632 16:48339914-48339936 CAGGGGTTTCAGAGGTAGCATGG + Intronic
1137758794 16:50923963-50923985 AAGGAGAAAAAGAGGGAGGATGG + Intergenic
1137887915 16:52126519-52126541 GAGGGGATAGTGAGAGAGGAAGG - Intergenic
1137977260 16:53042295-53042317 GAGGGGAGACGGAGGGAGGAAGG - Intergenic
1138130622 16:54476602-54476624 GAGGGGAGACAGAGGGAGGGGGG + Intergenic
1138495889 16:57409181-57409203 CTGGGGACATAGAGGAAGGAAGG + Intronic
1138518609 16:57555955-57555977 CAGGGGAGAGAGAGAGAGAAGGG - Intronic
1138988513 16:62361525-62361547 AAGGGGAGAGAGAGGGAGGGAGG + Intergenic
1140177660 16:72679951-72679973 CAGGGGCTGCAGGGTGAGGAGGG + Intergenic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1140328236 16:74026885-74026907 AAAGGGAGAGAGAGGGAGGAAGG + Intergenic
1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG + Intergenic
1140734208 16:77883765-77883787 CATCGGATGAAGAGGGAGGAGGG - Intronic
1140967696 16:79983111-79983133 GAGGGAAGAGAGAGGGAGGAAGG - Intergenic
1141161081 16:81629545-81629567 AAGGAGACAGAGAGGGAGGAAGG - Intronic
1141244868 16:82296487-82296509 CAGGGGAAAGTGTGGGAGGAGGG - Intergenic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141692701 16:85605642-85605664 CCGGGGGTGCAGGGGGAGGATGG - Intergenic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1142281030 16:89147536-89147558 GAGGGGCCACAGAGCGAGGAGGG + Intronic
1142399710 16:89852523-89852545 CAGGGGATCCGGGGGGTGGAGGG - Intronic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142693576 17:1621250-1621272 CCGGGGAGACAAAGGGAGGGGGG + Intronic
1142742693 17:1940424-1940446 GAGGGGAAACTGAGGTAGGAGGG - Intronic
1142869317 17:2809921-2809943 CAGAGGAGCCAGCGGGAGGAAGG - Intronic
1144196951 17:12903743-12903765 CAGGGGAAAGGGTGGGAGGAGGG - Intronic
1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG + Intronic
1144708515 17:17385459-17385481 CAGGGGCTGCAGAGGGGGGATGG - Intergenic
1145023866 17:19453231-19453253 CAGGGGATCCTGGGTGAGGATGG - Intergenic
1145866715 17:28246553-28246575 CCAGGGAGACAGTGGGAGGAGGG + Intergenic
1146122456 17:30207732-30207754 CAGGAGAAACAGAGGGCTGATGG + Exonic
1146945239 17:36869158-36869180 CAGAGGTCACAGAGGGAGGAGGG + Intergenic
1147050143 17:37788239-37788261 AAGGGGAGAGGGAGGGAGGAGGG - Intergenic
1147498753 17:40942321-40942343 GAGGGGGAAGAGAGGGAGGAGGG - Intergenic
1147587525 17:41660881-41660903 CAGGGGATTCACCAGGAGGAGGG + Intergenic
1147909837 17:43848927-43848949 CAGGAGCTGCAGAGGGAAGAGGG + Intronic
1148492537 17:48032603-48032625 CAGGAGAAAAACAGGGAGGAAGG + Intronic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1148774799 17:50089285-50089307 AAGGGGACACTGGGGGAGGAGGG - Exonic
1149176305 17:53876082-53876104 TAGGGGGTGCAGGGGGAGGAAGG - Intergenic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1149560467 17:57604703-57604725 CAGGGGATTCTGGGGAAGGAAGG + Intronic
1149774521 17:59346704-59346726 TAGAGGATACAGAGGCAGAAAGG + Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1150645689 17:66976317-66976339 GAGGAAAGACAGAGGGAGGAGGG - Intronic
1151320730 17:73350829-73350851 CAGGAGATTTGGAGGGAGGAGGG - Intronic
1151560330 17:74866392-74866414 CAGGGGCTGCAGAAGGAGGCCGG - Intronic
1151762322 17:76112290-76112312 GGAGGGAGACAGAGGGAGGAAGG + Intronic
1152041563 17:77906898-77906920 CATGTCTTACAGAGGGAGGATGG + Intergenic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1152739620 17:82013227-82013249 GAGGGGATGGAGACGGAGGAAGG - Intronic
1153273754 18:3348592-3348614 CAGGGTATAATGAGGTAGGAAGG - Intergenic
1153498938 18:5728826-5728848 CAGGAGGTACAGAAGGAGGTCGG - Intergenic
1153987797 18:10368627-10368649 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
1154326769 18:13396865-13396887 CTGTGGATACAGAGGGCTGACGG + Intronic
1154423073 18:14251690-14251712 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1155734681 18:29205873-29205895 CAGGTGATACACATGCAGGATGG - Intergenic
1156483451 18:37450404-37450426 CAGGGGAGAGGGAGGGAGGGAGG - Intronic
1157382545 18:47232560-47232582 CTGGGGACACAGAGGAGGGATGG - Intronic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1157569901 18:48705348-48705370 GAGGAGACACAGAGGGATGAAGG - Intronic
1157609824 18:48949463-48949485 AAGGGGGTGCAGAGGGAGGTGGG - Intronic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1158391892 18:57051188-57051210 CAGGGGATAGAGAGGAGGGAGGG - Intergenic
1158440578 18:57471130-57471152 GAGGGGATGCAAAGGGAGGCGGG - Intronic
1159453564 18:68633036-68633058 CAGGGGAAAGGGTGGGAGGAGGG - Intergenic
1159664432 18:71140809-71140831 AAGGGGAGAGAGAGAGAGGAAGG + Intergenic
1160222954 18:76990471-76990493 CAGGGGATGGTGAGGGATGAGGG + Intronic
1160400314 18:78605964-78605986 CTTAGGATGCAGAGGGAGGATGG - Intergenic
1161286004 19:3468561-3468583 CAGGGCATACAGTGGGGGGTGGG + Intronic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161458408 19:4381556-4381578 CAGGGGGAACAGAGAGAGGCAGG - Intronic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1161503820 19:4633221-4633243 CTAGGGGTAGAGAGGGAGGAGGG + Intergenic
1161616601 19:5274345-5274367 CTGGGGATACAGTGGAAAGAAGG + Intronic
1161664214 19:5565143-5565165 CAAGGGGGAGAGAGGGAGGAAGG - Intergenic
1161717780 19:5886526-5886548 AAAGAGATACACAGGGAGGAAGG + Intronic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1161756619 19:6138587-6138609 GAGGGAAGAGAGAGGGAGGAAGG + Intronic
