ID: 945944318

View in Genome Browser
Species Human (GRCh38)
Location 2:215980293-215980315
Sequence TCTGGGGCTCCAGGGCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 0, 2: 3, 3: 63, 4: 466}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945944310_945944318 -2 Left 945944310 2:215980272-215980294 CCCTTGGCCTTCATATATCTTTC 0: 1
1: 0
2: 1
3: 19
4: 281
Right 945944318 2:215980293-215980315 TCTGGGGCTCCAGGGCAGTGAGG 0: 1
1: 0
2: 3
3: 63
4: 466
945944315_945944318 -9 Left 945944315 2:215980279-215980301 CCTTCATATATCTTTCTGGGGCT 0: 1
1: 0
2: 0
3: 15
4: 142
Right 945944318 2:215980293-215980315 TCTGGGGCTCCAGGGCAGTGAGG 0: 1
1: 0
2: 3
3: 63
4: 466
945944311_945944318 -3 Left 945944311 2:215980273-215980295 CCTTGGCCTTCATATATCTTTCT 0: 1
1: 0
2: 0
3: 33
4: 341
Right 945944318 2:215980293-215980315 TCTGGGGCTCCAGGGCAGTGAGG 0: 1
1: 0
2: 3
3: 63
4: 466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945944318 Original CRISPR TCTGGGGCTCCAGGGCAGTG AGG Intronic
900165982 1:1244547-1244569 GCTGGGACCCCAGGGCAGCGGGG + Intronic
900396395 1:2454831-2454853 TTTGGGGCTCAGTGGCAGTGTGG + Intronic
900461220 1:2802843-2802865 TCTGAGGGTGCAGGGCAGGGGGG + Intergenic
900612856 1:3551705-3551727 TCTCGGGCTCCCCTGCAGTGTGG - Intronic
901208622 1:7511767-7511789 GCTGGGGCTCCTGGGCACTTGGG + Intronic
902372700 1:16016049-16016071 TCTGGGGCTCCTGGGGAACGTGG + Intronic
902375369 1:16027799-16027821 TCTGGGGAAGGAGGGCAGTGGGG - Exonic
902380333 1:16049596-16049618 TCTGGGGAAGGAGGGCAGTGGGG - Exonic
902404749 1:16176502-16176524 TCTGCCGCTCCAGGGGAGGGAGG + Intergenic
902465785 1:16617538-16617560 ATTGGGTCTCAAGGGCAGTGGGG + Intergenic
902484334 1:16733270-16733292 TCTGGGCCTGCAGGGCACAGTGG + Intergenic
902618035 1:17634589-17634611 TCTGGGGCTCTGGGGCTCTGGGG + Intronic
903973237 1:27132851-27132873 GCTGTGGCTCCAGGGAAGGGCGG + Intronic
904705117 1:32384132-32384154 TCTGGGGCTGCAGGAGAGGGAGG + Intronic
905169030 1:36099013-36099035 CCTGGGGCCCCAGGGCAGGGGGG - Exonic
905336272 1:37246777-37246799 TCTGAGGCCCCAGGGAACTGAGG + Intergenic
905882874 1:41475708-41475730 TCAGGGGCTCCATCACAGTGTGG + Intergenic
905905298 1:41614061-41614083 TCTGAGCCATCAGGGCAGTGTGG + Intronic
905920960 1:41718238-41718260 TCTGGGCTTCTGGGGCAGTGAGG + Intronic
906196576 1:43933857-43933879 TGTGGGGCTCCAGGCCCGGGTGG - Exonic
906306877 1:44725087-44725109 GCTGGGGTGCCAGGGCAGTCTGG - Intronic
906694639 1:47815716-47815738 TCTGGGGCTCCAAGTGACTGAGG + Intronic
906698355 1:47839965-47839987 TCTGTAGGTCCAGGGTAGTGTGG + Intronic
907135734 1:52138165-52138187 TCTGAGGCTGGAGTGCAGTGGGG + Intergenic
907954235 1:59213181-59213203 TCTGGGGCTCTAGGACACTTTGG + Intergenic
909046709 1:70719617-70719639 ACTGGGGCTACTGGGCAGTCTGG - Intergenic
912625202 1:111200461-111200483 TCTGGGCCTTCAGGACAGAGCGG + Exonic
912932947 1:113980779-113980801 TCTGGGGATCCAGGCCGCTGTGG + Intronic
913430763 1:118788692-118788714 TGTGAGGCTCCATGGCAGTGGGG - Intergenic
913550819 1:119915641-119915663 GCTGGGGCATCATGGCAGTGGGG + Exonic
914196944 1:145452499-145452521 TCTGTGGCTCCACGGCCCTGGGG - Intergenic
914676581 1:149911034-149911056 GCTCGGGGTCCAGAGCAGTGGGG - Intronic
915243673 1:154541574-154541596 TTGGGGGCTGCAGGGCTGTGGGG + Intronic
915585275 1:156840871-156840893 AATGGGGGTCCAGGGCACTGAGG - Exonic
915698307 1:157767252-157767274 CCTGGGGGCCCAGTGCAGTGAGG - Exonic
915701582 1:157801936-157801958 CCTGGGGGCCCAGCGCAGTGAGG - Exonic
915903010 1:159859908-159859930 CCTGGGGCTTCAGGGTAGGGAGG - Intronic
915951258 1:160191122-160191144 TCTGGGGGTGAGGGGCAGTGTGG + Intronic
917187580 1:172377694-172377716 TCTGAGGCTCCAGTGCATTTAGG - Intronic
918100565 1:181369650-181369672 CCTGTGTCTCCAGGGCAGTGTGG - Intergenic
918238240 1:182600274-182600296 CCTGAGTCTCCACGGCAGTGAGG - Exonic
919325351 1:196100111-196100133 CCTGGGACTTCAAGGCAGTGGGG - Intergenic
919724473 1:200873045-200873067 GCTGGGGCTCCAGGGCTCTGTGG - Exonic
920100954 1:203516777-203516799 TCTGGGGCACTGGGGCACTGGGG - Intergenic
920315760 1:205074709-205074731 TCTGGGGCTGCAGGTCGGGGAGG - Exonic
920704627 1:208242621-208242643 TTTGGGGCTCTAGGTCAGTAAGG - Intronic
922465003 1:225840371-225840393 TCTGGGGCTGCAGGGGAGAGGGG + Intronic
923036059 1:230286091-230286113 ACGGAGGCTCCAGGACAGTGGGG - Intergenic
923493800 1:234507402-234507424 TCTGGAGTTCCAGGTCAGTGGGG - Intergenic
923920451 1:238558600-238558622 CCTGGGTCTGCAGGTCAGTGGGG + Intergenic
924438563 1:244067614-244067636 ACTGGGGAGCCAGGGCAGCGGGG - Intergenic
924632237 1:245752012-245752034 GCGGAGGATCCAGGGCAGTGTGG - Intronic
1062991227 10:1821075-1821097 TTCGGGCCTCCAGGGCTGTGAGG + Intergenic
1063135210 10:3210281-3210303 TGTGGGGTCCAAGGGCAGTGGGG - Intergenic
1063451349 10:6152374-6152396 TCAGAGGCTCCACAGCAGTGTGG - Intronic
