ID: 945946817

View in Genome Browser
Species Human (GRCh38)
Location 2:216002760-216002782
Sequence ACAAAGAAGGAGAATGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1237
Summary {0: 1, 1: 1, 2: 15, 3: 105, 4: 1115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945946817 Original CRISPR ACAAAGAAGGAGAATGGGGA GGG (reversed) Intronic
900747388 1:4370262-4370284 AAAAAGAAAGAAATTGGGGATGG + Intergenic
901329171 1:8391432-8391454 AGCAAAAAGGAGAATGGAGAGGG - Intronic
901394980 1:8974550-8974572 ACAAAAACAGAGAAGGGGGACGG - Intronic
901409493 1:9072236-9072258 TCAAAGATGGAGGAGGGGGATGG + Intronic
901480167 1:9519658-9519680 AAAAAGAGGGAGGTTGGGGAGGG + Intergenic
901610725 1:10495880-10495902 AAAAAGAATGAAAATGGGGTGGG - Intronic
902388703 1:16090449-16090471 ACAGATAAGGAGATTGGGGTAGG - Intergenic
902682341 1:18052191-18052213 ACAAAGAAGAAGAAAGGGGGGGG - Intergenic
902711634 1:18243921-18243943 ACAGATATGGAGAATGGGGGAGG - Intronic
902759138 1:18569482-18569504 ACAGGGCAGGAGAGTGGGGATGG + Intergenic
903747233 1:25595849-25595871 ACAGAGAAGGAGGTTGGGAATGG + Intergenic
903930048 1:26856804-26856826 GCAAAGAAGGAGAAGAGAGAGGG - Exonic
903999233 1:27329122-27329144 ACAAAGAAACAGAATGTGCAAGG - Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904322086 1:29704323-29704345 AGAAGAAAAGAGAATGGGGATGG + Intergenic
904346980 1:29879119-29879141 ACAGAGCAGGGGAAGGGGGAGGG - Intergenic
904424234 1:30413310-30413332 ATAATGAAGAAGATTGGGGAGGG + Intergenic
904449620 1:30602399-30602421 GCATGGAAGGAGAATGGGGGAGG - Intergenic
904596613 1:31650298-31650320 AGACAGAAGGATAATGGGGTTGG + Intergenic
904688981 1:32279744-32279766 CCAAGTAAGGAGACTGGGGAGGG + Exonic
904797696 1:33069822-33069844 ATATAGAATGAGAGTGGGGAAGG - Intronic
905026094 1:34850792-34850814 ACAGATCAGGAGAATTGGGAGGG - Intronic
905076909 1:35280221-35280243 AGAAAGAAAGAGAAAGGGAAAGG - Intronic
905121934 1:35688989-35689011 AAAGAGAAAGAGAAGGGGGATGG + Intergenic
905152431 1:35941573-35941595 AGTAAGTAGGAGAATTGGGATGG - Intronic
905293105 1:36936591-36936613 ATAAAGCTGGAGAATGGGAATGG - Intronic
905338082 1:37259081-37259103 ACAGAGTAGGAAAATGGAGAAGG + Intergenic
905431267 1:37925825-37925847 CCAAAGAAGGAAAATGGAGAGGG + Intronic
905883179 1:41477546-41477568 ACATAGAAAGAAAATAGGGAGGG - Intergenic
905980541 1:42221959-42221981 AAAAAAAAGAAGAAGGGGGAGGG + Intronic
906558923 1:46739585-46739607 AGAAAGGAGGAAAAGGGGGAAGG - Intergenic
906626781 1:47332135-47332157 AAGAAAAAGGAGAATGGGGGTGG + Intergenic
906833765 1:49061070-49061092 GCAAAGGAGAAGAATGAGGAGGG + Intronic
906859300 1:49341871-49341893 AGAGAGGAGGAGAAAGGGGAGGG - Intronic
907201047 1:52726845-52726867 CCGAAGCAGGTGAATGGGGAAGG - Intronic
907644397 1:56227453-56227475 ACAAAGTAGGAAAATGGGGAAGG + Intergenic
907758907 1:57338313-57338335 GCAGAGAAGGGGAATGGAGAAGG - Intronic
907843581 1:58181717-58181739 ACAAAGAAGGAGAAAGAAAATGG - Intronic
907947144 1:59146590-59146612 ACAAATGCTGAGAATGGGGATGG + Intergenic
907951706 1:59189597-59189619 ACAGAGCAAGTGAATGGGGAGGG - Intergenic
908135938 1:61132628-61132650 ACAATTAAGGAGAAAAGGGATGG + Intronic
908152711 1:61320093-61320115 AAAAAGAAGTAGAATGGGAGTGG - Intronic
908340410 1:63172714-63172736 AGAAAAAAGGAAAATGGAGAAGG + Intergenic
908397905 1:63743126-63743148 ACAAAGATGGAGACTTGGAAGGG + Intergenic
908528262 1:65008664-65008686 AAAGAGAAGGAGAAGGGGAAGGG - Intergenic
908701461 1:66906727-66906749 AGATAGAAGGAGAATAGGGTAGG - Intronic
908909397 1:69055534-69055556 ACACACTAGGAGGATGGGGATGG + Intergenic
909425558 1:75520558-75520580 AGAAAGAATGAGAAAGAGGAGGG + Intronic
909822858 1:80087874-80087896 ACTAAGAAGGGTAGTGGGGAGGG - Intergenic
910089161 1:83441877-83441899 ACAAGGAAGGAGGCTGGGCATGG + Intergenic
910203670 1:84725823-84725845 CCAAAGAAGGAGTAGGGTGAAGG - Intergenic
910243904 1:85118789-85118811 AGGAAGAAGGAGGTTGGGGAAGG + Intronic
910474834 1:87595651-87595673 AAAAAGAAAGAGAAAGAGGAGGG - Intergenic
910668992 1:89754126-89754148 ACAGAGAAGGAGAATGGGACAGG - Intronic
910786551 1:91004560-91004582 AGAAATAAGGAGCATGGTGAAGG + Intronic
911720284 1:101183187-101183209 AGAAAGAAAGAGGATGGGAAGGG + Intergenic
912228633 1:107766232-107766254 AAGAAGAAGGAGGAGGGGGAAGG - Intronic
912438660 1:109681000-109681022 TCAGAGAAGGAGAATTGGGCAGG - Intronic
912441181 1:109699445-109699467 TCAGAGAAGGAGAATTGGGCAGG - Intronic
912782353 1:112563002-112563024 TCAGAGAAGTAGAATTGGGAGGG + Intronic
912791587 1:112657258-112657280 ACAAAGAAGGAGAAATAGGCCGG - Intronic
912797110 1:112699992-112700014 ACTAAGAGGGAGAATGGGGTGGG - Intronic
912962169 1:114206017-114206039 ATAAAGCAGGAGAGTGTGGAGGG + Intergenic
913208873 1:116567165-116567187 ACAAAGAAGGAAAGAAGGGAAGG + Intronic
913600867 1:120420462-120420484 AGAAAGCAGGTGAAAGGGGACGG - Intergenic
913939863 1:125091643-125091665 AAAAAGGAGGAGGAGGGGGAAGG + Intergenic
913979212 1:143493449-143493471 AAAAAGGAGGAGGAGGGGGAAGG - Intergenic
914043603 1:144072783-144072805 AAAAAGGAGGAGGAGGGGGAAGG - Intergenic
914073615 1:144319099-144319121 AAAAAGGAGGAGGAGGGGGAAGG - Intergenic
914086189 1:144456171-144456193 AGAAAGCAGGTGAAAGGGGACGG + Intronic
914105540 1:144647261-144647283 AAAAAGGAGGAGGAGGGGGAAGG + Intergenic
914134484 1:144887708-144887730 AAAAAGGAGGAGGAGGGGGAAGG + Exonic
914192083 1:145420122-145420144 AGAAAGCAGGTGAAAGGGGACGG + Intergenic
914341594 1:146764762-146764784 ACAAAAAATGACAGTGGGGATGG - Intergenic
914589990 1:149098072-149098094 AGAAAGCAGGTGAAAGGGGACGG + Intronic
914901194 1:151712048-151712070 ACGAAGAAGGAGGCTGGGAAGGG - Intronic
914964361 1:152240941-152240963 GCCAAGAAGAAGAATGTGGAGGG - Intergenic
915377842 1:155413308-155413330 ACAAAGAAGGAGCATGGGCCAGG + Intronic
915441208 1:155946525-155946547 ACAATGAATGACACTGGGGATGG + Intergenic
915580120 1:156808526-156808548 GCAAGGAGGGAGGATGGGGAAGG + Intronic
915582146 1:156820233-156820255 ACAAATAAATAGATTGGGGAAGG - Intronic
915918447 1:159956173-159956195 ACAAAGAAGGAGGCTGGGCAAGG + Intergenic
916295872 1:163219241-163219263 ACAAAGAGGGAGAACAGGCAGGG - Intronic