1161840809 19:6679291-6679313 CAGGGGATACCAAGGGGGGTAGG - Intronic
1161845016 19:6707378-6707400 CAGGAGCCAGAGAGGGAGGAGGG - Intronic
1161849581 19:6731549-6731571 CAGGGGAGACTGAGGGTGGGAGG + Intronic
1161851842 19:6741200-6741222 AAGGGGAGACAGAGGTAGGAGGG - Intronic
1162085614 19:8247254-8247276 CAAGGGGGAGAGAGGGAGGAGGG - Intronic
1162154558 19:8668357-8668379 CCGAGGATACAGAGGAATGATGG + Intergenic
1162582793 19:11540703-11540725 CAGGGGGCACAGAGGGGGCAGGG + Intronic
1162861009 19:13505870-13505892 GAGGGGAGGCGGAGGGAGGAGGG + Intronic
1163501031 19:17676363-17676385 CAGGGGATGCAGGGAGAGGGAGG - Intronic
1163548541 19:17952680-17952702 GAGGGGACAGAGAGGGAGGAGGG - Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163668084 19:18612443-18612465 CAGGGAACGGAGAGGGAGGAAGG - Intronic
1163821637 19:19499541-19499563 CCCAGGATACAGAGGGAGGAGGG + Intronic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164703489 19:30302911-30302933 CAGGGGGTAAAAAGGGATGAAGG - Intronic
1164727515 19:30476184-30476206 CTGGGGCCACAGAGGGAAGAAGG - Intronic
1165357227 19:35311733-35311755 CAGGGGCCACAGAGGTGGGAAGG + Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165742419 19:38211841-38211863 CAAGGGACAGAGAGGGAGGGAGG + Exonic
1165828600 19:38719514-38719536 GAGTGGATAGTGAGGGAGGAAGG + Intronic
1165833726 19:38742479-38742501 CCGGGGATACAGAGTAAGGGAGG + Exonic
1166147399 19:40847052-40847074 CTGGGGTTGCAGAGAGAGGATGG + Intronic
1166151548 19:40878937-40878959 CTGGGGTTGCAGAGAGAGGATGG + Intronic
1166170420 19:41024441-41024463 CTGGGGTTGCAGAGAGAGGATGG + Intergenic
1166178639 19:41091709-41091731 CTGGGGTTGCAGAGAGAGGATGG - Intronic
1166179072 19:41094477-41094499 CTGGGGACACAGAGAGAGGCTGG - Intronic
1166552526 19:43675777-43675799 CTGGGGATAGAGATGGAGGTGGG + Intergenic
1166736001 19:45085251-45085273 CAGGTCACAAAGAGGGAGGAAGG - Intronic
1166750361 19:45161595-45161617 CAGGGCACACAGAGGCAGGGCGG + Intronic
1166802986 19:45469455-45469477 CCGGGGACAGAGAGGGGGGAAGG - Intronic
1167306165 19:48710987-48711009 CATGGGTCACAGAGGGAGGGAGG - Intergenic
1167669139 19:50839458-50839480 CTGGGGAGTCTGAGGGAGGAGGG + Intergenic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
1202639497 1_KI270706v1_random:69433-69455 CTGGGGATGCAGACAGAGGAGGG + Intergenic
925079660 2:1053972-1053994 CAGGGCCTGCAGAGGGAGGAGGG - Intronic
925428493 2:3771132-3771154 CGGAGGATGCAGAGGGAGGACGG - Intronic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
926001405 2:9336290-9336312 CAGGGGAGAGAAAGGGAGGGAGG - Intronic
926142662 2:10377604-10377626 CACGGGAGCCAGGGGGAGGAGGG - Intronic
926697724 2:15782454-15782476 CAGGGGTGGGAGAGGGAGGATGG - Intergenic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
927352491 2:22133754-22133776 CAAATGATAGAGAGGGAGGAGGG - Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927680185 2:25133770-25133792 CAGGGGACACAGAGGGGAAAAGG - Intronic
928316815 2:30252813-30252835 CAGGGCTGGCAGAGGGAGGAAGG + Intronic
928395937 2:30943373-30943395 CAGTGGATCCAGAGGGTGAAGGG + Intronic
928629654 2:33177961-33177983 CAGGGGGTACAGAGGGGTGCAGG - Intronic
928985100 2:37173273-37173295 CGGGGGCTACTGAGGTAGGAAGG - Intronic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
929778885 2:44944773-44944795 GAGGGGAAGGAGAGGGAGGAGGG - Exonic
929834478 2:45382489-45382511 ATGGGGTAACAGAGGGAGGAAGG - Intergenic
930118720 2:47742268-47742290 CAGGGGAGACAGTGGTGGGAGGG - Intronic
930265980 2:49199542-49199564 CAGGGGACACAGAGGGACAATGG - Intergenic
930700422 2:54455108-54455130 GCGGGCATTCAGAGGGAGGAGGG - Intergenic
931212254 2:60208354-60208376 CAGTGGAGACAGAGGCAGGTTGG - Intergenic
931812900 2:65872382-65872404 AAGGGGACAAAGAGGAAGGAGGG + Intergenic
932411728 2:71551557-71551579 CAGGGGAGACAGAGGGGAGGAGG - Intronic
932451409 2:71813000-71813022 CAGGTGGGCCAGAGGGAGGAGGG - Intergenic
933990244 2:87628651-87628673 CAAGGGAGACAGAGGGTGGAGGG + Intergenic
934097913 2:88624682-88624704 CAGGACATCCAGAGGGAGGTAGG - Intronic
934138590 2:89022044-89022066 GAGGGGAGACAAAGGGAGGAAGG - Intergenic
934230655 2:90178519-90178541 GAGGGGAGACAAAGGGAGGAAGG + Intergenic
934494982 2:94788883-94788905 CTGGGGATGCAGACAGAGGAGGG + Intergenic
934762801 2:96865633-96865655 CTGGGGACACCGAGGTAGGAGGG + Intronic
935280320 2:101511735-101511757 TGGGGACTACAGAGGGAGGAGGG + Intergenic
935337372 2:102029192-102029214 GAGGGGACAGAGAGGAAGGAAGG - Intergenic
935653250 2:105399417-105399439 CGGGGGAGGCGGAGGGAGGAGGG + Intronic
936093874 2:109517290-109517312 CCGGGGATAAAGAGGGGGGCTGG - Intergenic
936255094 2:110904440-110904462 CAGGAAAGACAGAGGCAGGAGGG - Intronic
936303602 2:111322173-111322195 CAAGGGAGACAGAGGGTGGAGGG - Intergenic
936499860 2:113058684-113058706 CAGGAAAGACAGAGGAAGGAAGG + Intronic
936616697 2:114055355-114055377 CAAGGGATGCAGATGGAGGGAGG - Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937757382 2:125556768-125556790 CAGGAGAAACAGAGAGAGGCAGG - Intergenic
937904528 2:127046391-127046413 CTGCGGATCCAGAGGGAGGGAGG - Intergenic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
938313585 2:130311269-130311291 CAGGGAATCCAGAGGGAGTGAGG - Intergenic
938826819 2:135013857-135013879 CAGAGGATCAAGAGAGAGGAGGG - Intronic
