ID: 945946118

View in Genome Browser
Species Human (GRCh38)
Location 2:215997574-215997596
Sequence ACCTCACTAGAGTCTAGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945946118 Original CRISPR ACCTCACTAGAGTCTAGCAT GGG Intronic
906401010 1:45504680-45504702 ACCTCACTGCACTCTAGCCTAGG + Intronic
910377428 1:86587714-86587736 ACCTCACTGGAATCAAGCAATGG - Intergenic
910404564 1:86873408-86873430 CCATCATTAGAGTCTAGAATAGG + Intronic
912862326 1:113225209-113225231 GCATCACTACACTCTAGCATGGG - Intergenic
917466579 1:175283150-175283172 ACCTCACTACACTCCAGCCTTGG - Intergenic
917815877 1:178709481-178709503 ACGTCACTATACTCTAGCCTGGG + Intergenic
920066152 1:203271331-203271353 ACCACACTAGATTCTGGCCTCGG + Intronic
1063815996 10:9772555-9772577 ACATCACTACACTCTAGCCTGGG - Intergenic
1069119275 10:64548561-64548583 ACCTCACTATCCTCTAGCCTGGG + Intergenic
1075103374 10:119521223-119521245 ACCTCACTATATTCCAGCCTGGG + Intronic
1078086480 11:8236232-8236254 ACATCACTACACTCCAGCATGGG - Intronic
1078585037 11:12577825-12577847 AACTCACTAGAGCATAGCAAAGG - Intergenic
1084806721 11:71584416-71584438 ACCTCACAACACTCTTGCATTGG - Intronic
1086537477 11:87865500-87865522 CCCTCCCTAGAGTCTCCCATAGG + Intergenic
1095125091 12:38467333-38467355 ACCTCACTGCACTCTAGCCTGGG + Intergenic
1095168841 12:39008902-39008924 TTCTTACTAGAGTCTAGAATGGG - Intergenic
1097628385 12:62029864-62029886 ACTTCTCTAGAGTCCTGCATGGG - Intronic
1098042878 12:66370021-66370043 ACATGACCAGAGTCTAGAATTGG - Intronic
1098532552 12:71557423-71557445 ACCTCACTAGAGCCTAAAATGGG - Intronic
1100753027 12:97720334-97720356 TCATCACCAGAGTCCAGCATGGG + Intergenic
1100913235 12:99389124-99389146 AGGTCACTAGAGTCTAGGAGAGG + Intronic
1101776978 12:107804608-107804630 ACCTCACTGCACTCCAGCATGGG + Intergenic
1106746208 13:32711031-32711053 ACCACACTACACTCCAGCATGGG - Intronic
1107971899 13:45651178-45651200 ACTTCACTAAAATCTAGAATGGG - Intergenic
1109300651 13:60586877-60586899 ACCACACTACACTCCAGCATGGG + Intergenic
1110015911 13:70403175-70403197 AACTCAATAGAGTTTATCATTGG + Intergenic
1112939942 13:104848835-104848857 GCATCACTATACTCTAGCATAGG + Intergenic
1116751916 14:48897025-48897047 ACCACACAAGAGTCTAGTCTAGG + Intergenic
1119147454 14:72330121-72330143 GCCTCACTAGGATCTACCATTGG + Intronic
1122777641 14:104129075-104129097 ACATCACTATACTCTAGCCTGGG - Intergenic
1129405539 15:75314626-75314648 ACATCACTGCAGTCTAGCCTGGG + Intergenic
1130052202 15:80493272-80493294 ACCTCACAACACTCTTGCATTGG + Intronic
1130559311 15:84945900-84945922 ACCTCACTGTACTCTAGCCTGGG - Intergenic
1137629921 16:49935850-49935872 GCCTCACTCGAGTATAGCCTTGG - Intergenic