916336694 1:163679108-163679130 AGAAGAAAGGAGAATGAGGAAGG + Intergenic
916473129 1:165143018-165143040 ACAAGGATAGAGAGTGGGGATGG + Intergenic
916810354 1:168300261-168300283 CGAAGGAAGGAGAATGGGGAAGG + Intronic
917082228 1:171268059-171268081 ACCAAACAGGAGACTGGGGAAGG - Intronic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917680255 1:177358753-177358775 AGAAAGAAAGAGAGTGGGGGAGG + Intergenic
917681407 1:177371973-177371995 CCAAAAAAGGTGAATGGGGGTGG - Intergenic
917787760 1:178477171-178477193 AAAGGGAAGGAGAATGGAGAAGG - Intronic
918053397 1:180995344-180995366 ACAAGGAATGGGGATGGGGAGGG - Intronic
918083776 1:181227988-181228010 ATGAAGAAGGAGAAATGGGATGG - Intergenic
918304451 1:183233322-183233344 ACAAAGGAAGAGAGTAGGGAAGG + Intronic
918640579 1:186836886-186836908 GCAAAGGCGGAGAATGGGAAGGG + Intronic
918761864 1:188420589-188420611 AGGAAGAAGGAGGAAGGGGAAGG - Intergenic
919016764 1:192048504-192048526 AAAAAGAAGGAGAAGGAGAAGGG + Intergenic
919318282 1:196001918-196001940 ACAAATAGGCAGAATGTGGAAGG + Intergenic
919362617 1:196613468-196613490 AAAAAGAAGGAGAAATGAGAAGG - Intergenic
919491021 1:198204925-198204947 AAGAAGAAGGAAAATTGGGAGGG - Intronic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
919563379 1:199152842-199152864 AGAAAGAAGAAGAAAGGAGAAGG + Intergenic
919563384 1:199152865-199152887 AGAAAGGAGGAGAAGGAGGAAGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919665211 1:200284963-200284985 AGAAAGAAAGAGAAAGAGGAAGG + Intergenic
919857249 1:201714329-201714351 ACAAGGAAGGAGAAGGAGAAGGG - Intronic
920038735 1:203082597-203082619 GGAATGGAGGAGAATGGGGAGGG + Intergenic
920065921 1:203269672-203269694 AAAAGGAAGGAGAGTGGGGTGGG + Intronic
920292475 1:204933436-204933458 ACAAAGATGGGGACTGGAGATGG + Intronic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920526263 1:206668951-206668973 ACAAGGAAGGAAAAGGGGGATGG - Intronic
920776871 1:208947264-208947286 AGAAGGAAGGAGGGTGGGGAGGG + Intergenic
921357544 1:214299982-214300004 ACTAGGAAGGAGAGAGGGGAGGG + Intronic
921543100 1:216442693-216442715 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
921595724 1:217051758-217051780 TAAAAAAAGGAGTATGGGGATGG - Intronic
922509960 1:226157155-226157177 AAAAGGAAAGAGACTGGGGAAGG - Intronic
922628406 1:227077536-227077558 AGAAAGAAGGAGGATGGTAAGGG - Intronic
922661906 1:227437518-227437540 AGAAAGAAAGAGAAAGAGGAGGG + Intergenic
922913122 1:229233907-229233929 AGAAACAAGAGGAATGGGGAGGG + Intergenic
923072434 1:230577883-230577905 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
923250949 1:232179253-232179275 AGAAAGAAAGAGAAAAGGGAGGG + Intergenic
923492189 1:234493771-234493793 GGGAAGAAGGAGAGTGGGGAAGG + Intergenic
923499030 1:234549562-234549584 ACCAAGGAGGACAATGTGGAAGG + Intergenic
923942322 1:238842089-238842111 AGGATGAAGGAGAACGGGGAGGG - Intergenic
923964726 1:239124827-239124849 ACAGAGAAAGAGACTAGGGAAGG + Intergenic
924204583 1:241698673-241698695 AAGAAGAGGAAGAATGGGGAGGG - Intronic
924410465 1:243799188-243799210 GGAAAGAAAGAAAATGGGGAGGG + Intronic
924609003 1:245558417-245558439 GCAAAGGAGGAAGATGGGGAGGG - Intronic
924663809 1:246049077-246049099 AGAAACAAGGAAAATGGGGTTGG + Intronic
1062897439 10:1115009-1115031 ACAAAAAAGGGAGATGGGGAGGG - Intronic
1063122434 10:3114438-3114460 ACAAAGTAGGAGGCTGGGCACGG - Intronic
1063181164 10:3601696-3601718 ACACAGAAATAGAATGAGGAAGG + Intergenic
1063881338 10:10535788-10535810 CCACAGGAGCAGAATGGGGAGGG + Intergenic
1063884884 10:10567479-10567501 GCAGAGAAGCAGAATGGGGCGGG + Intergenic
1063925078 10:10969601-10969623 ACAATGACAGAGAATGGGGAAGG - Intergenic
1063985923 10:11501798-11501820 GAAAAGAAGGAGAAAGGGCAGGG - Intronic
1064038418 10:11935891-11935913 GCAAACAAGAAGAATGGAGAGGG + Intronic
1064096731 10:12429325-12429347 AAAGAGAGAGAGAATGGGGAAGG - Intronic
1064496121 10:15912100-15912122 ACAAAGGAGGAGGAGGAGGAAGG + Intergenic
1064769035 10:18704835-18704857 AGAAAGAAAGAGAAAGAGGAAGG - Intergenic
1065042121 10:21707778-21707800 ACAAAGTTGGAGAGAGGGGAAGG - Intronic
1065184218 10:23156676-23156698 ACATAGGAGGAAAATGGGGTTGG - Intergenic
1065360321 10:24883472-24883494 ACGAAAAAGGAAAAAGGGGAGGG + Intronic
1066780271 10:38938142-38938164 AAAAAGGAGGAGGAGGGGGAGGG - Intergenic
1066956019 10:42173428-42173450 AAAAAGGAGGAGGAGGGGGAGGG - Intergenic
1067083967 10:43228500-43228522 ACATAGTAGGGGAGTGGGGAGGG - Intronic
1067163023 10:43842971-43842993 AGAAGGAAGGAGGAAGGGGAAGG + Intergenic
1067779827 10:49192651-49192673 ACAAATAATGAGGATTGGGAAGG + Intergenic
1067921675 10:50464808-50464830 ACAAAGAAGGGGAGGAGGGAGGG + Intronic
1068691656 10:59922040-59922062 ACAAAGAATGAAAATGAGGGGGG - Intergenic
1069309449 10:67016222-67016244 ACCAAGTAGTACAATGGGGAGGG + Intronic
1069580399 10:69562136-69562158 GCAAAAAAGGATATTGGGGAAGG + Intergenic
1069948898 10:72006093-72006115 ACATAGAAGGGGCCTGGGGATGG - Intronic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070240718 10:74677457-74677479 GCAATTAAGAAGAATGGGGAAGG - Intronic
1070498564 10:77048480-77048502 GAAACAAAGGAGAATGGGGAGGG + Intronic
1070576404 10:77682236-77682258 ACAAAGAAAGAGAAAGTGGGGGG - Intergenic
1070835806 10:79446113-79446135 AGAAAGAAGGAGTATGAGAAAGG - Intergenic
1071428029 10:85579395-85579417 ACAGAGAAAGAGAGAGGGGACGG + Intergenic
1071479322 10:86052693-86052715 ATAGAGAAGAAGAATGGGAAAGG + Intronic
1071506708 10:86236781-86236803 ACAGAGAAGGAAAATGTGCATGG + Intronic
1071827091 10:89336132-89336154 GGAAAGAAGGAAAATAGGGAGGG + Intronic
1071827111 10:89336193-89336215 GGAAAGAAGGAAAATAGGGAGGG + Intronic
1072100485 10:92224957-92224979 AAAAAGAAAGAAAATGGGGTAGG - Intronic
1072178958 10:92960667-92960689 ACAAAGGAGAGGAATGAGGAAGG - Intronic
1072580638 10:96736912-96736934 AAAAAGAATGGGGATGGGGAGGG - Intergenic
1072833349 10:98683300-98683322 ACAAATAGGGAGAAGAGGGAAGG + Intronic
1073030802 10:100524145-100524167 AGAGAGAAGGAGAAAGGGGGAGG + Intronic
1073072571 10:100803823-100803845 GCAAAGGAGGGGAAGGGGGAGGG - Intronic