939158882 2:138561864-138561886 GAGGGGGTAGAGAGGGAGGGGGG - Intronic
939223858 2:139339874-139339896 GAGGGGACAGAGAGAGAGGAGGG + Intergenic
939223862 2:139339892-139339914 GAGGGGAGAGAGAGAGAGGAGGG + Intergenic
939237091 2:139508733-139508755 CAAGGCATACAGAGGAGGGAGGG + Intergenic
939683422 2:145167927-145167949 CAGAGGATACACTGGGAAGATGG + Intergenic
940029334 2:149244313-149244335 AAGGGAAGAAAGAGGGAGGAGGG - Intergenic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941619301 2:167758426-167758448 CTGGGGATACAAAGAAAGGAAGG + Intergenic
941857587 2:170246636-170246658 CAGAGGCTTCAGAGGGAGCATGG + Intronic
942218968 2:173750602-173750624 CAGGGCATAGAGAGGAAAGAGGG + Intergenic
942654029 2:178195415-178195437 CCGGGGATGCTGGGGGAGGAGGG + Intronic
942864728 2:180659597-180659619 TAAGGGATACAGTGTGAGGAGGG + Intergenic
943704846 2:191023485-191023507 CAGGGGAAACAGAGAGAACATGG + Intergenic
943794321 2:191972535-191972557 AAGGGGACACAGAGGAAGCAGGG + Intronic
943919152 2:193679978-193680000 CAAGGGAAACAGAGAAAGGAAGG + Intergenic
943997179 2:194784720-194784742 AAGGAGAGACAAAGGGAGGAAGG + Intergenic
944863874 2:203841449-203841471 CAGGGCTTCCAGAGGGTGGAGGG + Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
945965751 2:216184881-216184903 CAGGGCATACAGAAGAAGGGAGG - Intronic
945991683 2:216400838-216400860 CAGGGAATACAGAATCAGGAAGG - Intergenic
945996717 2:216443257-216443279 TATGGGAGACTGAGGGAGGAGGG + Intronic
946129403 2:217594122-217594144 TAGGGGATAAGAAGGGAGGAAGG + Intronic
946171160 2:217896557-217896579 CATAGGATTCAGAGGGAGCATGG + Intronic
946748475 2:222869337-222869359 CAGGGGAGCCAGAGAGATGAAGG - Intronic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947243476 2:228020961-228020983 CAGTGGGTACAGAAGGAGAAGGG + Intronic
947442812 2:230138009-230138031 CAGAAGACACAGAGGGAGGTAGG - Intergenic
947526181 2:230878102-230878124 CAGGGGGTTCTGGGGGAGGAGGG - Exonic
947537309 2:230948299-230948321 CAGGAGATGGGGAGGGAGGAAGG - Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947736776 2:232459300-232459322 AAGGGGATGCGGAGGGAAGAAGG - Exonic
948318921 2:237053500-237053522 CCTGGGATCCAGAGGGTGGATGG - Intergenic
948827189 2:240578421-240578443 CAGGGGACACAGGGAGAGGATGG + Exonic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
1168832562 20:854607-854629 CGGTGGACACTGAGGGAGGAGGG - Intronic
1170773193 20:19352014-19352036 CAGGGGATACCGATGAAGGAGGG + Intronic
1170808431 20:19654454-19654476 CAGAGCATACAGAGTGAGAAGGG - Intronic
1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG + Intronic
1171151431 20:22829501-22829523 GAGGGGAGAGAGCGGGAGGAGGG - Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171358911 20:24572828-24572850 CAGGGGTTAAGGATGGAGGAAGG + Intronic
1171885971 20:30652659-30652681 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1171886165 20:30653789-30653811 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1172022967 20:31927544-31927566 TAGTGGATACAGAGGTAGAAAGG + Intronic
1172479027 20:35260203-35260225 AGGGGGAGACAGAGGGAGCAGGG - Intronic
1172837520 20:37882568-37882590 CCGGGGACACAGAGTCAGGAGGG + Intergenic
1172839296 20:37892551-37892573 TAGGGGCTTCAGAGGGATGAGGG + Intergenic
1172984843 20:38976758-38976780 TAGGGGCTGCAGAGGGAAGAGGG - Intronic
1173104803 20:40123741-40123763 CAGAGGATAGAGAGGAAGAAAGG - Intergenic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1174556588 20:51399982-51400004 CAGGTGAGACACGGGGAGGAGGG - Intronic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1175127961 20:56766541-56766563 CAGGGGAGAGAGAGAGAGAAAGG - Intergenic
1175546216 20:59779608-59779630 CAGGGGAAAGAGAGGGAGAGAGG - Intronic
1175547162 20:59785839-59785861 CAGGGGATGCAGAGGGCTGCTGG - Intronic
1175547172 20:59785891-59785913 CAGGGGATGCAGAGGGCCGTTGG - Intronic
1175790319 20:61736592-61736614 AAGGGGAGAGGGAGGGAGGAAGG + Intronic
1176647827 21:9367032-9367054 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1177125198 21:17185250-17185272 CTGGGTTTATAGAGGGAGGAAGG - Intergenic
1177381984 21:20355893-20355915 CAGGGGCTACATTGAGAGGATGG + Intergenic
1177708593 21:24740916-24740938 GAGGGGAGAGAAAGGGAGGAGGG - Intergenic
1179066449 21:38029018-38029040 CAGGGAACACACAGAGAGGAAGG + Intronic
1179182514 21:39057798-39057820 CAGGGGATACAGGGACAGAAAGG + Intergenic
1179285351 21:39973200-39973222 CAGGGGAGACAGATGCAGGGCGG - Intergenic
1179540860 21:42082606-42082628 AGGAGGACACAGAGGGAGGAGGG - Intronic
1180186868 21:46144560-46144582 GGAGGGAGACAGAGGGAGGAGGG - Intronic
1180226758 21:46398056-46398078 CAGGAGATTCAGAGGCTGGAGGG + Exonic
1180362445 22:11912437-11912459 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1181006026 22:20013978-20014000 CTGGGGAGACTGAGGCAGGAGGG - Intronic
1181395485 22:22618387-22618409 CAAGGGACACAGAGAGGGGAGGG - Intergenic
1181410024 22:22712234-22712256 CAAAGGAAACAGAGAGAGGAGGG - Intergenic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181484736 22:23223601-23223623 CAGGGGGTACTCAGGGAGGAGGG + Intronic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1181527342 22:23497569-23497591 GAGGGCATCCAGAGGGAGGAGGG - Intergenic
1181762431 22:25067521-25067543 CAGGGAACACAGAGGGTGAAAGG - Intronic