1063957535 10:11280771-11280793 ACTGAGGCTGGAGGGCAGTGAGG - Intronic
1064329860 10:14383414-14383436 TCCGGGGCTCCAGTGGGGTGGGG - Intronic
1065471545 10:26086757-26086779 TGTGGGGCACGGGGGCAGTGAGG + Intronic
1065782217 10:29180521-29180543 TTTGGGAGTCCAGGGCAGGGTGG - Intergenic
1065813296 10:29462339-29462361 TCAGGGGCTCCAGACCAGCGTGG + Exonic
1066062899 10:31739893-31739915 TCTGGCCCTCCTGGGGAGTGTGG - Intergenic
1067906229 10:50294346-50294368 TGTTGGGCTCCAGGGCATTCTGG - Intergenic
1068873671 10:61973391-61973413 TCAGGGGCTCCAGGGCTCTGGGG + Intronic
1069823200 10:71240002-71240024 GCTGGGGCTCCAGGCGGGTGAGG + Intronic
1069850882 10:71404203-71404225 TCTGTATCTCCATGGCAGTGAGG - Intronic
1070149774 10:73798483-73798505 TCTGGGGCATCTGGGCAGGGAGG + Intronic
1070798835 10:79233109-79233131 TCTGGGGCCCAAGGGGGGTGTGG + Intronic
1071492960 10:86148816-86148838 CCTGGGGGAGCAGGGCAGTGGGG - Intronic
1072745611 10:97937183-97937205 CCTGGGGCTTCAGTGCAGCGAGG - Intronic
1072810283 10:98456236-98456258 TCTGTGGCCCCCTGGCAGTGAGG - Intergenic
1073326688 10:102647420-102647442 TCTGGTGCCCCAGGCCACTGGGG + Intronic
1074377785 10:112952720-112952742 TTGGGGGCCCCAGGGCAGCGCGG + Intronic
1074582092 10:114729358-114729380 TCTAAGGCTCCAGGGAAATGAGG + Intergenic
1075284949 10:121175761-121175783 TCTGAGGGTCCAGGCCAATGAGG + Intergenic
1075520521 10:123141101-123141123 CTCGGGGGTCCAGGGCAGTGGGG - Intergenic
1075573391 10:123561020-123561042 TCTCAGGTTCCAGGCCAGTGGGG + Intergenic
1076042142 10:127259463-127259485 TCTATGGCTCCAGGACAGCGGGG - Intronic
1076201592 10:128563390-128563412 ACAAGGGCTCAAGGGCAGTGTGG + Intergenic
1076377629 10:130002329-130002351 TCTGGGGCTCCAGCCCAGACTGG + Intergenic
1076686013 10:132198790-132198812 CCTGGGGCTCCAGACCAGTGTGG - Intronic
1076768323 10:132649759-132649781 TCATGGGCTCCAGGGGTGTGCGG + Intronic
1077105151 11:838966-838988 CATGGGGCTCCAGGGAAGGGAGG + Intronic
1077122786 11:917958-917980 TCTGGGGCTCCAGGGCATATCGG - Intergenic
1077155570 11:1089428-1089450 TCCTGAGCTCCAGGGCACTGGGG + Intergenic
1077252674 11:1567506-1567528 GCTGGGGCTCCTGGGCAGGGAGG - Intronic
1077296884 11:1830537-1830559 TCTGAGGTTCCAGGGCAGGAAGG - Intronic
1077342068 11:2030640-2030662 TCTGGGGCTCAAGGGAGCTGGGG - Intergenic
1077383196 11:2257057-2257079 TCTGGGAGTGGAGGGCAGTGAGG + Intergenic
1077919550 11:6632361-6632383 TCTGTGGCTCCAGGCCAAAGGGG + Exonic
1080046698 11:27816206-27816228 TCTTGGGCTCCAGCTCTGTGGGG - Intergenic
1081596158 11:44460943-44460965 TTGGGGGCTCCAGAGCAGTGTGG + Intergenic
1081597331 11:44467966-44467988 TCTGAGGCTCGGGGGCAGGGCGG - Intergenic
1081610050 11:44556523-44556545 TCTTGGGCTGGAGCGCAGTGGGG + Intergenic
1081702042 11:45158335-45158357 TCTGGGGCCCCAGTTCAGGGTGG + Intronic
1082098391 11:48150649-48150671 TCTGGGGCTTGATGGCAGTGTGG + Intronic
1083025209 11:59544996-59545018 GCTGGGGCACCAGGGAAGGGAGG + Intergenic
1083153799 11:60810295-60810317 ACCCGGACTCCAGGGCAGTGGGG - Intergenic
1083159846 11:60848229-60848251 TCTGGGACTACAGGGCAGGGAGG + Intronic
1083327349 11:61879558-61879580 GCTGGGGCTCCAGGAGAATGGGG - Intronic
1083710707 11:64546598-64546620 TCTGAAGCCCCAGGGCTGTGTGG - Intergenic
1083853140 11:65379289-65379311 TGTGGGTCGCCAGGGCAGGGTGG + Intronic
1084165112 11:67371991-67372013 CGTGTGGCTCCAGGGCAGCGAGG + Intronic
1084312492 11:68325100-68325122 TCAGGGGCTCCAGGGGTGGGGGG - Intronic
1084481190 11:69421142-69421164 ACTGGGGCTCCAGGGCATGGAGG - Intergenic
1085120563 11:73964918-73964940 TGGGGGGCTCCAGGGCCGAGGGG + Exonic
1085201589 11:74705371-74705393 TGTGTGGCTCCAGGTCAGCGAGG - Intronic
1085287796 11:75375457-75375479 CTTGGGGCTTCGGGGCAGTGAGG - Intergenic
1085521345 11:77140612-77140634 TAGGGAGCTCCAGGCCAGTGGGG + Intronic
1085711718 11:78835099-78835121 AGTGGGACTCCAGGGCGGTGAGG + Intronic
1087595972 11:100255814-100255836 TGCTGGGCTCCAGGACAGTGTGG - Exonic
1087713814 11:101583768-101583790 TCTGGGGCGCCCGGGCAGAGAGG + Exonic
1088449292 11:109964942-109964964 TCTAGGGCTCCAGTGGTGTGTGG + Intergenic
1088812117 11:113399073-113399095 CCTGGTGGCCCAGGGCAGTGTGG + Exonic
1089110681 11:116053440-116053462 GTTGGGGGTGCAGGGCAGTGGGG - Intergenic
1089240494 11:117074330-117074352 TGTGGGGCTGTAGGGAAGTGGGG - Intronic
1089329401 11:117679241-117679263 CCTGGGCCTCTAGGGCAGAGAGG - Intronic
1089389300 11:118089164-118089186 ACTGGGGCTCATGGGCAGGGAGG - Intronic
1089610500 11:119666030-119666052 TCTGGGCCTGCAGGGCAAGGTGG + Intronic
1089642321 11:119855988-119856010 TCTGGTGCTCTGGGGCAGTGTGG + Intergenic
1089926511 11:122263972-122263994 ACTGGGGTTTCAGGGCAGTGGGG - Intergenic
1090703505 11:129316380-129316402 TCTGCAGCTCCAGGGCAAAGGGG - Intergenic
1090985279 11:131760923-131760945 TCTGGGGCTCTAGGGAAAGGAGG + Intronic
1091082298 11:132682056-132682078 TCTGGGGCTTCAGGGGACTCAGG + Intronic