1073142763 10:101260029-101260051 TGAAAGAGGGAGAATGAGGACGG + Intergenic
1073167994 10:101474822-101474844 AAAAAGACGGAAAATGGGGAAGG - Intronic
1073184868 10:101609784-101609806 ACAAAAAGGGAGAATAGGGTGGG + Intergenic
1073186763 10:101619669-101619691 AAAAAGAAGAGGAAGGGGGAAGG + Intronic
1073546882 10:104356939-104356961 ATAATGAAGAAGAATGGGTATGG - Intronic
1073659910 10:105463517-105463539 AAAAAGAAGAACAATTGGGATGG - Intergenic
1073712273 10:106057206-106057228 ATAAAGAAGGGGAAAGGGAAAGG - Intergenic
1073877391 10:107940736-107940758 AAAAAAAAGAACAATGGGGAAGG + Intergenic
1074099042 10:110339138-110339160 ACCAAGAAAGTGAATGGGGCAGG - Intergenic
1074150388 10:110754433-110754455 CCAAAAGAGGACAATGGGGATGG - Intronic
1074610535 10:115016998-115017020 AAAAGGAAGGAGAATGTGGGTGG + Intergenic
1074878152 10:117630808-117630830 AGAATGTAGGAGAAAGGGGAAGG - Intergenic
1074889372 10:117722447-117722469 ACATAGAAGGAGAAGGGTGCAGG + Intergenic
1075762971 10:124870635-124870657 AAAAAGAAAGAGACTGGGCATGG + Intergenic
1075808133 10:125204786-125204808 AGACAGTAGGAGAGTGGGGAGGG + Intergenic
1075918749 10:126191963-126191985 AGGAAGAGAGAGAATGGGGAGGG + Intronic
1076380432 10:130021423-130021445 CCAAGGGAGGAGAGTGGGGAAGG + Intergenic
1076742554 10:132494005-132494027 ACGAGGAAGCAGAGTGGGGAGGG - Intergenic
1077609614 11:3636257-3636279 ACAAGGAACAGGAATGGGGAGGG - Intergenic
1077712579 11:4551688-4551710 AAAAAAAAAGAAAATGGGGAAGG - Intergenic
1077753828 11:5004112-5004134 ACAAACTTGGAAAATGGGGAAGG + Intergenic
1077909726 11:6563581-6563603 ACAATGAAGGAGGATAGGGGAGG + Intronic
1078654448 11:13225353-13225375 ACTAAGAAGGAGAGTAGAGATGG + Intergenic
1078833696 11:15003987-15004009 ATAAAAAATGAGAATGGGAATGG - Intronic
1079010912 11:16827507-16827529 GCTATAAAGGAGAATGGGGAGGG + Intronic
1079271288 11:18988310-18988332 AAAAAGAAGGGTAATGAGGATGG + Intergenic
1079461687 11:20685804-20685826 AAAAAGCAGAAGACTGGGGAAGG + Intronic
1079750838 11:24194797-24194819 AAAAAAAAGGAGACTGGGCATGG + Intergenic
1079850423 11:25526425-25526447 TCAAAGAGGCAGAATGGAGAAGG + Intergenic
1079923407 11:26460405-26460427 AAAAAGAAGAAGAAAGGGGGGGG + Intronic
1079946013 11:26741536-26741558 ATAAATAGGAAGAATGGGGATGG - Intergenic
1080406978 11:31988065-31988087 AGAATGCAGGAGAGTGGGGATGG - Intronic
1080607556 11:33876196-33876218 ACAAAGAAGGATAACGGGGATGG - Intronic
1080765222 11:35289965-35289987 ACAAGGCAGGCGAAAGGGGAGGG + Intronic
1080876131 11:36276006-36276028 ACAAAGGAGGATAAAGGGGATGG + Intronic
1080886774 11:36375274-36375296 ACAATGAAAGAGACTGGGCATGG - Intronic
1081424677 11:42912604-42912626 ACAAAAAAGGAGAATAGAGAAGG - Intergenic
1081878541 11:46428175-46428197 AAGAAGAAGGGGAATGGGGAGGG + Intronic
1082061759 11:47867124-47867146 AAAAAGAAGAAGAATTTGGAAGG - Intergenic
1082856697 11:57814642-57814664 CCAGAGAAGGAGACTGGGGTAGG - Intronic
1083597475 11:63925274-63925296 ACAAAAAAGGGGAATGGGGATGG - Intergenic
1083604620 11:63970756-63970778 ACAAAAAACTAGAATGGGGTGGG + Intergenic
1083909280 11:65696581-65696603 AAAAAAAAGGAGACGGGGGATGG + Intergenic
1083939379 11:65887459-65887481 AAAAAGGAGGGGAAAGGGGAAGG + Intronic
1084441791 11:69178863-69178885 AGAAAGAAGGAGGGCGGGGAGGG + Intergenic
1084596947 11:70122627-70122649 ACAGAGAGAGAGAAGGGGGAGGG - Intronic
1085446346 11:76603620-76603642 AGAAAGAAAGAGAAAAGGGAAGG + Intergenic
1085843217 11:80037557-80037579 AGGAAGAAAGAGAATGGGGTAGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086165442 11:83772480-83772502 GGAAGGAAGGAGAAGGGGGAGGG + Intronic
1086222905 11:84471297-84471319 ACAAATAAGGAGGAAAGGGAAGG - Intronic
1086457073 11:86969531-86969553 AGGAAGAAGGAGAAAGGGGATGG - Intergenic
1086543135 11:87936615-87936637 ACAAAGAAGAATAAAGTGGAAGG - Intergenic
1086761711 11:90639387-90639409 AGAAAAAAGGAGAGTGGGGGTGG + Intergenic
1086998917 11:93392984-93393006 AGAAAGAAGGAGGAGGAGGAGGG - Intronic
1087051982 11:93895654-93895676 AGCAAGAAGGAGAAGGGGGAGGG + Intergenic
1087067831 11:94044125-94044147 AAATAGACCGAGAATGGGGAAGG + Intronic
1087115031 11:94515582-94515604 AAAAAAAAGGAGAAAGGGAAAGG - Intergenic
1087140724 11:94763191-94763213 AAAAAGGAGGACAATGTGGAGGG - Intronic
1088430309 11:109751598-109751620 AAAAAGAAAGAGTAAGGGGAAGG - Intergenic
1088547608 11:110975862-110975884 AAAAAAAAAGGGAATGGGGAAGG + Intergenic
1088940589 11:114451354-114451376 ACTGAGAAGGAGAAAGGGGAGGG - Intergenic
1088954098 11:114601237-114601259 AGAAAGAGGGAGCATGGGAAGGG - Intergenic
1089157353 11:116412743-116412765 GCAAAGAAAGAGACTGGGGAGGG - Intergenic
1089558521 11:119330447-119330469 ACAAAGAAAGAGAGAGAGGAGGG - Intergenic
1089788500 11:120925123-120925145 ACAGAGAAGGAGCACAGGGAAGG + Intronic
1089803940 11:121065431-121065453 AGAAAGAAGGAGAATTGGAATGG - Intronic
1089855616 11:121541795-121541817 TCGAAGAAGGAGAAGAGGGACGG - Intronic
1089991822 11:122868716-122868738 AAAAAGAAGGAGGCTGGGTACGG + Intronic
1089999031 11:122937760-122937782 ACTAAGAAAGAGAACGGGGATGG - Intronic
1090148904 11:124360210-124360232 AGAAAGAAGGGGAAGAGGGAGGG + Intergenic
1090259284 11:125306980-125307002 ACAGAGAAGGAGAAACGGGGAGG - Intronic
1090893655 11:130950178-130950200 TCAAATATGGAGAATGGGGCAGG - Intergenic
1090908205 11:131095842-131095864 ACGAGGAAGGAGAGTGAGGAGGG - Intergenic
1090958819 11:131537758-131537780 ACAATGCAGGTGAATTGGGAGGG - Intronic
1091295298 11:134469949-134469971 ACAAAGAATGAATATGGGAAAGG + Intergenic
1091372408 11:135072043-135072065 TCAAACAAGGACACTGGGGATGG - Intergenic
1092314813 12:7399420-7399442 AGGAAGAAGAAGAATGGGGGAGG - Intronic
1092514538 12:9195409-9195431 GAAAAGAAGGAAAAAGGGGAAGG - Intronic
1092689552 12:11092501-11092523 ACAAAAAAGGAAAATGGGAGGGG - Intronic
1093055830 12:14554797-14554819 GCACAGGAGGAGACTGGGGAGGG - Intronic
1093195461 12:16125086-16125108 AGAAAGAAGGAGAGAAGGGAGGG - Intergenic
1093251514 12:16810508-16810530 TAAAAGGAAGAGAATGGGGAAGG - Intergenic
1093394154 12:18660211-18660233 AATACGCAGGAGAATGGGGATGG - Intergenic
1093834502 12:23810745-23810767 ACAAGGAAGGAAAAAAGGGAAGG - Intronic