1182069627 22:27454517-27454539 CAGGTGATACAGAGAGTTGATGG + Intergenic
1182573767 22:31259080-31259102 AAGGGTGTACAAAGGGAGGAAGG - Intronic
1183085378 22:35483693-35483715 GAGGGAAGAAAGAGGGAGGAAGG + Intergenic
1183689201 22:39378788-39378810 CCTGGGCTGCAGAGGGAGGATGG - Intronic
1183808725 22:40236273-40236295 CAGAGGATACAAAGGGGGGTAGG - Intronic
1184643161 22:45882856-45882878 GAGGGGACACCTAGGGAGGAGGG + Intergenic
1185117539 22:48946143-48946165 CAGGGCATACGGAGGGAGGGAGG + Intergenic
1185359962 22:50400200-50400222 CAAGGGAAACACTGGGAGGAAGG + Intronic
949596129 3:5549026-5549048 CAAGGGATACAGAGGAAACATGG + Intergenic
949603316 3:5625707-5625729 CAGGGGCTACAGGGGAGGGAAGG - Intergenic
949702589 3:6776301-6776323 CAGGGGGTAGAGGGGGAGCAGGG - Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950699033 3:14727390-14727412 CAGGGGCTCCAGATGGATGATGG - Intronic
951616021 3:24545042-24545064 CAAAGGATTCAGAGGGAGCATGG + Intergenic
951778051 3:26332136-26332158 CTGGAGATACTGAGAGAGGAGGG + Intergenic
951891603 3:27572872-27572894 TAGGAGGTAGAGAGGGAGGAAGG - Intergenic
952295272 3:32056696-32056718 CAAGGGTTGCAGAGGGACGAAGG - Intronic
953472297 3:43177627-43177649 CAGGGGAGTCAGAGGGGGGGGGG - Intergenic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
954453168 3:50582631-50582653 GAGGGCAGACACAGGGAGGAAGG + Exonic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
955092026 3:55761971-55761993 CAGGAGAGAGAGAGAGAGGAAGG - Intronic
955345489 3:58158170-58158192 TAGGGGATATAGACTGAGGAGGG - Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955570131 3:60295830-60295852 CTGGGCATACATAGGAAGGAGGG + Intronic
955901853 3:63764383-63764405 GAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901857 3:63764402-63764424 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901861 3:63764421-63764443 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901865 3:63764440-63764462 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901871 3:63764474-63764496 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
956659695 3:71584620-71584642 GAGGAGAGACCGAGGGAGGACGG - Intergenic
956695237 3:71913130-71913152 CAGGAGAGAGGGAGGGAGGAAGG + Intergenic
956932781 3:74064402-74064424 GAGGGGAGACAGAGAAAGGAGGG + Intergenic
957167991 3:76699803-76699825 AAGAGGAAACAGGGGGAGGAAGG - Intronic
957513571 3:81221996-81222018 CAGGTGATAAACAGGGAGGTGGG - Intergenic
957769036 3:84663935-84663957 CAGGGGAGAAGGAGAGAGGAAGG + Intergenic
959485110 3:106919642-106919664 CAGGAGTTACAGAGGAAGCAGGG + Intergenic
959512243 3:107226807-107226829 CAGAGGAGACACAGGAAGGAAGG + Intergenic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
961018701 3:123486298-123486320 CAGGGGAGACAGAGAAAGGTTGG + Intergenic
961214268 3:125147552-125147574 GAGGGGATCCGGAGGGAGGAGGG - Intronic
961347723 3:126274882-126274904 GAGGGAAGAAAGAGGGAGGAAGG - Intergenic
961810354 3:129518462-129518484 CAGGGGCCACACTGGGAGGAGGG + Intronic
962222202 3:133573618-133573640 GAGGGGAGGGAGAGGGAGGAGGG - Intergenic
962313419 3:134342092-134342114 CAGAGGAGACACAGGGAAGAAGG + Intergenic
962439048 3:135395081-135395103 TGGGGGACACAGAGGGAGGGAGG - Intergenic
962636998 3:137341360-137341382 CAGGGGATGCAGGGGGAAAAAGG - Intergenic
963561283 3:146869149-146869171 AAGGGGAGAGAGAGGGAGCAGGG - Intergenic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
963941981 3:151104757-151104779 TAGAGGCTTCAGAGGGAGGATGG - Intronic
964762465 3:160147193-160147215 AAGGGGAGACAGAGGGAGGGAGG - Intergenic
965077087 3:163992884-163992906 GAGGAGACAGAGAGGGAGGAAGG + Intergenic
965147993 3:164931053-164931075 CAGGGGATGGAGAGTGGGGATGG + Intergenic
965526466 3:169724552-169724574 CAGGGATTAGGGAGGGAGGAAGG + Intergenic
966140728 3:176752746-176752768 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
966542286 3:181105625-181105647 CAGGAGATACAAAAGGCGGATGG + Intergenic
967131930 3:186478541-186478563 CAGGGGTTTCAGAAGGAGGTTGG - Intergenic
967210199 3:187161764-187161786 TAGGGGAAGCAGAGGTAGGAAGG - Intronic
967529603 3:190533491-190533513 CAGGGGAAGCACAGGGGGGAGGG - Intronic
967674561 3:192281194-192281216 TAGAGGATTCAGAGGGAAGATGG - Intronic
967828265 3:193896293-193896315 CGGGGAAGACACAGGGAGGAGGG + Intergenic
968080829 3:195845710-195845732 CAAGCGAGAAAGAGGGAGGAAGG - Intergenic
968264262 3:197350497-197350519 CAGGGGCTGGGGAGGGAGGAAGG - Intergenic
1202739057 3_GL000221v1_random:37955-37977 CTGGGGATGCAGACAGAGGAGGG - Intergenic
968914484 4:3491356-3491378 CAGGGGGAGCAGAGGAAGGAAGG - Intronic
968916658 4:3499707-3499729 GAGGGGATGCAGAGGGAGCGTGG + Intronic
969323033 4:6424541-6424563 CTGTGGATACACAGGGAGGCCGG + Intronic
969393438 4:6906138-6906160 AAGGGGATTGGGAGGGAGGATGG + Intergenic
969492717 4:7509297-7509319 GAGGGGATGGAGAGGGAGAAAGG + Intronic
969872161 4:10111398-10111420 CAGGGGAAGCAGAGGGTGGTGGG - Intronic
969985250 4:11202186-11202208 CAAGGGTTAAAGAGGCAGGAGGG - Intergenic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
970448044 4:16140258-16140280 CAGGGGTTTCAGAGGGAGGCTGG + Intergenic
971115212 4:23638285-23638307 CAGGGGAAAGAGTGGGAGTAAGG - Intergenic
972425902 4:38932602-38932624 CAGGGGAGACTGAGGCAGGAGGG - Intronic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