1202825054 11_KI270721v1_random:85829-85851 TCTGGGGCTCAAGGGAGCTGGGG - Intergenic
1091996845 12:5000541-5000563 TCTGGAGGTCCAGGGCACAGAGG + Intergenic
1092093231 12:5821237-5821259 TCTAGGGGTCCAGTGCTGTGGGG + Intronic
1092801529 12:12173238-12173260 TTTGGGGCCTCAGGACAGTGAGG - Intronic
1093081951 12:14822263-14822285 TCTTGGGCTCTAGGGCAGCCTGG - Intronic
1095133511 12:38571227-38571249 TCTGCTGCTGCTGGGCAGTGGGG - Intergenic
1096712147 12:53465251-53465273 GCTGGGTCTTCAGGGCAATGGGG - Intronic
1096846590 12:54410588-54410610 ACTCAGGCTACAGGGCAGTGGGG + Intronic
1099390936 12:82078028-82078050 ATTGGGGGTACAGGGCAGTGGGG + Intergenic
1101329011 12:103742401-103742423 TCTGGTCCTCCAGGGCAGGCTGG - Exonic
1102676969 12:114665607-114665629 TCTGGCTCTCTAGGGCCGTGGGG + Intergenic
1103560832 12:121792686-121792708 CCTGTGGCTCCAGGGCTCTGTGG - Intronic
1104751871 12:131245169-131245191 TCTGGTGCTCCAGCCCAGCGTGG + Intergenic
1104915081 12:132260331-132260353 TCTGGGCCTCCAGAACGGTGAGG + Intronic
1105012108 12:132762468-132762490 TCTCGAGCTCCCGGGCCGTGGGG - Intergenic
1105858260 13:24389758-24389780 TCAGGGGCTCCTGGGCAGGCAGG + Intergenic
1106592032 13:31106103-31106125 ACTGGGGCTCCACGGGCGTGGGG - Intergenic
1108809746 13:54207319-54207341 TTTGAGACTCCAGGGCAGTGAGG + Intergenic
1110260094 13:73475123-73475145 TCAGGGGCTCCAGGGATGAGGGG + Intergenic
1110357324 13:74582314-74582336 TCTGGGGTTGCAGAGCAGTGTGG + Intergenic
1112278864 13:98045282-98045304 ACTGGGGCTCCATGAAAGTGAGG + Intergenic
1112570000 13:100585556-100585578 TCAGGAGCTCCAGACCAGTGTGG + Intronic
1112898019 13:104324898-104324920 TCTTGGGCACCAGGGCACTCTGG + Intergenic
1113525493 13:110971656-110971678 CCTTGGTCTCCAGGACAGTGTGG + Intergenic
1113597239 13:111541940-111541962 GCTCGGGCTCCGGGGCACTGTGG - Intergenic
1114049794 14:18913590-18913612 TCTGGGGGCCCAGGGCAGGCAGG - Intergenic
1114112767 14:19488341-19488363 TCTGGGGGCCCAGGGCAGGCAGG + Intergenic
1114738795 14:25071869-25071891 TCTGTTGGTCCAGGGCAGTTTGG - Intergenic
1114740665 14:25093893-25093915 TCTGAGGATGAAGGGCAGTGGGG + Intergenic
1118733878 14:68688807-68688829 TGTGTGGTGCCAGGGCAGTGCGG + Intronic
1119001581 14:70886794-70886816 TCTGGAGCTCAAGGGCCTTGTGG + Intergenic
1120951436 14:90045630-90045652 GCCAGAGCTCCAGGGCAGTGTGG + Intergenic
1121340713 14:93103546-93103568 CCTGGGGCTCCAGGAGACTGTGG + Intronic
1121662278 14:95644282-95644304 TCTGGGGCTCAATAGAAGTGGGG + Intergenic
1122009806 14:98736787-98736809 CCAAGGGCTCCATGGCAGTGGGG - Intergenic
1122154662 14:99742873-99742895 TGTGGGGCACAAGGGAAGTGTGG + Intronic
1122283588 14:100638403-100638425 CCCGGGGCTCCGGGGCACTGAGG - Intergenic
1122371955 14:101233920-101233942 TCTGGGGCTCTGGGGCTGTGGGG - Intergenic
1122371958 14:101233928-101233950 TCTGGGGCTCTGGGGCTCTGGGG - Intergenic
1122540121 14:102493419-102493441 GCAGGGGCTCCAGGGAAGGGAGG - Intronic
1122691606 14:103534388-103534410 GCTGGGACTGCAGGGCAGAGGGG - Intronic
1122814273 14:104304632-104304654 TTCGGGGCTCGAGGGGAGTGAGG - Intergenic
1122853307 14:104548163-104548185 GCAGGGGCTCCGGGGCGGTGGGG + Intronic
1122902400 14:104787288-104787310 CCTGGGGCTCCAGGCCAGGATGG - Intronic
1122940002 14:104977020-104977042 TGGGGGGCTCCAGAGCAGGGAGG - Intronic
1122972645 14:105158675-105158697 TGGGGGGTTCCTGGGCAGTGAGG - Intronic
1123765803 15:23477548-23477570 TCTGTGGCTCCACCCCAGTGTGG - Intergenic
1123783068 15:23645834-23645856 TCTGGGCCTCCTGGGCAGGCAGG + Exonic
1124207555 15:27734595-27734617 TGTGGGGCTTCAGGGCTGTGAGG + Intergenic
1124370806 15:29103735-29103757 TCCGGGGCTCCAGGGCTCTCAGG + Intronic
1125159655 15:36628220-36628242 CCTTAGGCTCCAGGGCAGGGGGG - Intronic
1126860722 15:52880132-52880154 GCTGGGGCTGCAGGCCAGTGTGG + Intergenic
1127188696 15:56506982-56507004 TGTGGGGCCCCAGGGCACTCAGG - Intergenic
1128364397 15:66987091-66987113 TGCTTGGCTCCAGGGCAGTGAGG - Intergenic
1128558112 15:68645386-68645408 GCTGCAGCTCCAGGGCAGAGAGG + Intronic
1129694188 15:77731273-77731295 TCTGGGAAACTAGGGCAGTGGGG - Intronic
1129821405 15:78604502-78604524 TCTGGGGATCCTGGTCACTGTGG + Intronic
1130653046 15:85773130-85773152 TCTGGGCCTCCTGTGCAGTTTGG - Intronic
1130887410 15:88105480-88105502 TCTGGGACTGCATGGCTGTGTGG - Intronic
1130969616 15:88721690-88721712 TCTGGGACTCCAGGGTTGAGGGG + Intergenic
1131134714 15:89925035-89925057 ACTGGGGCTCCAGGGCGGGAAGG + Intergenic
1132570822 16:643123-643145 TCTGGGGCTCCATCCTAGTGAGG + Intronic
1132576328 16:666054-666076 TCTTGAGCTCCATGGCCGTGCGG - Exonic
1132983161 16:2749559-2749581 TCTTGGGCCCCAGGCCAGGGGGG + Intergenic
1133007965 16:2895116-2895138 ACTGGGGCTCCAGGCCAGTGTGG - Intronic
1134451642 16:14367565-14367587 GCAGGGGCTCCAGGGCAAAGAGG + Intergenic
1136012087 16:27370295-27370317 TCTGTGGTTCCATGGCAGAGAGG - Intergenic