1093837527 12:23853062-23853084 GAAAAGAAGGATAGTGGGGATGG + Intronic
1094070298 12:26405159-26405181 AGAAAGAAGGAGGAGGAGGAGGG + Intronic
1094527831 12:31244329-31244351 ACTAGGAAGGAGAATGGGAAGGG + Intergenic
1094544406 12:31391159-31391181 AGAAAGTAGGAGATTGGGGGAGG - Intronic
1095215800 12:39545868-39545890 CCAAAGAAGCAGAAAGAGGAAGG + Intergenic
1095837490 12:46654484-46654506 ATAAAGCAGGAGAAAAGGGAAGG - Intergenic
1095863578 12:46947220-46947242 TGAAGGAAGGAGAAAGGGGAAGG - Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096162004 12:49386589-49386611 ACAAAGCAGGAGAAGGGCAAGGG + Intronic
1096205683 12:49719691-49719713 AGAAAGAAAAAGAAAGGGGAGGG + Intronic
1096502873 12:52075785-52075807 ACCAAGCAACAGAATGGGGAAGG - Intronic
1096528419 12:52228133-52228155 AAGAAGAAGGAGGAGGGGGAGGG - Intergenic
1096769708 12:53927348-53927370 ACAAAACAGGAGAGAGGGGAAGG + Intergenic
1097091795 12:56511317-56511339 ACAAATGAAGAGACTGGGGATGG + Intergenic
1097191307 12:57220855-57220877 ACAGAGATGGGGGATGGGGATGG - Intronic
1097225175 12:57472824-57472846 AGATACAAGGAGAATGGAGATGG + Intronic
1097781072 12:63705448-63705470 ACAAAGAAAGACAATGGGTTTGG + Intergenic
1097915212 12:65013984-65014006 CCAAAGAAGGAGAAGGAGAAGGG - Intergenic
1098198262 12:68025468-68025490 TCAGGGAAGGAGAATGAGGAGGG + Intergenic
1098469378 12:70826129-70826151 AGAAAGAAGGAGGATAGGGAGGG + Intronic
1098495882 12:71135285-71135307 AAGAAGAAGGAGGAGGGGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1099082332 12:78201016-78201038 AGAAAGAGAGAGAGTGGGGAGGG - Intronic
1099304590 12:80937745-80937767 AAAAAGGAGGAGATTGGGGGCGG + Exonic
1100017981 12:90035183-90035205 AGAATGAGGGAGAGTGGGGAGGG + Intergenic
1100216160 12:92450960-92450982 GCAAACTAGGAGAATGGGGATGG - Intergenic
1100534609 12:95496458-95496480 ACAATGGAGGAAATTGGGGAGGG - Intronic
1101481308 12:105100331-105100353 GGAAAGAAGGAGAAAGAGGAAGG - Intergenic
1101693010 12:107098347-107098369 AGAAAGAAAAAGAAGGGGGAGGG + Intergenic
1101739878 12:107492584-107492606 ACACAGAAGCAGAAGTGGGAGGG - Intronic
1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG + Intronic
1101994457 12:109514898-109514920 AAAAAGAAGAAGAAAGGGGATGG - Intronic
1102167892 12:110820835-110820857 ACGAAGAAGGAGGAGGAGGAGGG - Intergenic
1102693482 12:114779965-114779987 ACAAAGAAAGAGAGAAGGGAGGG - Intergenic
1102739478 12:115194488-115194510 ACAAAGAAGGAGGAGGAGAATGG + Intergenic
1103131972 12:118477107-118477129 AGAAAGGAGGAGAGGGGGGAAGG - Intergenic
1103277242 12:119722787-119722809 AGAAAGAAGGACAAAGGAGATGG - Intronic
1103990171 12:124793704-124793726 AAAAAAAAAAAGAATGGGGATGG + Intronic
1104509973 12:129368359-129368381 ACAAGGATGGAGAATGTGGAAGG - Intronic
1104613339 12:130248108-130248130 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
1104754911 12:131262929-131262951 AGAAAGAAGGAGAAAGGGCATGG + Intergenic
1105203326 13:18197407-18197429 AGACAGAAGGGGAATGGAGAAGG - Intergenic
1105457524 13:20555167-20555189 AGAAAGAAAGAAAATGGGGAGGG - Intergenic
1105814104 13:24017728-24017750 AGAAAGAAGGAGGAAGGAGAGGG - Intronic
1105933482 13:25075098-25075120 ACAAAGAGGGAGGCTGGGCACGG + Intergenic
1106180960 13:27369024-27369046 CCAAATAATGACAATGGGGAAGG + Intergenic
1106664502 13:31837460-31837482 ACAAGGAAGGAGAAAGTGGAGGG + Intergenic
1106713531 13:32364329-32364351 ACCATGAATGAGGATGGGGAGGG - Intronic
1106726637 13:32493213-32493235 AAAAAGAAAGAGACTGGGCACGG - Intronic
1106778127 13:33027973-33027995 ACTATGAAGGAGAGTGGGCAGGG + Intronic
1106894199 13:34280430-34280452 AATAAGAAGGAGAATAGGAAAGG - Intergenic
1107061530 13:36164652-36164674 AAAAAGAAGGCCAATGGGGTTGG - Intergenic
1107142116 13:37010982-37011004 ACAAAGTAGGAGAAGGGAGATGG + Intronic
1107328834 13:39274891-39274913 GGAGAGAAGCAGAATGGGGAAGG + Intergenic
1107405586 13:40109576-40109598 ACGAAGAAGGAGAAGGGAGAGGG + Intergenic
1107948151 13:45438128-45438150 TCAAGGCACGAGAATGGGGAAGG - Intergenic
1108021635 13:46133721-46133743 AGAAACTAGGTGAATGGGGAGGG + Intronic
1108392090 13:49956508-49956530 AGAAAGAAGAAGAAAGAGGAAGG - Intergenic
1109106201 13:58253544-58253566 GCAAAGAAGAAAAATGAGGAGGG - Intergenic
1109218192 13:59614076-59614098 ACAAAGATGGGGATAGGGGAGGG - Intergenic
1109536478 13:63728564-63728586 AGAAAGAAGGGGAGTGGGGAAGG - Intergenic
1109749961 13:66677606-66677628 AGAGAGAAAGAGCATGGGGAAGG - Intronic
1110081673 13:71321421-71321443 ATAAAGAAGGAGAAAGAAGATGG + Intergenic
1110420735 13:75304800-75304822 AGGAAGAAGGAGAATAGGGAGGG + Intronic
1110443734 13:75553215-75553237 ACAAAGAAGGAAAACAGGTAAGG - Intronic
1110519222 13:76455797-76455819 AAAGAGGAGGAGGATGGGGAGGG + Intergenic
1110700383 13:78540620-78540642 AAGAAGAAGGAGGATGGGGAGGG - Intergenic
1110789509 13:79571966-79571988 AGAAAGAAATAAAATGGGGATGG - Intergenic
1110917897 13:81046458-81046480 ACAAAGAGGGAGGATGGGAGCGG - Intergenic
1111953093 13:94726028-94726050 TCAAAGAAGGAGAATTTGTAGGG + Intergenic
1112158156 13:96840002-96840024 ACAAAGAAGGAAAGGAGGGAAGG + Intergenic
1112630700 13:101158452-101158474 GCAGAGAAGGAGAAAGGGGTGGG + Intronic
1112675528 13:101696830-101696852 ACAATTAAGGAGAATGAGAAAGG + Intronic
1112723327 13:102272191-102272213 TGAAAGAGGGAAAATGGGGAGGG - Intronic
1112835743 13:103512179-103512201 ACAAAGAATGAGAATAGAGGAGG + Intergenic
1113246475 13:108402441-108402463 ACAAATAAGTAGAATGTTGAGGG + Intergenic
1113250433 13:108446499-108446521 ACAAAGGTGGATATTGGGGAAGG + Intergenic
1113270914 13:108673347-108673369 AAAAGGAAGAAGAACGGGGAGGG - Intronic
1113524513 13:110964335-110964357 ACGAAGGAGGAGAAAGGGGGTGG - Intergenic
1113801228 13:113087391-113087413 AAGAGGGAGGAGAATGGGGAGGG + Exonic
1113815185 13:113164692-113164714 AGAAGGAAGGAGGATGTGGACGG - Intronic
1113913954 13:113860161-113860183 ACAAAGAAAGAGATGGGGGAAGG + Intronic
1114066589 14:19064430-19064452 AGATAGAGGGGGAATGGGGAAGG - Intergenic
1114095677 14:19335593-19335615 AGATAGAGGGGGAATGGGGAAGG + Intergenic
1114350107 14:21841042-21841064 AGAAAGAGAGAGAATGGGAAGGG + Intergenic
1114449786 14:22817931-22817953 GCAAAGAATGAGAAAGGGGAGGG - Intronic