973331046 4:48910394-48910416 GAGGGGAGAGAGAGGAAGGAAGG - Intergenic
973878998 4:55249867-55249889 CAGGGCCTTCAGAGGGAGCACGG + Intergenic
974451122 4:62061613-62061635 CAGGGGTGAAAGATGGAGGATGG - Intronic
974660251 4:64879174-64879196 AAGGAGAGATAGAGGGAGGAGGG - Intergenic
974710637 4:65589434-65589456 CAGTGGTTACAGAGGGAGGTGGG - Intronic
975323600 4:73035915-73035937 CAGAGGACACACAGGGAAGAAGG - Intergenic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
975738005 4:77400498-77400520 GAGGGGATAAAGAGTGAGGCAGG + Intronic
976126079 4:81835053-81835075 AAGGAGGAACAGAGGGAGGAAGG + Intronic
977271101 4:94917970-94917992 CAGGAGAAAGAGAGTGAGGAGGG - Intronic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
977374213 4:96180571-96180593 CAGGGGAAGGAGAGAGAGGAGGG - Intergenic
977551818 4:98450665-98450687 CAGAGGGTACATAGGAAGGAAGG + Intergenic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
979347694 4:119607627-119607649 CTGGGGAGACTGAGGCAGGAGGG + Intronic
979666171 4:123313194-123313216 GAATGGATGCAGAGGGAGGAGGG - Intronic
979853234 4:125599605-125599627 GAGGGGAGAAAAAGGGAGGACGG - Intergenic
982277934 4:153656013-153656035 AAGGGGTGGCAGAGGGAGGATGG - Intergenic
982370442 4:154627424-154627446 CAGGGGAGGGAGACGGAGGAAGG - Intronic
983281010 4:165680862-165680884 CAGGGGATAGTGATGAAGGACGG + Intergenic
984241003 4:177219214-177219236 CAAGGGAAAAAGAGGGAGTAGGG - Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985280570 4:188282653-188282675 CCGGGGATAGGGAAGGAGGAAGG - Intergenic
1202766857 4_GL000008v2_random:155288-155310 CTGGGGATGCAGACAGAGGAGGG + Intergenic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985864568 5:2504326-2504348 CACATGATACAGAGGGTGGAAGG - Intergenic
986014812 5:3748564-3748586 CAGGGGAGAGAGAGGGAGGGCGG - Intergenic
986039085 5:3969476-3969498 CAGGGGAGACAGTAGGAGGCAGG + Intergenic
986286776 5:6365123-6365145 CAGGGGGTACTGAGGGAGATGGG - Intergenic
986769441 5:10958391-10958413 CAGGGGATGTGGAGGAAGGAGGG - Intergenic
987071739 5:14343411-14343433 CAGGGGTTAGAGATGGAGCAGGG - Intronic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
988506083 5:31824511-31824533 TAGGGGCTACACTGGGAGGAAGG + Intronic
988872567 5:35406863-35406885 AATGGGGTACAGAGGGAGGCAGG - Intergenic
989189552 5:38657133-38657155 CAGGGGATACAGGGTCATGATGG - Intergenic
989214277 5:38888062-38888084 CATGCGAGACAGACGGAGGAGGG + Intronic
989323539 5:40164860-40164882 CTGGGGTTGAAGAGGGAGGAAGG + Intergenic
990389861 5:55307789-55307811 CAGTGGATAAAGAGCGAGGGCGG - Exonic
990902400 5:60766859-60766881 CTGGGGTTAGAGAGGGAGAATGG - Intronic
991289713 5:65021591-65021613 CAGAGGATACAGAGTGCTGAGGG - Intergenic
991693157 5:69245270-69245292 GAGGGGAAAAGGAGGGAGGACGG - Intronic
993592197 5:89808050-89808072 CATGAGACATAGAGGGAGGAGGG - Intergenic
993875821 5:93305505-93305527 AAGGAGAAAAAGAGGGAGGAAGG + Intergenic
994022920 5:95048797-95048819 CAGGGGATTTGGAGAGAGGAAGG + Intronic
994925218 5:106108570-106108592 CAGTGGATACAGAGAGATGCAGG - Intergenic
994956878 5:106544353-106544375 TGGGAGATCCAGAGGGAGGACGG - Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
997258318 5:132446011-132446033 CAGGGGATTTCAAGGGAGGATGG + Intronic
997444893 5:133933751-133933773 AAGTGGATAGAGAAGGAGGAGGG - Intergenic
997799466 5:136845222-136845244 CAGAGGCTTCAGAGGGAGCATGG + Intergenic
999199627 5:149806471-149806493 CAGGAGAGACCGAGGGAGCAGGG - Intronic
1000175231 5:158745717-158745739 TAGAGGATAAAGAGGGAGGGTGG + Intronic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1001153606 5:169253951-169253973 CAGGGGCTACGGAGGAGGGATGG + Intronic
1001482551 5:172098493-172098515 CACAGGATGCAGAGGAAGGATGG + Intronic
1001569920 5:172723874-172723896 AAGGAGAGAAAGAGGGAGGAAGG + Intergenic
1001573096 5:172743682-172743704 CAGGTGGTCCAGAGGAAGGAGGG + Intergenic
1001934226 5:175693235-175693257 CAGAGCATTCAGAGGGTGGAAGG + Intergenic
1002102353 5:176863772-176863794 AAGGGGGTAAAGAAGGAGGAGGG - Intronic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1002950978 6:1810648-1810670 CAGGGAACAGACAGGGAGGAGGG + Intronic
1002994293 6:2268476-2268498 CATGGGACACAGAGCCAGGAGGG + Intergenic
1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG + Intergenic
1003153134 6:3569912-3569934 GAGGGGAGAGGGAGGGAGGATGG - Intergenic
1003400300 6:5785150-5785172 CAGAGGATACAGCAGGAGAAGGG + Intergenic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003516050 6:6819550-6819572 CAGGGGTTAGATATGGAGGAGGG + Intergenic
1003565640 6:7219921-7219943 CAGTTGATACTAAGGGAGGAAGG + Intronic
1003890069 6:10556143-10556165 ACGGGGAGGCAGAGGGAGGAGGG + Intronic
1004332098 6:14731193-14731215 AAGGGAATACAGAGGGAGACAGG - Intergenic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1004947834 6:20635342-20635364 CAGGGACTACAAAGGAAGGAAGG - Intronic
1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG + Intergenic
1005632675 6:27723232-27723254 CTGGGGAGACTGAGGCAGGAGGG + Intergenic
1005959053 6:30683602-30683624 GAGGGGAAACCCAGGGAGGAAGG + Intronic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007403061 6:41615586-41615608 CAGCTAATCCAGAGGGAGGAGGG + Intergenic
1007615808 6:43179371-43179393 AAGGGGAGGCTGAGGGAGGACGG - Exonic