1136458992 16:30398384-30398406 CCTGGGGCTCCATGTGAGTGAGG - Exonic
1136564332 16:31061106-31061128 CCAGGGGCTCCAGGGGTGTGGGG + Exonic
1137489846 16:48923259-48923281 TCTGAGGCTGAAGTGCAGTGAGG + Intergenic
1140941939 16:79729968-79729990 TCTGGGTCTCCAGAGGGGTGAGG - Intergenic
1141635524 16:85312056-85312078 TCTGGGGGTGCAAGGCAGAGAGG - Intergenic
1141932340 16:87214364-87214386 TCTGTGGATCCAGGTCAGTGGGG - Intronic
1142114400 16:88348748-88348770 GTTGGGGTCCCAGGGCAGTGGGG - Intergenic
1142285435 16:89169729-89169751 TCTGGAGGTCCTGTGCAGTGGGG - Intergenic
1142321533 16:89386380-89386402 GGTGGGGCAGCAGGGCAGTGTGG - Intronic
1142330829 16:89452323-89452345 CTTGTGGCTCCAGGGGAGTGGGG - Intronic
1142401500 16:89861011-89861033 TCCGGGGCCGCAGTGCAGTGCGG - Intronic
1142624053 17:1180917-1180939 CAGGGGGGTCCAGGGCAGTGGGG + Intronic
1143001206 17:3796410-3796432 TCAGTGACTCCAAGGCAGTGAGG - Intronic
1143575965 17:7793263-7793285 CCTGGGGCCCCAGTGGAGTGGGG - Intronic
1144586611 17:16491548-16491570 TGTGGGGCCTCAGGGCAGGGCGG - Intronic
1144632393 17:16880859-16880881 TCTGGGGCTGCAAGGCAGCTGGG + Intergenic
1144659402 17:17058461-17058483 AGTGGAGCTCCAGGGCCGTGGGG + Intronic
1145771271 17:27494981-27495003 GAAGGGGCTCCCGGGCAGTGCGG + Intronic
1145786702 17:27598336-27598358 TCTGGAGCTCCAGGTCCATGAGG + Intronic
1146237921 17:31185529-31185551 TCTAGGGCTTCAGGGGTGTGGGG + Intronic
1146633841 17:34489752-34489774 ACTGGAGCTTCTGGGCAGTGGGG + Intergenic
1146793710 17:35766854-35766876 TCCGGGGCCCCAAGCCAGTGTGG - Exonic
1147121391 17:38337320-38337342 TCTGGGGCTCCAGGGACAAGTGG + Intronic
1147539641 17:41346539-41346561 TCTGCCGCTCCAGGTCACTGCGG + Exonic
1147541591 17:41364870-41364892 TCTGCCGCTCCAGGTCACTGCGG + Exonic
1147545068 17:41394939-41394961 TCTGCCGCTCCAGGTCACTGCGG + Exonic
1147673895 17:42192215-42192237 AGTGGGACTCAAGGGCAGTGAGG - Intronic
1147740705 17:42669749-42669771 GCTGAGGCTCCAGGGATGTGAGG + Intronic
1148397725 17:47323810-47323832 CCAGGGGCTCCGGGGCTGTGGGG - Intronic
1148711619 17:49685951-49685973 TCAGGGGCTCCAAGGAAGTTTGG + Intergenic
1148790020 17:50167715-50167737 TCGTGGGCTCCAGGTCATTGAGG + Exonic
1148804805 17:50258812-50258834 TCAGGGGCTCCCGGGCCCTGGGG - Intergenic
1148805306 17:50260903-50260925 GCTGGGCCTCTAAGGCAGTGTGG - Intergenic
1148858157 17:50590455-50590477 CCTCGGGCTGCAGGGCAGGGTGG - Exonic
1149435379 17:56629376-56629398 TCTGGGGCCCGGGGGCTGTGGGG + Intergenic
1149467195 17:56889446-56889468 TCTAGGACTCCAGGGTTGTGTGG + Exonic
1149661813 17:58338125-58338147 TCTGGGGCTCTGGGGCTCTGGGG - Intergenic
1150136483 17:62698111-62698133 CCTGGGTCTCCTGGGCTGTGGGG + Intergenic
1150799985 17:68273584-68273606 TCTGAGGATCCAGGGCTGTAGGG - Intronic
1151398846 17:73842726-73842748 TCTGGGGTCCCCGGGCAGAGGGG - Intergenic
1151977466 17:77490690-77490712 TCTGGGGGAGCGGGGCAGTGGGG - Intronic
1152243944 17:79175614-79175636 ACTGGGGAGCCAGGGCAGCGGGG - Intronic
1152409163 17:80113202-80113224 CCTGGGGCTGCAGGGCAGGCGGG - Intergenic
1152636544 17:81432733-81432755 TCTGGGGCTCGGGGGGAGGGTGG - Intronic
1152769130 17:82156807-82156829 TCTCAGGCTCCAGGACAGTGAGG - Intronic
1152799080 17:82322766-82322788 GCTGGGGCTCCAGGAGAGGGTGG - Intronic
1154199346 18:12288436-12288458 TCTCAGGCTCCAGGGCGGGGAGG - Intergenic
1156476766 18:37410404-37410426 TCCAGGGCTGCAGGCCAGTGTGG + Intronic
1157697228 18:49732600-49732622 TCAGGGGCTGCAGGGCTGGGTGG - Intergenic
1157706549 18:49812738-49812760 TTTGGTGCTCCAGGGCCCTGTGG - Intronic
1158960458 18:62583844-62583866 TCTGGGGTCCCAGGGCTGAGAGG + Intronic
1159028413 18:63207517-63207539 TCTGGTGCTCCCAGGCAGTCTGG - Intronic
1159028418 18:63207551-63207573 TCTGGTGCTCCCAGGCAGTCTGG - Intronic
1159028423 18:63207585-63207607 TCTGGTGCTCCCAGGCAGTCTGG - Intronic
1159888921 18:73936461-73936483 TCAGGGGCACCATGGCACTGGGG - Intergenic
1160744252 19:703457-703479 TGTGGGGCTGCAGGGCACTGGGG + Intergenic
1160810983 19:1012836-1012858 TGGGGGCCGCCAGGGCAGTGGGG - Intronic
1160930439 19:1567578-1567600 TCGGGGGCCCCAGGGCCGCGGGG + Exonic
1161112729 19:2479097-2479119 TTGGGGGCTGCAGGGCAGAGGGG - Intergenic
1161587303 19:5112642-5112664 TCTGGGACTCCTGGGCGGTCTGG + Intronic
1161731361 19:5962835-5962857 TCTGGTGGTCGGGGGCAGTGGGG - Intronic
1161984669 19:7646868-7646890 TCTGGGCCTCCAGGCCCTTGGGG - Intronic
1162639934 19:12000257-12000279 TGTGGGGCTCCACTGCTGTGGGG + Intergenic
1162914121 19:13865319-13865341 TCGGCGGCTCCGGGGCAGGGCGG - Intronic
1163155912 19:15439883-15439905 GGTGCTGCTCCAGGGCAGTGGGG + Intronic
1163525173 19:17816580-17816602 TCTGGGGCTCCCCTGGAGTGAGG + Exonic
1163611351 19:18303515-18303537 GCTGGGGCCTCAGGGCAGGGAGG - Intergenic
1163628312 19:18403574-18403596 TCTGGGGATCCTGGGGACTGAGG + Intergenic
1164704284 19:30308530-30308552 TTTGTTGCTCCAGGGCAGTGAGG + Intronic