1114525388 14:23364771-23364793 AAGAAAAAGGAGAATGGGGAGGG + Intronic
1114745372 14:25140543-25140565 GCAAAGAAAGATGATGGGGAGGG - Intergenic
1115009317 14:28524837-28524859 GGAAAGGAGGAGAAGGGGGAGGG + Intergenic
1115275606 14:31605843-31605865 ACAAGGAAGGAGAAGGGAGGAGG - Intronic
1115673601 14:35644687-35644709 ACAAATAAGGAAAACGGGGAAGG + Intronic
1115941395 14:38614246-38614268 AAAAAGAACTAGAAAGGGGAGGG + Intergenic
1116182905 14:41558007-41558029 TCAAAGAATGAAAATGTGGAGGG - Intergenic
1116190378 14:41657763-41657785 ACAAAGGAGATGAATTGGGAAGG - Intronic
1116427342 14:44807100-44807122 AGAAAGAAAGAGAAAGAGGAAGG + Intergenic
1116639853 14:47447379-47447401 ACAAAGAAAGAAAAAGGAGAAGG + Intronic
1117058833 14:51940166-51940188 AAAAAGAAGAGGAGTGGGGACGG + Intronic
1117814431 14:59582499-59582521 ACAAAGAAAGAAAATGGAAAAGG - Intergenic
1117835518 14:59801048-59801070 ACATAGAAAAAGAATGGGGGAGG + Intronic
1118203960 14:63704227-63704249 AAAAAGAAGAACAATGTGGAAGG + Intronic
1118751490 14:68811052-68811074 ACAAAGGAGGAGACTGAGGGAGG - Intergenic
1118821204 14:69347255-69347277 ACAGAGGAGGAGAATGAGTAGGG - Intronic
1119359112 14:74033016-74033038 AGAAAGAAGGAGGATGAGGAAGG - Intronic
1119489064 14:75014364-75014386 ATGAAGCTGGAGAATGGGGAGGG - Exonic
1119558828 14:75573810-75573832 TTAAACAAGGAGAATGGGGCCGG - Intergenic
1119919315 14:78431565-78431587 GCAAAGAAAGACAAAGGGGAGGG + Intronic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120396335 14:83971445-83971467 GAAAAGAAGGAGGAAGGGGAGGG + Intergenic
1120574105 14:86159317-86159339 AAAAAGAAGGAGATCTGGGAAGG - Intergenic
1120850501 14:89164860-89164882 ACATAGAAAGTGAAAGGGGAAGG + Intronic
1120962256 14:90136090-90136112 ACCAAGAAGGAGATTGGGCTGGG + Intronic
1121043223 14:90767519-90767541 AGAAAGAAGGAAAAGGGGGCTGG - Intronic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121408545 14:93733983-93734005 ACCTAGAAGGAGGCTGGGGAGGG - Intronic
1121495776 14:94390598-94390620 ACCAAGAAGGAGGAGGGGGTCGG - Exonic
1121857144 14:97280644-97280666 AAAAAGAAGAAGAATGTCGATGG + Intergenic
1121894968 14:97638297-97638319 AGAAAGAGAGAGAAGGGGGAAGG - Intergenic
1122312376 14:100805210-100805232 CCAGGGAAGCAGAATGGGGAGGG + Intergenic
1122392786 14:101401797-101401819 AAAGAGAAGGAGAAGGGGAAGGG - Intergenic
1122777005 14:104122552-104122574 AGAAAGAAGGAGGGAGGGGAGGG - Intergenic
1122879588 14:104684216-104684238 ACCGAGAAGGAGGCTGGGGAGGG + Intergenic
1122897951 14:104769632-104769654 ACACAGAAGGGGAAGGGGGAGGG + Exonic
1123418236 15:20108030-20108052 AGAACCCAGGAGAATGGGGAGGG + Intergenic
1123527454 15:21114552-21114574 AGAACCCAGGAGAATGGGGAGGG + Intergenic
1123974879 15:25543743-25543765 TCAAAGAAGGACCATGAGGAAGG - Intergenic
1124345241 15:28917922-28917944 AGAAAGGAGCAGAATGGGGCGGG - Intronic
1124594034 15:31079022-31079044 ACAAATATGGAAAGTGGGGAAGG + Intronic
1124818931 15:33023228-33023250 ACAAATAAGGGTAAAGGGGAAGG + Intronic
1124987594 15:34636862-34636884 AAAATCAAGGAGAAAGGGGATGG + Intergenic
1124996500 15:34728068-34728090 ATTTAGATGGAGAATGGGGAGGG - Intergenic
1125255476 15:37758399-37758421 AGAAAGAAAGAGAAAGAGGAAGG + Intergenic
1125718659 15:41834712-41834734 AGAAAGAAGAAGACAGGGGATGG - Intronic
1125721311 15:41846456-41846478 TCAAAGCAGGAGAATGGGAGTGG - Intronic
1125800140 15:42438498-42438520 ATAGAATAGGAGAATGGGGAGGG - Intronic
1126684210 15:51233194-51233216 ACATAGAAAAAGAATAGGGAAGG - Intronic
1126868493 15:52962229-52962251 AGCAAGACCGAGAATGGGGAGGG - Intergenic
1127973018 15:63977101-63977123 AAAGAGAAGGGGAAGGGGGAAGG + Intronic
1128095609 15:64952253-64952275 AAAAAGAAGGAGAAGGAAGAAGG - Intronic
1128095733 15:64953538-64953560 AGAAAGAAGGAGAAGGAAGAAGG - Intronic
1128253290 15:66178785-66178807 AGAGAGAAGGAGAGTGGGGGTGG + Intronic
1128355475 15:66923514-66923536 AGAAAGATCGAGGATGGGGACGG + Intergenic
1128380647 15:67109643-67109665 ACAAAGAAGGAAAAGCGAGAGGG + Intronic
1128467308 15:67923675-67923697 ACACAGACTGAGAATGGGGAAGG - Intergenic
1128674592 15:69599409-69599431 ACACTGAAGGAGAGTGAGGAAGG + Intergenic
1128794314 15:70453611-70453633 AGAAAGAAGGGGAAAGGGAAGGG - Intergenic
1129291810 15:74574068-74574090 AGAAGGAAAGAGAATTGGGAGGG - Intronic
1129550293 15:76441214-76441236 AAAAAGAAGGAGAATAGGCTGGG - Intronic
1129644396 15:77417425-77417447 ACTAGGAAGGAGAGTGGGGTGGG + Intronic
1129925352 15:79358933-79358955 ACTAAGAAAGGGAGTGGGGATGG + Intronic
1129990104 15:79954718-79954740 AAAAAGAGGGAGTATGGGGATGG + Intergenic
1130062409 15:80579270-80579292 ATCAGGAAGGAGAATGGGAAAGG + Intronic
1130127399 15:81105252-81105274 AGAAAGAAAGAGAAAGAGGAAGG - Intronic
1130205315 15:81870071-81870093 AAAGAGATAGAGAATGGGGAGGG - Intergenic
1130418268 15:83714750-83714772 AGAAAGAAAGAGAAAAGGGAAGG - Intronic
1130435812 15:83898299-83898321 AAAAAGAAGAAGAATGGCGGGGG + Intronic
1130971872 15:88739966-88739988 ATAATGGAGAAGAATGGGGATGG + Intergenic
1131300860 15:91198663-91198685 ACAAAAAATGAGAAGGGGAATGG + Intronic
1131408104 15:92183275-92183297 AGACAGAAGTAGTATGGGGAGGG - Intergenic
1131433865 15:92407643-92407665 AAAAAGCAGGGGAATGGAGAGGG + Intronic
1131835807 15:96389680-96389702 CCAAAAAAGGAGAAAGGGAATGG + Intergenic
1131870691 15:96760790-96760812 ACAAAGCATGGAAATGGGGATGG + Intergenic
1131901131 15:97088768-97088790 AAAAGGAAGGAGAAGGAGGAGGG - Intergenic
1131938190 15:97531195-97531217 ATAAAGAAGGAAAATGAGGTAGG + Intergenic
1131951218 15:97683701-97683723 AAAAAAAAAGAGAAGGGGGAGGG + Intergenic
1132267881 15:100492967-100492989 ACAAAGAAGGGGACGGGGAATGG - Intronic
1132874525 16:2130437-2130459 ACAGAGATGGATGATGGGGAGGG - Intronic
1133052969 16:3128730-3128752 ACAAAGAAGGGATATGGGGACGG - Intergenic
1133431006 16:5736721-5736743 ACACAGATGGAGAGAGGGGAGGG - Intergenic
1133904371 16:10008209-10008231 CCAAATAAGGGGATTGGGGAAGG - Intronic
1134115081 16:11542016-11542038 AGAAAGAAAGAGAATGAGAAAGG - Intergenic
1134374987 16:13663807-13663829 ACAAAGAAGCAGAATGTGAAAGG - Intergenic
1134398663 16:13889078-13889100 CCGGAGAAGGAGAAAGGGGAGGG - Intergenic