1007708538 6:43806411-43806433 GAGAGGAGTCAGAGGGAGGAAGG + Intergenic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1008004274 6:46393478-46393500 CAGGGGAAACGGTGGGATGAGGG + Intronic
1008475532 6:51931886-51931908 AAGGGGAGAGAGAGAGAGGAGGG + Intronic
1009394064 6:63177070-63177092 AATGGGATATAGAGGGAGGGAGG - Intergenic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1010467327 6:76183963-76183985 GAGGGAAGACAGTGGGAGGAGGG - Intergenic
1011043546 6:83057380-83057402 CTGGGGATACAGAGTGAACAAGG - Intronic
1011525815 6:88263767-88263789 CAGGGCAGAAGGAGGGAGGAGGG + Intergenic
1011629691 6:89311711-89311733 CAGGGCCTGCACAGGGAGGAGGG - Intronic
1011682021 6:89792507-89792529 TGGGGGGTAAAGAGGGAGGAGGG + Intronic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012925338 6:105261832-105261854 CAGGGGATCCAGAGTGGGGCAGG - Intergenic
1015349767 6:132203913-132203935 CAGAAGTTAGAGAGGGAGGAAGG - Intergenic
1015395863 6:132733954-132733976 GAGGGGAGAGAGAGAGAGGAAGG + Intronic
1015549368 6:134396096-134396118 CGGGGGAGAGGGAGGGAGGAAGG - Intergenic
1015600158 6:134903839-134903861 TGGGTGAGACAGAGGGAGGAGGG + Intergenic
1016040943 6:139431537-139431559 GAGGGGATCCAGAGGGATGGGGG - Intergenic
1016241425 6:141935722-141935744 GAGGGGATGCAGATGGAGGTGGG + Intergenic
1016426570 6:143941942-143941964 CAGGGGATACCGAGGGGTGGAGG + Exonic
1016505994 6:144779615-144779637 CAGGGGTAACAGAGGCAGAAAGG + Intronic
1016521458 6:144951341-144951363 CTGTGGATACTGAGGGATGATGG - Intergenic
1017025753 6:150179091-150179113 CTGGGGAGACCCAGGGAGGAAGG + Intronic
1017124474 6:151052460-151052482 CAAGGGATACAGAAGAAGGATGG + Intronic
1017294287 6:152776152-152776174 CAGGGGGTGCAGTGGGAGGAGGG + Intergenic
1017506684 6:155074929-155074951 CTGGGGAGTCAGAGGGTGGAGGG + Intronic
1017550242 6:155498171-155498193 CAGTGGTTACAGAGGGAGTTTGG + Intergenic
1017646075 6:156541029-156541051 GAGGGAATTCAGAGGGAAGAGGG + Intergenic
1017739071 6:157389768-157389790 CAGTGGGTACAAAGGGTGGAAGG - Intronic
1017929302 6:158938494-158938516 CAGGTGAAAAGGAGGGAGGAAGG + Intergenic
1018003468 6:159599749-159599771 TAGAGGATTCAGAGGGAGCATGG - Intergenic
1018347817 6:162921206-162921228 CAGGAGAGACAGAGTGGGGAGGG + Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1018788852 6:167130974-167130996 GAGGGGGTCCAGAGGGAGGGTGG - Intronic
1018998203 6:168726036-168726058 CAGAGGAGGCAGTGGGAGGAGGG + Intergenic
1019100821 6:169627824-169627846 CAGCCCATGCAGAGGGAGGAGGG + Intronic
1019210662 6:170401992-170402014 CAGGGAGTCCTGAGGGAGGATGG - Intronic
1019272207 7:156638-156660 CAGAGGGTACAGATGGAGCAGGG - Intergenic
1019293126 7:260061-260083 CAGTGAATTCAGAGGCAGGACGG + Exonic
1019471879 7:1225367-1225389 CAGGGGAGAGGGAGGGAGGGAGG + Intergenic
1019479785 7:1261224-1261246 CAGGGGACGGACAGGGAGGATGG + Intergenic
1019479816 7:1261311-1261333 CAGGGGATGGACTGGGAGGATGG + Intergenic
1019479871 7:1261468-1261490 CAGGGGATGGACTGGGAGGATGG + Intergenic
1019479910 7:1261579-1261601 CAGGGGATGGATTGGGAGGATGG + Intergenic
1019479926 7:1261625-1261647 CAGGGGATGGACTGGGAGGATGG + Intergenic
1019788878 7:2997424-2997446 CAGGGGAGGCAGGGCGAGGATGG + Intronic
1019825276 7:3279387-3279409 AAGGGGAGAGAGAGGAAGGAGGG + Intergenic
1020011352 7:4807534-4807556 GAGGGGAGACAGAGGGAGAGAGG - Intronic
1021171128 7:17399097-17399119 GAGGGGCTAAAGTGGGAGGATGG - Intergenic
1021509998 7:21425275-21425297 GAGGGGAAAGGGAGGGAGGAAGG - Intergenic
1021559469 7:21955510-21955532 CAGGGGTTAAGGAAGGAGGAAGG - Intergenic
1022243602 7:28535612-28535634 TAGGAGAGAAAGAGGGAGGAAGG + Intronic
1023159303 7:37282196-37282218 CAGGAGGTCCACAGGGAGGAAGG + Intronic
1023992753 7:45139212-45139234 CTGGGGAGACAGAGAGAGGGCGG - Intergenic
1024198336 7:47081846-47081868 GAGGGGAGACACTGGGAGGAAGG + Intergenic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024863499 7:53874939-53874961 CTGGGGACTCAGAGGCAGGAAGG + Intergenic
1024875718 7:54020714-54020736 CGGGGGAAAGAGTGGGAGGAGGG - Intergenic
1026529557 7:71185154-71185176 GAGGGGACAGAGAGGAAGGAAGG - Intronic
1026622932 7:71966518-71966540 CAGGAGACAGAGAGAGAGGAGGG - Intronic
1026806125 7:73430450-73430472 AAGGGGATGGAGGGGGAGGAGGG - Intergenic
1026955235 7:74372634-74372656 CAGGGGCCAGCGAGGGAGGATGG + Intronic
1026979680 7:74519087-74519109 CAGGCAATGCAGAGGCAGGAAGG + Intronic
1027185343 7:75967750-75967772 CGGTCCATACAGAGGGAGGAGGG + Intronic
1027246532 7:76371339-76371361 CAGAGGATGCAGAGGAAGGTAGG + Intergenic
1027309270 7:76937238-76937260 AAGGGCATACAGAGGGAGACTGG - Intergenic
1027987736 7:85315909-85315931 GAGGGGATAAATGGGGAGGAAGG - Intergenic
1028210568 7:88069196-88069218 AAGGAGAAACATAGGGAGGAAGG - Intronic
1028437394 7:90820492-90820514 CAGGAGAGACAGAGCGAGGCAGG - Intronic
1028760594 7:94491775-94491797 CAGGGGAAAGAGTGGGAGGGAGG + Intergenic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1029585579 7:101468722-101468744 CTGGGGAAACTGTGGGAGGAGGG + Intronic
1029882866 7:103835280-103835302 CAGGAGTTAAAGAGGGAGGTAGG + Intronic
1030002726 7:105082619-105082641 CAGGGGTGACAGAGGGAGAAGGG + Intronic
1030789506 7:113706467-113706489 CAGGGCATTCAGAGTGAGTAGGG - Intergenic
1031472790 7:122187158-122187180 GAGGGGATAAAGGGGGAGGTGGG + Intergenic
1031630166 7:124034298-124034320 AAGGAGATAAAGAGGGAGGAAGG - Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032383628 7:131506835-131506857 CTGGGGCTAGAGAGGGAGGCAGG - Intronic