1165152184 19:33767267-33767289 TCCATGGCTCCTGGGCAGTGGGG + Intronic
1165781701 19:38438427-38438449 TCAGGGGCCCCAGGGAGGTGGGG + Intronic
1165803659 19:38567595-38567617 TATGGGGCTCCAGTCCAATGTGG - Intronic
1166696638 19:44855485-44855507 TGTGGGGCTCCAGGGACCTGGGG + Intronic
1166698007 19:44865258-44865280 TCCTGGGCTCCTGGGCAGAGAGG - Exonic
1167152829 19:47719542-47719564 TCTGGGCCTCCAAGGCCATGGGG - Intronic
1167455401 19:49595011-49595033 TCTGGGGGGCCAGGGCGGTAAGG - Exonic
1167495081 19:49812922-49812944 TCTGGGTCTTCAAGGCAGTAGGG - Intronic
1167678132 19:50901561-50901583 GCTGGGGCTCGGGGGGAGTGGGG - Intergenic
1167946748 19:52994180-52994202 CCTGGGGCTCCAGGCCAGCCTGG + Intergenic
925020217 2:562845-562867 CCTGGGCCTGCAGGGCTGTGGGG + Intergenic
925078175 2:1037247-1037269 TTTGGGACACCAAGGCAGTGGGG + Intronic
925588572 2:5487564-5487586 TCTCTCCCTCCAGGGCAGTGGGG - Intergenic
926058670 2:9791875-9791897 TCTGGGCCTCCAGGACGGTGGGG + Intergenic
926165916 2:10522141-10522163 GCTGGGGCTGCAGGCCTGTGTGG - Intergenic
926217895 2:10916206-10916228 CCTGGGGCACCAGGGGAGGGAGG + Intergenic
926248542 2:11139368-11139390 TGTGGGGCTCAGGGGCTGTGAGG + Intronic
926320112 2:11743616-11743638 CCTGGGGCTCCGGGGAAGGGAGG - Intronic
927853077 2:26511986-26512008 GCTGGGGCCAGAGGGCAGTGGGG - Intronic
928097303 2:28412518-28412540 TCAAGCGCTCCAGGGCCGTGAGG + Exonic
929450092 2:42030993-42031015 TCTGGGTCTGCTGGGCACTGGGG - Intergenic
929969563 2:46562275-46562297 TCTCTTTCTCCAGGGCAGTGAGG - Intronic
930691808 2:54372588-54372610 TCTGGGGCTGCTGTGCTGTGAGG + Intronic
931221746 2:60294999-60295021 TCTGGGCCTCCGGTGCAGTCTGG + Intergenic
932404153 2:71502831-71502853 GCTGGGGCTCAGGGGCAGTGTGG + Intronic
932476350 2:72008761-72008783 CCTGGTGCTCCCGAGCAGTGAGG - Intergenic
932619752 2:73258566-73258588 TCTGGGGCCCCAAGCCAATGGGG - Exonic
934865915 2:97811095-97811117 TATGGGGATTCATGGCAGTGGGG - Intronic
935789774 2:106580467-106580489 GCTGGGTCTCCTGGACAGTGTGG - Intergenic
935848919 2:107197901-107197923 TCAGGTGCTAGAGGGCAGTGTGG - Intergenic
936089814 2:109494364-109494386 TCTGGGGCTCATGAGCAGTTTGG - Intronic
937065600 2:119014488-119014510 TCAGGGGTTCCAGGCCAGTCTGG + Intergenic
937248899 2:120511199-120511221 GCCGGGGCTCCAGGGCAGCCAGG + Intergenic
937304134 2:120860760-120860782 TCTGGGACTCTAGAGCAGTGAGG + Intronic
938079652 2:128362933-128362955 GCTGGGGCTCCAGGGTGGTCTGG - Intergenic
938288424 2:130136957-130136979 TCTGGGGGCCCAGGGCAGGCAGG + Intergenic
938468104 2:131535979-131536001 TCTGGGGGCCCAGGGCAGGCAGG - Intergenic
940792820 2:158046005-158046027 TCTGGGGCTATAGGGCAGATTGG - Intronic
941159280 2:162017597-162017619 TCTGGGACTCCATGGGAGTGGGG - Intronic
942131087 2:172880185-172880207 TCTGGGGCATCAGGGAAGTGAGG - Intronic
942645893 2:178111169-178111191 CCTGGGGTTGGAGGGCAGTGAGG - Intergenic
943069865 2:183127861-183127883 TCAGGAGCTCCAGAGCAGTCTGG + Intronic
944984234 2:205156573-205156595 TGTGGGGCTCAAGCACAGTGTGG - Intronic
945944318 2:215980293-215980315 TCTGGGGCTCCAGGGCAGTGAGG + Intronic
946404695 2:219486176-219486198 TCTGGAGCTCCAGGACACTCAGG - Intronic
948009082 2:234636485-234636507 CCTAGGGCTCCAGGCCTGTGAGG - Intergenic
948593720 2:239066641-239066663 TCTGGGGCTCTCGGGCAGCCAGG + Intronic
948660478 2:239503535-239503557 TCTGGGGTTCCTGGGCTGTGGGG - Intergenic
949026248 2:241767762-241767784 CGTGGGGCTCCAGGGCAGCCAGG - Exonic
1168807498 20:681114-681136 CCTGGGGCTCCTGGGCAGGAAGG - Intergenic
1169135106 20:3192485-3192507 TGTGGGGGACCAGGCCAGTGGGG - Intronic
1169163826 20:3406524-3406546 TGTGGGGCGCCGGCGCAGTGTGG - Intronic
1169839696 20:9921436-9921458 TCTGATGCTCTAGGGCAGTGTGG - Intergenic
1170332056 20:15223991-15224013 TCTGAGGCTGCTGTGCAGTGAGG + Intronic
1170613748 20:17933503-17933525 TTTGGGGGTCCAGGGCCCTGAGG + Intergenic
1171291560 20:23985612-23985634 TGTGGGGCCCCAGGGCATCGTGG - Intronic
1171381534 20:24737677-24737699 TGAGGGGCTCCAGGGAAGTCAGG - Intergenic
1171382890 20:24746517-24746539 TTCAGGGCTCCTGGGCAGTGAGG + Intergenic
1171869563 20:30514232-30514254 TGTGGGGCTGCAGGGGAGGGGGG + Intergenic
1172482611 20:35279827-35279849 ACTGGGGCTGCAGGTCAGGGAGG - Intronic
1172876069 20:38165137-38165159 TCAGGGGCCCCGGGGCATTGGGG - Intronic
1173482721 20:43416112-43416134 GCTCCGGATCCAGGGCAGTGTGG - Intergenic
1173522850 20:43712124-43712146 GCAGGGGCTCCTGGGCAGGGGGG + Intronic
1173824471 20:46038806-46038828 TCTAGGTTTCCAAGGCAGTGTGG - Intronic
1174402146 20:50281965-50281987 TCTAGAGCTCCACGGAAGTGGGG + Intergenic
1174443599 20:50575520-50575542 AGTGGGGCTCCAGGGCTGTGTGG + Intronic
1175160651 20:57005311-57005333 GCTGAGCCCCCAGGGCAGTGAGG + Intergenic
1175224951 20:57439385-57439407 GCTGGGGGTGCAGGGCAGAGGGG - Intergenic
1175403436 20:58713188-58713210 TCTGGCTCTCCAGAGCAGCGGGG + Intronic