1134441204 16:14300848-14300870 AGAAAGAAAGAGGATGGAGAGGG + Intergenic
1134449426 16:14354283-14354305 ACAGGGAAGGGGAAAGGGGAGGG + Intergenic
1134553470 16:15149270-15149292 ACAGAGATGGATGATGGGGAGGG - Intergenic
1134610260 16:15602597-15602619 ACAAAGAAGAAGAAAGGAGGAGG + Intronic
1134718959 16:16370590-16370612 AGAGAGATGGAGAAAGGGGAGGG - Intergenic
1134751411 16:16628261-16628283 AAAAAGAAAGAGAAAGAGGAAGG - Intergenic
1135045204 16:19149672-19149694 ACAATGATGGTGAAAGGGGAAGG - Intronic
1135126148 16:19810813-19810835 AAAAAGAAAGAAAATGGGGATGG + Intronic
1135139373 16:19908443-19908465 ACAGGGATGGAGGATGGGGAAGG + Intergenic
1135354380 16:21757307-21757329 ACAAGGAAGGAGAGTGGGGCTGG - Intronic
1135452871 16:22573447-22573469 ACAAGGAAGGAGAGTGGGGCTGG - Intergenic
1135614424 16:23898538-23898560 ACAAATGAGAAGAATGGGGTAGG + Intronic
1135884710 16:26295511-26295533 AGAAAAAAGGGGAATGGGAAAGG + Intergenic
1136026618 16:27472792-27472814 TCAGAGGAGGAGAATGGAGAGGG - Intronic
1136035483 16:27536696-27536718 GCAATGAGGGATAATGGGGAGGG - Intronic
1136278647 16:29194090-29194112 ACAAGGAAGGAGACTGGGTCTGG + Intergenic
1136577904 16:31135174-31135196 AGAAAGAAAGAGAAAGAGGAGGG + Intronic
1136799200 16:33055248-33055270 AAAAAGGAGGAGGAGGGGGAAGG - Intergenic
1136935373 16:34458440-34458462 ACAAAGAAGGAGTTAGGGGTGGG - Intergenic
1136938208 16:34496067-34496089 ACAAAGAAGGAGTTAGGGGTGGG - Intergenic
1136961610 16:34852490-34852512 ACAAAGAAGGAGTTAGGGGTGGG + Intergenic
1136964445 16:34890130-34890152 ACAAAGAAGGAGTTAGGGGTGGG + Intergenic
1136968592 16:34944824-34944846 ACAAAGAAGGAGTTAGGGGTGGG + Intergenic
1137290916 16:47051350-47051372 ACGATGAAGGAGGATGAGGAAGG + Intergenic
1137905267 16:52315188-52315210 AGACGGAAGGAGATTGGGGATGG - Intergenic
1137968355 16:52959102-52959124 AAAAAGGAGGAGGAGGGGGATGG - Intergenic
1138160112 16:54745375-54745397 ACAAAGAAGCTGAAAAGGGAAGG + Intergenic
1138541351 16:57689602-57689624 ACAAAGAGGGAGAACGGTGGCGG + Intergenic
1138835414 16:60428876-60428898 AAAGAGAAGGAGGATGGGGTGGG + Intergenic
1139109491 16:63872218-63872240 AAAAAGAAGAATAATGTGGAGGG + Intergenic
1139351400 16:66338468-66338490 AGAAAGAGGGAGAGTGGGGGAGG + Intergenic
1139640050 16:68285065-68285087 AAAAAGAAGCAGAAGTGGGAGGG - Intronic
1139743200 16:69053263-69053285 CTAAATAGGGAGAATGGGGAGGG - Intronic
1139992685 16:70952680-70952702 ACAAAAAATGACAGTGGGGATGG + Intronic
1140695715 16:77531495-77531517 ACAAAAAAAGAGAATGGGAGAGG + Intergenic
1141185502 16:81784215-81784237 GCAAATGAGGGGAATGGGGAGGG - Intronic
1141475964 16:84273676-84273698 ACAAAGAAGGTGATTGGGGCTGG + Intergenic
1141508455 16:84496451-84496473 AGAAGGAAGGAGAAGGCGGAAGG - Intronic
1141546804 16:84775851-84775873 AGAAAGAAGGATAAAAGGGAAGG - Intronic
1141703029 16:85651080-85651102 AGAAAGAAGGCGGAGGGGGAGGG - Intronic
1141845116 16:86603371-86603393 AGGAAGAAGGAGGAGGGGGAAGG - Intergenic
1142083037 16:88160171-88160193 ACAAGGAAGGAGACTGGGTCTGG + Intergenic
1142231815 16:88903608-88903630 CCAAAGAAGGTGAATGTGGCAGG + Intronic
1143126650 17:4645709-4645731 AGAAAGAGGGAGAGTGGGGAGGG - Intergenic
1143134661 17:4704946-4704968 AGAAACTAGGAGAATGGGTAGGG - Intergenic
1143224206 17:5286850-5286872 ACAGAGCAGGAGAAAGGGAAGGG + Intronic
1143918499 17:10312549-10312571 ACAAAGAAAGCGGCTGGGGAAGG + Intronic
1143934070 17:10463773-10463795 AAAAAGAAGGTAAATCGGGAAGG + Intronic
1143947430 17:10605472-10605494 AAAGAGAAGGAGGAGGGGGAGGG + Intergenic
1144096459 17:11904647-11904669 AAAAAAAAAAAGAATGGGGAAGG + Intronic
1144134941 17:12284809-12284831 GGAAAGAAAGAGAATGGAGATGG - Intergenic
1144159021 17:12538857-12538879 ACTAAAAATAAGAATGGGGAAGG + Intergenic
1144285159 17:13767021-13767043 ATAAAGAATGGGAATTGGGAGGG + Intergenic
1146421806 17:32693862-32693884 AGAAAAAAGGAGAGTGGGGCCGG + Intronic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1146487824 17:33258409-33258431 ACAGAGAAGGAGGATGGGTAGGG + Intronic
1147126672 17:38374643-38374665 AAAAAGAAGGTGAAGGGTGAAGG + Intronic
1147228244 17:38997708-38997730 AAAAAGAAAAAGAAAGGGGAGGG - Intergenic
1147462194 17:40580400-40580422 ACATAGAAGGGGAATCAGGAAGG + Intergenic
1147490297 17:40859769-40859791 TCAAAGAAGCAGAAGGGAGAGGG - Intergenic
1147511898 17:41076990-41077012 AGAAAGAAAGAGAAAGAGGAAGG + Intergenic
1148015968 17:44522947-44522969 AAAAAAAAAGAGAATGAGGATGG - Intergenic
1148107477 17:45127147-45127169 ACAAAGAAGGAAACTGAGGCAGG + Intronic
1148467576 17:47874075-47874097 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
1148554705 17:48571410-48571432 AGTAGGAGGGAGAATGGGGAGGG + Intronic
1148854393 17:50570797-50570819 ACAGAGAAGCTGAAGGGGGATGG + Intronic
1149087706 17:52738953-52738975 ACCAACAAGGAAATTGGGGAGGG - Intergenic
1149183874 17:53974370-53974392 CCAAATAAAGAGAATTGGGAAGG + Intergenic
1149755951 17:59185965-59185987 ACAAAGAATGGGAATTTGGAGGG + Intronic
1149939337 17:60846224-60846246 ATAAAGAAGTAGAATGGGGCTGG - Intronic
1150139244 17:62714742-62714764 AAAAAAGAGGAGAAGGGGGAGGG - Intronic
1150316590 17:64174377-64174399 ACTAGTAAGCAGAATGGGGAGGG + Intronic
1150339792 17:64357237-64357259 ACCCAGGAGGAGAATGGGGATGG - Intronic
1150995794 17:70315972-70315994 AGAAATAAGGAGAATGATGAGGG - Intergenic
1150996910 17:70329225-70329247 ACAAAGAAAAAGAATGGGGAGGG + Intergenic
1151184917 17:72356748-72356770 AAAAAAAAAAAGAATGGGGAGGG + Intergenic
1151219376 17:72600893-72600915 ACAAAGAGAGAGAATTGGGAGGG - Intergenic
1151365672 17:73614653-73614675 ACAAAGATTGAAAAGGGGGAGGG + Intronic
1151398430 17:73840301-73840323 AGAAAGAAAGAGAAAAGGGAAGG - Intergenic
1151412434 17:73940168-73940190 ACAAATACAGAGAAGGGGGAAGG + Intergenic
1151887544 17:76932087-76932109 ACAAAGACGAAGAAGGGGGGGGG - Intronic
1152243016 17:79170033-79170055 AGAAGGAAGGAGAAGAGGGAAGG + Intronic
1152297532 17:79476839-79476861 ACAGAGAAGGAGGAAGAGGAGGG + Intronic
1152324268 17:79626525-79626547 ACAAAAAAGGAGAATGCAGATGG - Intergenic
1153143341 18:2000365-2000387 TCAAAGAAGGAGATAGGAGATGG + Intergenic
1153980129 18:10301707-10301729 TCAGAGAGGGAGAATGGTGAAGG - Intergenic