1032616438 7:133477315-133477337 CAGGGGTTAGGGAGGGTGGAGGG - Intronic
1032746304 7:134790110-134790132 GAGAGGACAGAGAGGGAGGAAGG + Intronic
1033150893 7:138914073-138914095 CGGGGGAAACAGAGGCAGAATGG + Intronic
1034070440 7:148179582-148179604 CGGGGGAGAGAGAGGGAGGGAGG + Intronic
1034263825 7:149772306-149772328 CTGGGGAGACAGAGGGGGAAGGG - Intronic
1034270005 7:149798808-149798830 CAGGGGCTGGAGAGGAAGGAGGG + Intergenic
1034399485 7:150852653-150852675 AACAGGACACAGAGGGAGGAGGG + Intronic
1034535041 7:151721079-151721101 GAGGGGACACAGAGGGCAGAGGG + Intronic
1034670981 7:152858355-152858377 CATCGCTTACAGAGGGAGGAAGG + Intergenic
1034827067 7:154275292-154275314 GAGGGGACACAGAGGGAAGGAGG - Intronic
1034929196 7:155147905-155147927 CAGGGGGAAGAGAGAGAGGAGGG - Intergenic
1035046725 7:155972737-155972759 CAGGGAAGAGACAGGGAGGAAGG + Intergenic
1035754753 8:2022912-2022934 CGGGGCAGACAGAGGGAGGCAGG - Intergenic
1035924563 8:3713441-3713463 CAGGGGCTACAGAGGAGGGCAGG - Intronic
1036217987 8:6896798-6896820 GAGGGTTTACAGAGGTAGGAGGG - Intergenic
1037192430 8:16142824-16142846 CTGGGAATACAGAGGGAGGGAGG + Intronic
1037274639 8:17164946-17164968 CATGGGATCCAAAGGGATGAGGG - Intronic
1037723892 8:21467466-21467488 CAAGGGATTCAGAGTGAGCATGG - Intergenic
1037959921 8:23089211-23089233 CAGGGTAGAAAGTGGGAGGAGGG + Intronic
1038478384 8:27884897-27884919 CAGGGAGTACAGAGTGAGGCAGG + Intronic
1038723391 8:30058234-30058256 CAGCACATACAGAGGGAGCATGG - Intergenic
1039090972 8:33829320-33829342 AAGGGGATAAGGTGGGAGGAGGG - Intergenic
1039378273 8:37059463-37059485 CAGGGGATTGATGGGGAGGAGGG + Intergenic
1039408329 8:37331374-37331396 CGGGGGAGACTGAAGGAGGAGGG + Intergenic
1039447785 8:37646474-37646496 CAGGGGCAAGAGAGAGAGGAGGG + Intergenic
1039561028 8:38512642-38512664 GAGGGGATGGAGAGGGAGGCAGG + Intronic
1039745848 8:40426033-40426055 GAGGGGATTGAGAGGGAGGTAGG - Intergenic
1039836528 8:41260608-41260630 CAAGGGACACAGAGGTAGGCTGG - Intergenic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1040587608 8:48757919-48757941 CAGGGGCTGCTGCGGGAGGAGGG + Intergenic
1040681918 8:49820776-49820798 GAAGGGAGACGGAGGGAGGAAGG + Intergenic
1040973444 8:53163444-53163466 CTGAGGATACAGAGCCAGGACGG - Intergenic
1041654438 8:60335062-60335084 CAGAGGATGCAGAGGGAAGGGGG + Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1042335738 8:67628532-67628554 CAGTGGCTACAAAGGGAAGATGG - Intronic
1042765416 8:72315850-72315872 CAGGAGACAGAGAGGGAAGAGGG + Intergenic
1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG + Intronic
1043727423 8:83628884-83628906 CAGAGCATTCAGAGGGAGCAGGG - Intergenic
1043778195 8:84297198-84297220 GAGGGTAGACAGTGGGAGGAGGG - Intronic
1044186398 8:89256884-89256906 GAGGTGAGAGAGAGGGAGGAGGG + Intergenic
1044295287 8:90519806-90519828 CAGGAGAGACAGAGGGTGAAGGG - Intergenic
1044627190 8:94245578-94245600 GAGGGGACACAGAGGGAAGAAGG - Intergenic
1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG + Intergenic
1045622377 8:103995461-103995483 CAGTGGAGACAGAGGGAGAATGG + Intronic
1045674098 8:104589082-104589104 CAGGCGAGCCGGAGGGAGGAGGG - Intergenic
1046199875 8:110911143-110911165 CTGGGGATACAGAGGGCGGGGGG + Intergenic
1046241894 8:111507155-111507177 CAGGGGATAGGGTGGGAGGCGGG + Intergenic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1047167686 8:122458420-122458442 CAGTGGAAACAGTGGGTGGAGGG + Intergenic
1047416204 8:124666697-124666719 CATGGGATAGGGAGGGTGGAGGG + Intronic
1048013048 8:130473946-130473968 GAGGGAACACAGAGGAAGGAGGG + Intergenic
1048940449 8:139396077-139396099 CAGGGCAGACAGAGAGAAGACGG - Intergenic
1048976332 8:139674916-139674938 GAGGGGATCCAGAGTGGGGAAGG - Intronic
1048993849 8:139776918-139776940 CAGGAGCTACAGAGGGTGCAAGG - Intronic
1049444670 8:142624487-142624509 CAGGGCATCCAGACGGAGGCTGG + Intergenic
1049554467 8:143275171-143275193 TAGGGGATGCAGGAGGAGGAGGG - Intronic
1049845174 8:144797280-144797302 CAGGGGAAACTGGGTGAGGAGGG - Intergenic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1049952576 9:659691-659713 CAGGAGAAAAAGAGGGAAGAAGG + Intronic
1050120336 9:2301204-2301226 CAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1050290161 9:4145730-4145752 GAGGGGGAACAAAGGGAGGAGGG - Intronic
1050881467 9:10705132-10705154 GAGGGGATAGAGAGGAAAGAAGG + Intergenic
1051347300 9:16163768-16163790 CAGGGTGTAAAGAGAGAGGAAGG - Intergenic
1051664327 9:19454464-19454486 CAAGGGATAAAGAGCCAGGAAGG - Intergenic
1052210877 9:25901823-25901845 AAGGGGCTACAGAGGAAGGAAGG + Intergenic
1053049321 9:34945669-34945691 TACAGGAGACAGAGGGAGGAAGG - Intergenic
1053180722 9:35966780-35966802 CAGGGGTTACAGATGGGGAAGGG - Intergenic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1053499071 9:38569829-38569851 CTGGGGATGCAGACAGAGGAGGG + Intronic
1053525511 9:38826230-38826252 GAGGGGAGCCAGAGGGGGGATGG - Intergenic
1053662144 9:40291471-40291493 CTGGGGATGCAGAGAGAGGAGGG - Intronic
1053912590 9:42921639-42921661 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054197740 9:62050657-62050679 GAGGGGAGCCAGAGGGGGGATGG - Intergenic
1054374270 9:64437712-64437734 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054522466 9:66084813-66084835 CTGGGGATGCAGAGAGAGGAGGG + Intergenic