1175797158 20:61778918-61778940 ACTGGGGCTTCAGGGGAGAGAGG + Intronic
1176087788 20:63305925-63305947 TCCGGGGCTCCAGAGCCGAGGGG - Exonic
1176114275 20:63424297-63424319 TCAGGGGCTGCAGGGGAGGGGGG + Intronic
1176141982 20:63548851-63548873 TCTGTGACTCCAGGGCAGGCAGG - Intronic
1176199849 20:63855311-63855333 GCTGTGGCCACAGGGCAGTGGGG + Intergenic
1176199865 20:63855359-63855381 GCTGTGGCCGCAGGGCAGTGGGG + Intergenic
1179255519 21:39712241-39712263 ACAGAAGCTCCAGGGCAGTGCGG + Intergenic
1179427113 21:41290420-41290442 AGCGGGGCTGCAGGGCAGTGGGG - Intergenic
1179437681 21:41373575-41373597 TGTGGGGCTGAAGGGCAGAGGGG - Intronic
1179545439 21:42110054-42110076 TCTCGGGCTCCAGGCCACTGGGG - Intronic
1179634173 21:42696761-42696783 TCTGGGTCTGTAAGGCAGTGAGG + Intronic
1179713964 21:43278392-43278414 TCTGGGGGTACAGGGCAGGAAGG + Intergenic
1179911372 21:44450722-44450744 GCAGGGGCTCCAGGGCTCTGGGG - Intergenic
1180160166 21:45995657-45995679 GCAGGGCCTCCAGGGCTGTGGGG + Intronic
1180468272 22:15635965-15635987 TCTGGGGGCCCAGGGCAGGCAGG - Intergenic
1180836838 22:18934182-18934204 TGTGAGGCACCCGGGCAGTGAGG - Intronic
1181116819 22:20636607-20636629 CCCGGGGCTCCTGGGCAGAGTGG + Intergenic
1181379380 22:22488282-22488304 TAGAGGGCTCCTGGGCAGTGTGG + Exonic
1181790611 22:25262890-25262912 TCTGGGGCCCCAGAGGAGTGAGG + Intergenic
1181826427 22:25519943-25519965 TCTGGGGCCCCGGGGGAGTGAGG + Intergenic
1181900956 22:26155374-26155396 TCTGGGGCTCCACTCCACTGGGG - Intergenic
1182516586 22:30862338-30862360 TCTTGGCCTCCAGGGCCATGGGG + Intronic
1183340456 22:37277786-37277808 GATGGGGGTCAAGGGCAGTGGGG - Intergenic
1183367022 22:37412366-37412388 ACTGGGGCTCCTGGGAATTGAGG + Intronic
1183453777 22:37910638-37910660 TCTGGTGCCCCAGGGCTGGGTGG - Intronic
1183704800 22:39469841-39469863 GCCGGGGCTGCAGGGCAGGGCGG + Intronic
1183706908 22:39479815-39479837 TGTGGAGGCCCAGGGCAGTGCGG + Intronic
1183830549 22:40416452-40416474 TCCTGGGCACCAGGGCAGGGTGG - Intronic
1183860617 22:40667355-40667377 TCTTGGGGCCCAGGGCAGGGTGG - Intergenic
1183942297 22:41302395-41302417 TCTGGGCCTGCTGGGCAGGGGGG + Intronic
1183952366 22:41358814-41358836 TCTGGGGAACCAGGGCACGGTGG - Exonic
1184677854 22:46053415-46053437 TCCGGGGCTCTCGGGCTGTGGGG + Intronic
1184684406 22:46089647-46089669 CCTGGGCCACCAGGGCAGGGTGG - Intronic
1185288990 22:50014710-50014732 TCTGGGTCTCCAGGGCAGCACGG + Intergenic
1185315835 22:50178742-50178764 ACTGCGGCTCCGGGACAGTGGGG + Intronic
1185330378 22:50249593-50249615 ACTGGGGCTGCAGGGAAGGGTGG + Intronic
1203286931 22_KI270734v1_random:159481-159503 TGTGAGGCACCCGGGCAGTGAGG - Intergenic
949613973 3:5733615-5733637 TCTTGGGCTCAAGGTCAGAGAGG + Intergenic
950171411 3:10841405-10841427 TCTCAGCCTGCAGGGCAGTGGGG - Intronic
950277540 3:11675426-11675448 TCAGGGGTTCTAGGGCAGTATGG + Intronic
950744387 3:15074912-15074934 GCTGGGACTCCAGGGCAGCCTGG + Exonic
951269082 3:20603161-20603183 ACTGGGGCCCCAGGCCAGTGGGG + Intergenic
953026991 3:39151229-39151251 TCTGGGGTTCCTCGGCGGTGTGG - Intronic
953260747 3:41336748-41336770 ACTGGGTCTCCTGGGCAGTCTGG + Intronic
953384564 3:42499262-42499284 TCAGGGGCTCCATGGTGGTGAGG - Intronic
953774056 3:45800657-45800679 TCTGGTGCCCCATGGCAATGGGG + Intergenic
953854656 3:46491966-46491988 TCTGGGGTTCCAGGGGTGGGAGG - Intergenic
955392487 3:58531617-58531639 TCTGGGGCCCCAGGTCAGGGAGG + Intronic
957665423 3:83218907-83218929 TCTGAGCCTACAGGGCAGGGAGG + Intergenic
961461219 3:127051648-127051670 TCCGTGGCACCAGGGGAGTGGGG - Intergenic
961649218 3:128409094-128409116 CCTGGGGCTACAAGGCAGGGTGG - Intergenic
963180359 3:142348992-142349014 ACTGAGGCTGCAGTGCAGTGGGG + Intronic
966769420 3:183491149-183491171 TCCCGGGCTGCAGTGCAGTGTGG + Exonic
966941151 3:184748162-184748184 TCTTGGGGTCCAGGACACTGGGG - Intergenic
967246375 3:187491225-187491247 TATGGGTCACCAGGGAAGTGAGG - Intergenic
968038138 3:195565909-195565931 TCTAGCTCTGCAGGGCAGTGAGG + Intergenic
968285323 3:197505221-197505243 TGAGGGGCTCCAAGGCTGTGCGG + Intergenic
968583533 4:1405731-1405753 CCAGGGGCTGCAGGGCTGTGAGG - Intronic
968703171 4:2066218-2066240 TCTGAGAGTCCTGGGCAGTGTGG + Exonic
968921877 4:3526579-3526601 TCTCGGGCTGCAAGGCAGTGTGG - Intronic
968946269 4:3666064-3666086 AGTGGAGGTCCAGGGCAGTGTGG + Intergenic
971055411 4:22907669-22907691 ACTGGGGCTCTCGGGGAGTGGGG - Intergenic
973737360 4:53885736-53885758 TCCAGGGCTCCAGGGAGGTGGGG - Intronic
973975132 4:56255682-56255704 TCTAGGGGTCTAGGGCTGTGAGG + Intronic
974557558 4:63471472-63471494 TCTAGGGCTCCAGAGACGTGGGG + Intergenic
975142396 4:70931770-70931792 TCTGAGGCTGGAGTGCAGTGGGG + Intronic
975626955 4:76359964-76359986 TCTAGGCCTCCAGGCCAGTGAGG - Intronic
976928220 4:90529254-90529276 ACTGGGGCTGGAGTGCAGTGGGG + Intronic
977501438 4:97843871-97843893 TCTGGGGTTACAGGTCAGTCAGG - Intronic