1154957757 18:21276065-21276087 AAACAGAATGAGAATGAGGAAGG - Intronic
1155145417 18:23079207-23079229 ACAGAGAGGGAGAAGAGGGATGG + Intergenic
1155148566 18:23104301-23104323 CCAAAGAAGGAGGATCAGGAGGG + Intergenic
1155280080 18:24230235-24230257 ACAAACAAGGAGAGGGAGGAGGG + Intronic
1155740759 18:29285105-29285127 ACACAGAATGAGAATTTGGAGGG - Intergenic
1155996145 18:32333229-32333251 ACAAGGAAGGGGAGTGGAGAGGG + Intronic
1156095026 18:33519865-33519887 TCAAAGAAGGAGAATGGACATGG - Intergenic
1156126542 18:33912221-33912243 AAAAAGATTGAGAATGAGGAAGG - Intronic
1156659333 18:39328178-39328200 AAGACGAAGGAGAATAGGGAAGG - Intergenic
1156730278 18:40185764-40185786 GAAAAGAAGAAGAATGAGGAGGG + Intergenic
1156883620 18:42109162-42109184 AAAAAGAAAAAGAATGGAGAAGG - Intergenic
1156987153 18:43361763-43361785 AAAAAGAAGAAGAATAAGGAGGG + Intergenic
1157237605 18:45979188-45979210 AAGAAGAAGGAGAAGGGAGAGGG - Intergenic
1157345718 18:46830252-46830274 AGAAAAAAGGATAATGGGGTAGG + Intronic
1157443753 18:47729593-47729615 ACAAAGCAGGAGAGGGAGGAAGG + Intergenic
1158334937 18:56405767-56405789 ACAAAGAAAGAGAATAGGAGAGG + Intergenic
1158768147 18:60481086-60481108 AGAAGGAAGGAGGATGGGAAGGG - Intergenic
1158870182 18:61679120-61679142 GCTAAGAAGGATAGTGGGGATGG + Intergenic
1158903912 18:61992435-61992457 AATGAGAAGGAAAATGGGGAGGG + Intergenic
1159520239 18:69510872-69510894 AAAAAGAAAGAAAAAGGGGAGGG - Intronic
1159679800 18:71334991-71335013 ACACAGAAGGAGTAGGTGGAGGG + Intergenic
1159756059 18:72367594-72367616 AGAGAGAAGGAGAAAGTGGAAGG + Intergenic
1159887023 18:73918664-73918686 ACAAAGCAGGGAAATGGGCATGG - Intergenic
1160239423 18:77112553-77112575 ACAGAGAAGGGGGAGGGGGAGGG - Intronic
1161241646 19:3226404-3226426 AAAGAGATGGGGAATGGGGAGGG - Intronic
1161908409 19:7174751-7174773 AGAGAGAAAGAGAAAGGGGAGGG + Intronic
1162215070 19:9127390-9127412 AGAAAGAAAGAGAGGGGGGAAGG - Intergenic
1162526235 19:11208572-11208594 AGAAAGAAGGAGAATAGGCTGGG - Intronic
1162674525 19:12288927-12288949 ACAAAGAATGGGAATTTGGAGGG - Intronic
1162861249 19:13506969-13506991 ACAAAGAAGATGAAAGGGAAGGG + Intronic
1163073833 19:14870169-14870191 GGTAAGAAGGAGAATGTGGATGG + Intergenic
1163207240 19:15812618-15812640 GGAAAGAAGGAGAGTGAGGAAGG + Intergenic
1163674296 19:18647668-18647690 AAAGAACAGGAGAATGGGGAGGG + Intronic
1164667543 19:30051517-30051539 ACAGAAAAGGAGGAGGGGGAAGG - Intergenic
1164782614 19:30905698-30905720 ACAAAAAGAGAGATTGGGGAAGG - Intergenic
1165197731 19:34118117-34118139 AAAAAAAAGAAGAAGGGGGAGGG + Intergenic
1165314194 19:35044907-35044929 AGAAAGAAGGAAACGGGGGAAGG + Intronic
1165455672 19:35909238-35909260 ACAAAGATGAAAGATGGGGAAGG + Intergenic
1165742132 19:38210812-38210834 AGAAAGGAGGAGAAGGGGGATGG - Intergenic
1166095660 19:40537428-40537450 AGAGAGAATGAGAATGGTGAAGG + Intronic
1166147846 19:40849675-40849697 ACAATGAAGGGAGATGGGGAGGG + Intronic
1166338312 19:42122191-42122213 AGAAAGTAGGAGCAAGGGGATGG + Intronic
1166966233 19:46530824-46530846 ACCTGGAAGGAGAGTGGGGAGGG - Intronic
1167205101 19:48096153-48096175 ACAAAGGATGAAAATGAGGAGGG + Intronic
1167286666 19:48602267-48602289 ACAGAGAGGGTGAAAGGGGAAGG + Intronic
1167367405 19:49061953-49061975 GAAAAGGAGGAGGATGGGGAGGG + Exonic
1167390899 19:49194252-49194274 TCAAAGAAGAAGAAAGGAGAAGG - Intronic
1167432042 19:49460842-49460864 TCAAGGAAGGAGAATGTGGGTGG - Exonic
1167574959 19:50313577-50313599 ACAAAGAGGGTGCTTGGGGAGGG + Intronic
1167608262 19:50493215-50493237 AGGTAGAAGGAGAATGGGGAGGG + Intergenic
1167628397 19:50607519-50607541 ACTGAGAAAGAGGATGGGGACGG - Intergenic
1167671719 19:50857348-50857370 AGGAGGAAGGAGAAGGGGGAAGG + Intronic
925172024 2:1755750-1755772 AAAAGGAAGGAGAAAGGGGCTGG - Intergenic
925326563 2:3026590-3026612 ACAAAGAAGCAGTACGGGTAGGG + Intergenic
925855379 2:8124231-8124253 ATAAAGAAGGGAAATGGGGCCGG - Intergenic
926918515 2:17916352-17916374 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
927284853 2:21346050-21346072 ACAAAGAAGGTGAAAGCTGATGG - Intergenic
927337472 2:21941649-21941671 ACAGAGAAGCAGAATGGGGGAGG - Intergenic
927372165 2:22368809-22368831 ACAAAGAGAGAGAATGGGGAGGG + Intergenic
929210320 2:39349720-39349742 AAAAAAGAGGAGAAGGGGGATGG + Intronic
929456744 2:42071581-42071603 ACAGAGAAGAAGAAAGGAGAGGG - Intergenic
929677478 2:43951638-43951660 GCAAAGAAAGAGAAGGGGAATGG + Intronic
929747645 2:44675466-44675488 AGAAAGAAGGAGAACAGGGAGGG - Intronic
929766445 2:44847876-44847898 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
929882949 2:45853156-45853178 ATAAGAAAGGAGAATGGGGAGGG - Intronic
930175045 2:48292972-48292994 AAAAAGAAGGAGGCTGGGCAGGG + Intergenic
930218317 2:48720007-48720029 GCCAAGAATGAGAAGGGGGATGG + Intronic
930266431 2:49205050-49205072 ACAAACAAGGATAAAGGGTAAGG + Intergenic
932569926 2:72933256-72933278 ACAGAGAGGCAGAATGGGCATGG - Intronic
933310395 2:80653223-80653245 GGAAAGAAGGAGAATAAGGAAGG + Intergenic
933394518 2:81713747-81713769 ACAGAGAAAGTGAATAGGGATGG - Intergenic
934155460 2:89195839-89195861 AAGCAGTAGGAGAATGGGGAAGG - Intergenic
934165804 2:89293140-89293162 ACACCAAAGGAGAAGGGGGATGG + Intergenic
934201473 2:89889316-89889338 ACACCAAAGGAGAAGGGGGATGG - Intergenic
934211863 2:89986919-89986941 AAGCAGTAGGAGAATGGGGAAGG + Intergenic
935308361 2:101759557-101759579 AGAGAGGAGGGGAATGGGGAGGG - Intronic
935490148 2:103709499-103709521 AAAAGGAAGGGGAAAGGGGAAGG + Intergenic
936388482 2:112052521-112052543 AAAAAAAAGGAAAATGAGGAAGG - Intergenic
936434716 2:112494315-112494337 AGAAAGAAAGAGGATGGAGAGGG + Exonic
936578727 2:113676918-113676940 TCAAAGAAGGAGTGTTGGGAAGG + Intergenic
937675722 2:124588069-124588091 AGAAAGAAAGAGAAAGGGAAGGG - Intronic
937687627 2:124715783-124715805 AGAAAGAAGGAGATTGGATATGG + Intronic
938269763 2:129959292-129959314 ACAGAGAAAGAGAAAGGGAAAGG - Intergenic
938412343 2:131075482-131075504 AAAAAGAAAGAAAGTGGGGATGG - Intronic
938483980 2:131684558-131684580 AGATAGAGGGGGAATGGGGAAGG - Intergenic