1054640614 9:67537715-67537737 GAGGGGAGCCAGAGGGGGGATGG + Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055092221 9:72374559-72374581 CAGGGGATAGAGGGGAAAGAGGG + Intergenic
1055379702 9:75692782-75692804 CAGGGAATACAGAAAGAAGATGG - Intergenic
1056545054 9:87606478-87606500 AGGGAGAGACAGAGGGAGGAAGG - Intronic
1056586644 9:87931785-87931807 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1056610233 9:88121156-88121178 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1057162119 9:92896171-92896193 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1057226742 9:93296706-93296728 GGGAGGATAGAGAGGGAGGAAGG - Intronic
1057226944 9:93297424-93297446 CAGGGGAAACAGACAGTGGAAGG - Intronic
1057678507 9:97154310-97154332 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1058120731 9:101135833-101135855 CTGGGCAGACAGAGGCAGGAAGG - Intronic
1058288452 9:103209099-103209121 CAGGGGAGACAGAGAGAAGGGGG + Intergenic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058656743 9:107229218-107229240 AAGGGGATACGGAGGGGGCAGGG + Intergenic
1058711524 9:107683468-107683490 AAGGGGATGCAGAGGGAGAAGGG - Intergenic
1058783621 9:108364415-108364437 CAGGAGATACAGAGGGGTTATGG - Intergenic
1059286287 9:113174624-113174646 CAGAGAATAAAGAGGGATGATGG + Intronic
1059342260 9:113604119-113604141 CTGGGGATACAGTGAGAAGACGG - Intergenic
1059489107 9:114652537-114652559 CAGGGGATACAGTATGAGAATGG + Intergenic
1060016913 9:120094666-120094688 CAGGGGACACACAGGGCGGGGGG + Intergenic
1060297759 9:122354932-122354954 CTGGGGATAGACAGAGAGGAGGG - Intergenic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1060482095 9:124022634-124022656 GAGGTGACACAGAGGGATGACGG + Intronic
1060494164 9:124105718-124105740 AAGGGGACACAGAGGGAAGGAGG - Intergenic
1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG + Intronic
1060798233 9:126526874-126526896 CAGGGCATAGAGAGTGAGGTAGG + Intergenic
1061875679 9:133542404-133542426 CAGGGCATGCAGAGGGAGAGTGG + Intronic
1061921844 9:133786914-133786936 AAGGGGAGAAAGAGGGAGGGAGG + Intronic
1062133141 9:134911026-134911048 AATGGGATTCAGAGAGAGGAGGG + Intronic
1062315292 9:135964231-135964253 CTGGGGGAACAGAGAGAGGAGGG + Intergenic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1062581637 9:137231537-137231559 CAGGGCGTAGAGAGGGAGGGTGG + Intronic
1185448561 X:271233-271255 CCCAGGACACAGAGGGAGGAAGG + Intergenic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1186053695 X:5626847-5626869 AAGAGCAGACAGAGGGAGGAAGG + Intergenic
1186479020 X:9881716-9881738 TCGGGGAGGCAGAGGGAGGAAGG - Intronic
1187056230 X:15743748-15743770 CAGGGGATGCAGCAGGAGGTGGG - Intronic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1188079231 X:25815553-25815575 CAGGGGAGAGAGAGGGGGAAGGG - Intergenic
1188329415 X:28850526-28850548 TAGGGGGAAGAGAGGGAGGAAGG - Intronic
1188705699 X:33326856-33326878 CAGGAGATATGGAGGGGGGATGG + Intronic
1188734585 X:33696728-33696750 AAGGGGAGAGAGAGGGAAGAGGG + Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189497130 X:41518953-41518975 CAAGGGATACAGCAAGAGGAAGG + Intronic
1189571415 X:42301924-42301946 GAGAGGAGAAAGAGGGAGGAGGG - Intergenic
1190160919 X:48030782-48030804 AAGGGGAGCCAAAGGGAGGAAGG + Intronic
1190619076 X:52266989-52267011 AAGGGGAGCCAGAGGGAGGAAGG + Intergenic
1190637099 X:52446146-52446168 AAGGGGAGCCAGAGGGAGGAAGG - Intergenic
1191223772 X:58017899-58017921 CAGAGCATAGAGAGGGAGCATGG + Intergenic
1191915336 X:66195040-66195062 AAAGGGATAAACAGGGAGGAAGG - Intronic
1191971307 X:66819751-66819773 GGGGGGTTCCAGAGGGAGGAGGG + Intergenic
1192264322 X:69528851-69528873 CAGGGGGTAGAGAGGAAGAAGGG - Intronic
1194014304 X:88600235-88600257 CAGGAGAGACAGAGAGAGAATGG + Intergenic
1194200473 X:90948776-90948798 CAGGAGAAAGAGAGGGAGGGAGG - Intergenic
1194372890 X:93096211-93096233 CAAGAGATAGAGAGAGAGGAGGG + Intergenic
1195385884 X:104313290-104313312 AGGGGGACAAAGAGGGAGGAAGG - Intergenic
1195446417 X:104957455-104957477 CTGGGGGTTCAGAGGGAGGGAGG + Intronic
1195479288 X:105324230-105324252 AATGGAGTACAGAGGGAGGAAGG + Intronic
1196276485 X:113771774-113771796 TTGGGGATACAGAGGTAGTATGG - Intergenic
1197545774 X:127822189-127822211 CAGGGGAAAGGGAGGGAGTAGGG + Intergenic
1197651604 X:129071542-129071564 GAGGGGGAAAAGAGGGAGGAAGG + Intergenic
1198276532 X:135099212-135099234 CAGGGGAGACCGTGGGAGAAGGG - Intergenic
1198309966 X:135421540-135421562 CAGGGGAGACCGTGGGAGAAGGG + Intergenic
1198562980 X:137871405-137871427 CCAGGGATACAGAGAGAGGATGG - Intergenic
1198801552 X:140452791-140452813 CAGGGGTAGCAGAGGCAGGAAGG + Intergenic
1199303547 X:146240744-146240766 AAGGGGATAGGGAGGGAGGAGGG - Intergenic
1199417243 X:147599502-147599524 CAGGGCAGAGAGAGGGAGGGAGG - Intergenic
1199420923 X:147643884-147643906 CAGGGGAAAGAGAGTGAAGAGGG - Intergenic
1200326434 X:155245176-155245198 CATTGGATACATAAGGAGGAGGG - Intergenic
1200384904 X:155880818-155880840 CAGGGAATAGAGATGGAAGAGGG + Intergenic
1200680928 Y:6210251-6210273 CAAGAGATAGAGAGAGAGGAGGG + Intergenic
1201382097 Y:13392058-13392080 CAGGGGCTGAAGAGGGAGGATGG + Intronic
1201509591 Y:14744245-14744267 CAGAAGATAAAGAGTGAGGATGG + Intronic
1201890906 Y:18942829-18942851 GAGGGGAGACAGAGAGAGGAAGG + Intergenic