979216569 4:118171555-118171577 TCTAGGGCCACAGGGAAGTGAGG - Intronic
979785549 4:124712336-124712358 TCTGGGGCTCGAGGCCGGAGAGG + Intronic
980958698 4:139453892-139453914 TCGGGGGCTTCACGGCAGCGCGG - Exonic
981207706 4:142063307-142063329 GCTTGGGCTCCTGGGCAGGGTGG - Intronic
984248132 4:177300321-177300343 TCTTTGACTCCAGGCCAGTGAGG - Intergenic
985649938 5:1102756-1102778 CCTGTGGCTCCAGGGGAGGGTGG - Intronic
985849478 5:2378307-2378329 TCACGGGCTCCAGGGAAGTCAGG + Intergenic
985891167 5:2716068-2716090 CCTGGGCCTCCTGGGCAGGGTGG - Intergenic
986340853 5:6788167-6788189 CCAGGGGCTGCAGGGCAGGGTGG + Intergenic
986773614 5:10994752-10994774 TCTGGGTGTCCAGGACAGTTTGG + Intronic
991957409 5:72009294-72009316 TAAGGGACTCCAGGCCAGTGAGG - Intergenic
992126331 5:73646052-73646074 TCTGGTGCAGCAGGGAAGTGGGG - Intronic
993896220 5:93538357-93538379 TCTGAGCCTCCCGAGCAGTGGGG - Intergenic
994835612 5:104848645-104848667 CCGGGGCCTCTAGGGCAGTGGGG - Intergenic
995835796 5:116398297-116398319 TCTGGGAAGGCAGGGCAGTGGGG - Intronic
997672963 5:135691430-135691452 TCAGGGTCTCCAGGGCAGCTTGG + Intergenic
998252805 5:140564107-140564129 TCTGGGGCTCAAAGACGGTGGGG - Intronic
998290392 5:140908968-140908990 TCTAGGGGTCCAGTGGAGTGGGG - Intronic
998879732 5:146633767-146633789 TCTGGGGCTCCCTGGGTGTGTGG + Intronic
999149981 5:149420495-149420517 CCTTGGGCTCCAGGGCCGTAGGG - Intergenic
1000043102 5:157499734-157499756 GCTGGGGTTCCAGGGGTGTGTGG - Intronic
1001721769 5:173862726-173862748 TCTGAGGCTTCAGGACACTGGGG - Intergenic
1001929752 5:175664535-175664557 CCTGAGACCCCAGGGCAGTGGGG + Intronic
1002965675 6:1963952-1963974 TCTGCTGCTCCTAGGCAGTGTGG - Intronic
1003559679 6:7170389-7170411 TCTGCTGCTCCTGGGCAGTGAGG - Intronic
1004971577 6:20916505-20916527 ACTGGGGGTGCAGGTCAGTGAGG + Intronic
1005740845 6:28789173-28789195 TCTGGGGTTCGAGACCAGTGTGG + Intergenic
1005962733 6:30705183-30705205 TCTGGAGCTCAGGGGCTGTGGGG + Exonic
1006022412 6:31125220-31125242 TCTGGGGCTCCAGGGCCTGTGGG + Intronic
1006256445 6:32836252-32836274 TCTGGGGCTCCAGAGAATTGTGG - Intronic
1006734403 6:36262289-36262311 TCTGGGGATTCAGGGCAGAGTGG - Intronic
1006914534 6:37585828-37585850 CCCCAGGCTCCAGGGCAGTGGGG - Intergenic
1007067155 6:39002129-39002151 TCTGGGGCTCCAGGGAAATGTGG + Intronic
1007369922 6:41420049-41420071 ACTGGGAGTCCAGGGCAGGGGGG + Intergenic
1007993745 6:46284309-46284331 TCTGTGACTCCAGGGATGTGGGG + Intronic
1011109556 6:83821909-83821931 TCTGAACCACCAGGGCAGTGGGG - Intergenic
1012052635 6:94362623-94362645 TCTGGGGATGCAGGGCACAGGGG + Intergenic
1013366904 6:109443694-109443716 ACTGGGGGTCCAGAGCAGTATGG - Exonic
1013777930 6:113699914-113699936 TGTGGGGCTCCATGTCAGAGAGG + Intergenic
1014748336 6:125226520-125226542 TATGGGGCTCCATGGCTATGAGG + Intronic
1015035199 6:128645131-128645153 TTTGGGCCTTCAGAGCAGTGAGG + Intergenic
1015140686 6:129928184-129928206 TCTGAGGCTCCAGGGGGGTGGGG - Intergenic
1015147671 6:130005591-130005613 TGTGGGGCAGGAGGGCAGTGGGG + Intergenic
1015206876 6:130650333-130650355 TCTGGGGCTAGGGGGCAGTGGGG - Intergenic
1016202614 6:141430515-141430537 TCTGGGCCTCCAGGCCCGTGAGG + Intergenic
1016558776 6:145370630-145370652 TCTGGCTTTCCAGGGCACTGAGG + Intergenic
1016940909 6:149482273-149482295 GCTGCGGCTCCAGGGCCGAGTGG - Intronic
1017238691 6:152143739-152143761 TCTGTGACTCTAGGGCACTGTGG + Exonic
1018862717 6:167722767-167722789 TCTGGCTCCCCAGGGCAGAGGGG + Intergenic
1019020887 6:168916744-168916766 TGTGGGGCCCCAGGGCAGCTTGG - Intergenic
1019172151 6:170138604-170138626 TCTGTGGCTCAAGGGGATTGGGG - Intergenic
1019649349 7:2148373-2148395 TGTGGGGCTGGTGGGCAGTGGGG - Intronic
1019929874 7:4216309-4216331 TGTGGAGGTGCAGGGCAGTGAGG - Intronic
1021634935 7:22682780-22682802 TCTGGAGCTGCATGGCAGGGAGG + Intergenic
1023103999 7:36746261-36746283 TCGGGGAGTCCAGGGAAGTGAGG - Intergenic
1023777302 7:43620096-43620118 TCTGAGGCTCCATAGAAGTGTGG + Intronic
1024004683 7:45216739-45216761 GCAGGGGATGCAGGGCAGTGGGG + Intergenic
1024216522 7:47253729-47253751 CCTGTGTCTCCGGGGCAGTGTGG + Intergenic
1024934812 7:54701375-54701397 TCTGCGTCTCCAGTGCAGGGGGG + Intergenic
1026145815 7:67745552-67745574 TCTGGTGCTCCAGGGCTGCAGGG + Intergenic
1027216702 7:76188441-76188463 GCTGGGGCTCCAAGTCAGTGTGG + Intergenic
1028206311 7:88021162-88021184 TCTTGGGGCACAGGGCAGTGTGG + Intronic
1028627078 7:92889337-92889359 TGTGGGGTTGCAGGGGAGTGAGG + Intergenic
1031763139 7:125739428-125739450 TCTGGGGCTCAAGGCCAGGGAGG - Intergenic
1032021393 7:128408875-128408897 TAAGGGGCTCCTCGGCAGTGGGG - Intronic
1032392987 7:131568557-131568579 TTTGGGGATCCAGGGTGGTGTGG - Intergenic
1033220328 7:139523374-139523396 GCTGTGGCTCCAGGGCAGCCGGG + Intergenic
1034005012 7:147462071-147462093 TCTGGGTCACGAGAGCAGTGTGG - Intronic