1138962208 16:62040437-62040459 ACCTCACTAATGTTTAGTATGGG + Intergenic
1141155084 16:81591865-81591887 ACGTCACTACACTCTAGCCTAGG - Intronic
1146567217 17:33923833-33923855 AACTCCCTGTAGTCTAGCATGGG - Intronic
1147618130 17:41843081-41843103 ACCTCACTGCAGTCCAGCCTGGG + Intronic
1149216415 17:54359275-54359297 ACCTCCTTACAGTCTTGCATGGG + Intergenic
1151250279 17:72828873-72828895 AACTCACAGGAGTCAAGCATCGG + Intronic
1155996592 18:32337086-32337108 ATCTCCCTAGAGTCTCTCATTGG - Intronic
1156311941 18:35931731-35931753 ACATCACTGCACTCTAGCATGGG + Intergenic
1158983219 18:62786047-62786069 ACCACACTAGAGGCTATCACTGG - Intronic
1162678230 19:12317193-12317215 ACATCACTGCATTCTAGCATGGG - Intergenic
1168034125 19:53705428-53705450 ACGTCACTACACTCCAGCATGGG - Intergenic
1168480695 19:56717394-56717416 ACACCACTACAGTCTAGCCTGGG - Intergenic
1168663576 19:58185520-58185542 ACCTGAATAGAGTCAAGCTTGGG + Intronic
926015363 2:9446536-9446558 ACGCCACTAGACTCTAGCCTGGG + Intronic
927879660 2:26681638-26681660 ACCTCACTAGCATCTAACCTGGG - Intergenic
928371613 2:30744189-30744211 TCCCCACTATAGTCAAGCATAGG + Intronic
931596244 2:63947877-63947899 ACCTCACTACACTCCAGCCTTGG - Intronic
938784908 2:134618069-134618091 ACATCACTACAGTCCAGCCTGGG + Intronic
944888194 2:204086908-204086930 GCCTCCTTAGAGTCAAGCATGGG + Intergenic
944900480 2:204208848-204208870 ACCTCACAACACTCTTGCATTGG + Intergenic
945946118 2:215997574-215997596 ACCTCACTAGAGTCTAGCATGGG + Intronic
947581150 2:231319453-231319475 CCCTTACTAGTGCCTAGCATGGG - Intronic
1178551047 21:33539648-33539670 ACGTCACTACACTCTAGCCTGGG + Intronic
949345026 3:3068530-3068552 ACATCACTACACTCTAGCCTGGG + Intronic
954454508 3:50590511-50590533 ACCTCACTACCCTCTAGCGTGGG + Intergenic
955532927 3:59893127-59893149 ACCTGACTAAAGTTTGGCATTGG + Intronic
960593139 3:119384711-119384733 ACCTCACAACAGTGTTGCATTGG + Intronic
963237699 3:142971990-142972012 GCCTCAGGAGAGACTAGCATGGG + Intronic
968776070 4:2540916-2540938 ACATCACTACACTCTAGCCTGGG + Intronic
977748712 4:100582279-100582301 ACATCACTGCAGTCTAGCCTGGG - Intronic
981501256 4:145454371-145454393 ACGTCACTATACTCTAGCTTGGG - Intergenic
983191451 4:164758674-164758696 ACGTCACTGCAGTCTAGCCTGGG - Intergenic
985369898 4:189275587-189275609 ACCACACTACATTCCAGCATAGG - Intergenic
985942616 5:3150711-3150733 ACCTCCCTAGAGTCTCTCGTAGG - Intergenic
986511805 5:8515024-8515046 ACCTCACTAAAGCCAAGCAAGGG + Intergenic
987702721 5:21422486-21422508 ACATCACTACACTCTAGCCTGGG - Intergenic
988824936 5:34926908-34926930 ACCTCACTAGAGGCTATTAGAGG + Intergenic
993902233 5:93592468-93592490 AACTAACTAGAGGCAAGCATAGG - Intronic