1034446150 7:151115208-151115230 TCTGGGGCGCGCGGGCAGCGCGG + Intronic
1034662157 7:152780885-152780907 ACCCGGGCTACAGGGCAGTGGGG + Intronic
1034973274 7:155432449-155432471 TCTGAGGCTCCTGGGCTCTGAGG + Intergenic
1035330642 7:158094860-158094882 TCAGGGTCTCCTGGGCACTGTGG + Intronic
1036777097 8:11620967-11620989 CGTGAGGCTCCAGGGCGGTGAGG - Intergenic
1037427151 8:18768353-18768375 CCTGGGCCTCCCAGGCAGTGTGG - Intronic
1037671870 8:21022144-21022166 TCTGGAGCCCCAGGGCAATGGGG - Intergenic
1037772423 8:21810364-21810386 GCTATGGCTCCAGGTCAGTGAGG - Intronic
1037833903 8:22205061-22205083 TCTGAGGCTTCAGGGCAGCAGGG + Intronic
1038318945 8:26511404-26511426 TCTGGGGCTCCTGGGCACAGGGG - Intronic
1038490653 8:27968178-27968200 TCTGGGGGACCAGGGCAGTGTGG - Intronic
1039056954 8:33544535-33544557 TCTGAGTCTCGAGAGCAGTGTGG - Intergenic
1039503003 8:38031460-38031482 GCTGGGGCTCCGGGGCTGGGAGG - Intronic
1040502910 8:48020995-48021017 CCTTGGGCTCCAGAGCACTGGGG + Intronic
1041988365 8:63954421-63954443 TCTGGGGCTCCAGGGTGTCGTGG - Intergenic
1042837295 8:73090456-73090478 ACTGTGGCTCCTGGGCAGGGCGG - Intronic
1044202334 8:89452062-89452084 TCTGGGGGTCCAGTGGTGTGGGG + Intergenic
1044682735 8:94798747-94798769 TCTGTGGCTACAGGGCTGTGGGG - Intergenic
1045374162 8:101554241-101554263 CCCAGGACTCCAGGGCAGTGTGG - Intronic
1047456557 8:125018247-125018269 TCTGGGGGTTAAGAGCAGTGGGG + Intronic
1047767301 8:128000341-128000363 TGTGGGCCTCCTGGGCAGTCAGG + Intergenic
1048060798 8:130917572-130917594 TCCGGGGCACCAGGGCAGGAAGG - Intronic
1048318038 8:133376252-133376274 TCTGTGTCCCCAGGGCACTGTGG + Intergenic
1048514507 8:135093647-135093669 TCTGGGGCTGCATGGCAGATGGG + Intergenic
1048524353 8:135187655-135187677 TCCGAGGCTCCAGGGAGGTGAGG - Intergenic
1049208169 8:141373007-141373029 CCTGGGGTTCCCGGGCTGTGGGG - Intergenic
1049278673 8:141732904-141732926 TCTGGGCATCCAGGGCTGTGAGG + Intergenic
1049594215 8:143475997-143476019 CCTGGGGCTGCAGGGCAGAGGGG + Intronic
1049603205 8:143517627-143517649 GCTGGGGCTGCAGGCCAGTGGGG - Intronic
1049644522 8:143730105-143730127 TCTTGGGCTTGAGGGTAGTGGGG - Intronic
1049787758 8:144459202-144459224 TCTGCGGCCCGAGGGCAGTGTGG - Intronic
1055803020 9:80061135-80061157 GCTGGTGCTCTTGGGCAGTGGGG + Intergenic
1056626440 9:88257395-88257417 TTTGGGGTTCTAGGGCATTGAGG - Intergenic
1056753147 9:89365946-89365968 TCTGGTGATCCTGGACAGTGGGG - Intronic
1057222761 9:93266723-93266745 TCTGGGGTGCCAGGGGAGTGTGG + Intronic
1057386014 9:94606670-94606692 TGTGGGGCTCCTGAGCAGTGTGG - Intronic
1058544231 9:106043174-106043196 TCTGGGGATCCAGTGATGTGGGG - Intergenic
1058864012 9:109145021-109145043 TGTGGGGCTACAGGGGAGAGAGG - Intronic
1060214767 9:121732041-121732063 TCTGGGGGGCCAGGGCTGAGGGG + Intronic
1060297048 9:122350004-122350026 ACTGAGGTGCCAGGGCAGTGTGG + Intergenic
1060930296 9:127485670-127485692 CCTGGGGCACCTGGGCAGGGAGG - Intronic
1060933423 9:127503020-127503042 ATGGGGGCTCCTGGGCAGTGGGG - Exonic
1061278305 9:129582227-129582249 TCTCGGGCTGCAGGGAAGAGAGG - Intergenic
1061306723 9:129736623-129736645 TCTGCGGCTCCAGTGTGGTGGGG + Intergenic
1061318735 9:129814537-129814559 TGTGGAGCTCCAGATCAGTGGGG + Intronic
1061548001 9:131315820-131315842 TCTTGGGCTCCTGGTCACTGTGG + Intergenic
1061947070 9:133914526-133914548 TCTGGTGACCAAGGGCAGTGGGG + Intronic
1062076794 9:134594120-134594142 GCTGGGGCTGCCAGGCAGTGAGG + Intergenic
1062094429 9:134695589-134695611 TATGGGGGTACAGGGGAGTGGGG - Intronic
1062413738 9:136437748-136437770 ACTTGGGCACCATGGCAGTGGGG + Intronic
1062441425 9:136571414-136571436 TAGGGGGCTGAAGGGCAGTGTGG + Intergenic
1062567367 9:137169227-137169249 TCGGGGTCTGCAGGGCGGTGCGG - Intronic
1062697790 9:137884343-137884365 TCTGTGGCTCCACGGCCCTGGGG + Intronic
1188744889 X:33829765-33829787 TGTGGGGCTCCATGGGAGTGAGG + Intergenic
1190746451 X:53325807-53325829 TCTCAGCCTCCAGGGCTGTGAGG + Intergenic
1191984332 X:66962182-66962204 TCTGCTGCTCCTGGGCAGTGGGG + Intergenic
1193440637 X:81536155-81536177 GCTGGGGTTTCAGGACAGTGGGG + Intergenic
1194201484 X:90957981-90958003 TCTGGAGGTCCTGGTCAGTGAGG - Intergenic
1195750777 X:108160636-108160658 TCAGGAGCTCCAGGGCAGCAAGG - Exonic
1196093755 X:111776209-111776231 TCTGGGGGGCAGGGGCAGTGAGG + Exonic
1199614533 X:149646492-149646514 TGTGGGGCTCCAGGTGAGAGTGG - Intergenic
1199778748 X:151038774-151038796 TCTGGGGCTCAAGAGGAGTGGGG + Intergenic
1199875570 X:151925355-151925377 TATGGGGCTCCAGGTGAGAGTGG + Intergenic
1199893811 X:152113827-152113849 TGTGGGGCTCCAGGTGAGAGTGG - Intergenic
1200065721 X:153503298-153503320 TCTGGGGCTCCAGCAGAGCGAGG - Intronic
1200215086 X:154364740-154364762 CCTGAGGCTCCAGGGCACTGAGG - Intronic
1200547325 Y:4533436-4533458 TCTGGAGGTCCTGGCCAGTGAGG - Intergenic
1200831852 Y:7693191-7693213 TCTGGGAAGGCAGGGCAGTGGGG - Intergenic