997971412 5:138405461-138405483 ACTTCACTGCACTCTAGCATAGG + Intronic
1002632926 5:180592848-180592870 ACCTCACTACACTCCAGCCTGGG - Intergenic
1003972831 6:11315400-11315422 ACCTCATTAGAATCTTGCATGGG - Intronic
1004818595 6:19340232-19340254 ACATCACTAGAGTCTAGGTAAGG - Intergenic
1005249665 6:23929995-23930017 ACCTCACTGTACTCCAGCATGGG + Intergenic
1012517919 6:100084710-100084732 ACATCACTGGAGTTTATCATTGG - Intergenic
1012651221 6:101755526-101755548 AACTCTCTAGAGTCTAGACTAGG - Intronic
1012860279 6:104551396-104551418 ACCTCACTATAGCCTGGCAAAGG - Intergenic
1015227304 6:130872526-130872548 ACCTCTCTAGAGCCTAGAAGAGG - Intronic
1018667311 6:166150408-166150430 GCCTCACTACACTCTAGCCTGGG - Intergenic
1019469665 7:1211986-1212008 ACCTCACTGCATTCTAGCTTGGG - Intergenic
1020143136 7:5623222-5623244 ACCTCAATGGAATCTAGCCTGGG + Intronic
1024134512 7:46392700-46392722 ACCTCCCTAGAGTCGAGCTTTGG - Intergenic
1027746146 7:82076837-82076859 ACCTCACTAGTCTCCAGCAGTGG + Intronic
1030016251 7:105225126-105225148 AGATCACTTGAGTCTAGCCTAGG + Intronic
1030610266 7:111681121-111681143 ACCCCACTGGACTCTAGCCTGGG + Intergenic
1033903942 7:146178074-146178096 ACGTCACTACACTCTAGCCTGGG - Intronic
1036931575 8:12961375-12961397 ACCTCACTTGATGCTAGCATAGG + Intronic
1039066893 8:33617021-33617043 ACACCACTATACTCTAGCATGGG - Intergenic
1040778194 8:51072961-51072983 ACCTCACTACAGTCCAGAGTGGG - Intergenic
1041908084 8:63055413-63055435 ATCTAACTAGTGTCTAGCACAGG - Intronic
1043417036 8:80061639-80061661 ACATCACTGCACTCTAGCATGGG + Intronic
1045378996 8:101604262-101604284 AACTCACTAGGGTCTTGCGTGGG - Intronic
1047582552 8:126232332-126232354 ACATAACTACAGTATAGCATTGG + Intergenic
1049743339 8:144251543-144251565 TCCTCACTGAAGTCCAGCATGGG + Intronic
1049878083 8:145040423-145040445 ACACCACTAGAGTCCAGCCTGGG - Intergenic
1051531843 9:18112811-18112833 TCATCCCTAGAGTCTAGCACAGG + Intergenic
1057356498 9:94336139-94336161 ACGCCACTACACTCTAGCATGGG - Intergenic
1057524560 9:95786910-95786932 ACCTCAGTAGTGTCTTCCATCGG + Intergenic
1057651252 9:96921488-96921510 ACGCCACTACACTCTAGCATGGG + Intronic
1060707424 9:125817118-125817140 ACCTCAATAGAGTAAAGAATTGG + Intronic
1061873035 9:133530738-133530760 GCCTCACAAGAGTCCAGCATGGG + Intergenic
1189576324 X:42357640-42357662 ACCTCACTGCATTCCAGCATGGG + Intergenic
1194616889 X:96115289-96115311 ACATCACTGGACTCTAGCCTGGG + Intergenic
1195917288 X:109948215-109948237 GCCTCAGTAGACTATAGCATCGG + Intergenic
1199459692 X:148070862-148070884 ACCTCACTATTGTTTTGCATTGG - Intergenic
1201506465 Y:14706454-14706476 ACATCACTGCAGTCTAGCCTGGG - Intronic