938518674 2:132042416-132042438 AAAAAGGAGGAGGAGGGGGAGGG + Intergenic
938665025 2:133526150-133526172 ACAGAGAAAGGGAATGAGGAAGG + Intronic
938772547 2:134512716-134512738 AGAAAGAGGGAGAATGGTGAAGG + Intronic
938938939 2:136152245-136152267 GGAAAGAAGGAGAAATGGGAAGG - Intergenic
939115659 2:138057394-138057416 AGAAAGAAAGAGAGAGGGGAAGG - Intergenic
939144034 2:138390820-138390842 ACAAAGAAGGAAAGAGGTGAGGG + Intergenic
939710628 2:145514238-145514260 ACAAAGGAGGAGAAGGGAAATGG + Intergenic
940074422 2:149725117-149725139 GGAAAGAAGGAGAATAGGAAAGG - Intergenic
940137219 2:150451603-150451625 AAATAGAAGGAGAAGGAGGAGGG - Intergenic
940736446 2:157458483-157458505 AGAAATGGGGAGAATGGGGAGGG - Intronic
940976279 2:159948655-159948677 AAAAAAAAGGAGAAAAGGGAAGG + Intronic
941380129 2:164782520-164782542 AGGAAGAAAGGGAATGGGGAGGG + Intronic
941426204 2:165348430-165348452 CCAAAGATAGAGAAAGGGGAAGG + Intronic
941650100 2:168083214-168083236 AAAAAAAAGGAGAATGTGGAAGG - Intronic
941703886 2:168636786-168636808 ACACAGAAGGAAAATGAGGTAGG - Intronic
941793798 2:169578758-169578780 AGAAAAAATGAGGATGGGGAGGG - Intergenic
942080153 2:172392808-172392830 AAAAATAGGGAGAATGGGCAAGG + Intergenic
942130358 2:172872711-172872733 ACAATCAAGGAGAAAGGTGAAGG - Intronic
942470896 2:176258458-176258480 ACAAATAAGGAAAGAGGGGAAGG + Intergenic
942632941 2:177971636-177971658 AGAGAGAAGGAGATGGGGGAAGG + Intronic
943716608 2:191159632-191159654 ACAAAGTAGGTGAAGGGAGATGG + Intergenic
943921538 2:193713269-193713291 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
943924215 2:193750800-193750822 GGAGAGAAGGAGAATGGAGAAGG - Intergenic
944096494 2:195974078-195974100 AGAAAGAAGGGGAAGGGGAAGGG + Intronic
944526683 2:200626727-200626749 ACAAAGAAGGAATATGGGGCTGG + Intronic
944667732 2:201971152-201971174 AGACAGAGGGAGAAAGGGGATGG + Intergenic
945012372 2:205479262-205479284 GCAATGAAGGAGAAGTGGGAAGG - Intronic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945946817 2:216002760-216002782 ACAAAGAAGGAGAATGGGGAGGG - Intronic
945988452 2:216372583-216372605 AGAAAGAAGGAGAAAGGCCACGG + Intergenic
946145080 2:217724474-217724496 GTAAAGAGGGAGAATGGTGAGGG + Intronic
946300031 2:218817380-218817402 AAAAAGAAGGAGAATCTAGAGGG + Intergenic
946770077 2:223080071-223080093 ACAAAAAAGGAGAAAAGGGGAGG + Intronic
946787540 2:223263478-223263500 ACAAATAAGGAGCCTGGCGATGG - Intergenic
946901166 2:224373256-224373278 AGAAAGAAGGAGAAAGGGGAAGG - Intergenic
946907171 2:224428634-224428656 ATAAAGAGAGAGAATGGGGCGGG - Intergenic
947015145 2:225611067-225611089 AGAAAGGAAGAGAATGGGGCAGG + Intronic
947040546 2:225913958-225913980 GCAAGGAAGGGTAATGGGGAAGG - Intergenic
947082913 2:226419036-226419058 ACAGAGAGAGAGAATAGGGATGG + Intergenic
947628180 2:231634457-231634479 AGAAAGAAGGGGGAGGGGGAGGG + Intergenic
947707422 2:232287686-232287708 ATTAAGAAGGAAAATGGGGCTGG - Intronic
948558597 2:238835356-238835378 AAAAAGAAGGAGAAGGAGAAGGG - Intergenic
948761128 2:240191698-240191720 AGAAAGAAGGAAGAAGGGGAAGG - Intergenic
948989212 2:241543515-241543537 AGAAAGAGGGAGAAGGGGAAGGG - Intergenic
949037675 2:241824828-241824850 AAAAAGAAGAAGAATGAGGCTGG - Intergenic
1168798281 20:626837-626859 AGAATGAAGGAGAGTGGTGATGG - Intergenic
1168811714 20:709115-709137 ACAAAGAATGGGAAGTGGGAGGG - Intergenic
1168914203 20:1473054-1473076 ACAACGCAGGAGGAGGGGGAAGG - Intronic
1168987903 20:2066154-2066176 CCAGACAGGGAGAATGGGGAAGG + Intergenic
1169002952 20:2181395-2181417 TCAAAGAAGGAAGAAGGGGATGG + Intergenic
1169062958 20:2674843-2674865 ACAAAAAAGGGGGATGGGGGAGG - Intergenic
1169582736 20:7042839-7042861 ACAAAGAAGGAGACTGCTAAAGG + Intergenic
1169651598 20:7874372-7874394 GCAAAGAGGGAGATTGGGCAGGG - Intergenic
1169687874 20:8296588-8296610 AAAAAGAAGGAGCAGAGGGATGG + Intronic
1169765571 20:9144655-9144677 AGAAAGAAGGAGGAGGAGGAGGG + Intronic
1170664858 20:18378050-18378072 ATGAAGAAGGAGATGGGGGAAGG + Intergenic
1171015526 20:21537608-21537630 AGAAAGAAAGAGAAAGAGGAGGG - Intergenic
1171232636 20:23499975-23499997 AGAAAGAGAGAGAAAGGGGAAGG + Intergenic
1172038694 20:32028779-32028801 AGGAAGAAGGAGAAGGGGGGTGG + Intronic
1172387175 20:34542201-34542223 TCCAAGAAGGATAATGGGGAAGG + Intergenic
1172779542 20:37427750-37427772 ACAGAGAAGGAGCATGTGTAGGG - Intergenic
1172937399 20:38630040-38630062 AAAAAGAAGGAGGAGGAGGAGGG - Intronic
1173310987 20:41895628-41895650 ACTGAGAGGGAGAAAGGGGAGGG + Intergenic
1174094042 20:48073834-48073856 GGACAGAAGGAGGATGGGGAAGG - Intergenic
1174435270 20:50502060-50502082 GCAAAGGAGGAGTCTGGGGAGGG - Intergenic
1174827745 20:53783855-53783877 AGAAAGAAAAAGAATGTGGAGGG + Intergenic
1175127668 20:56764553-56764575 ACAATGAAAGAGAAAAGGGAAGG + Intergenic
1175503632 20:59467188-59467210 CCAGGGAAGGGGAATGGGGAGGG + Intergenic
1175780019 20:61676409-61676431 AAAAAGAAGGTGGATGGGGGAGG + Intronic
1175849766 20:62083552-62083574 AGAGAGAAGGAGAAAGAGGAGGG - Intergenic
1176151122 20:63591454-63591476 ACAATGACAGAGAATGGGAAGGG - Intronic
1176714638 21:10340611-10340633 AGACAGAAGGGGAATGGAGAAGG + Intergenic
1177027005 21:15932720-15932742 ACAAAAAAGGGGGAGGGGGATGG + Intergenic
1178150551 21:29789250-29789272 ACAAAGAATGGGAATTTGGAAGG - Intronic
1178150823 21:29791483-29791505 ACAAAGAAGAAGAAGGAGAAGGG + Intronic
1178157761 21:29874420-29874442 ACAAAGAATGGGAATTTGGAAGG - Intronic
1178351567 21:31875281-31875303 ACAAAGAGGGGAAATGGGGTGGG - Intronic
1178496222 21:33088700-33088722 AAAAAGAAGGAGAAAAAGGAGGG + Intergenic
1178562706 21:33654025-33654047 AGAAAGAAAGAGAAAGAGGAAGG - Intronic
1178791520 21:35704796-35704818 GCAAAGAAGGAGAAAAGAGAAGG + Intronic
1178822859 21:35991336-35991358 ACAGAGCAGGAGAGTGAGGAGGG + Intronic
1179173360 21:38990194-38990216 ACAAAGAAGTAGAAGGAGAAGGG + Intergenic
1179488607 21:41726583-41726605 AGAAAGAAGAAGAAGGGGGGGGG - Intergenic
1179558536 21:42196067-42196089 AGAAAGGGGGAGAGTGGGGAGGG + Intergenic
1180340347 22:11613005-11613027 GAAAAGAAAGAAAATGGGGAAGG - Intergenic
1180485070 22:15787020-15787042 AGATAGAGGGGGAATGGGGAAGG - Intergenic
1180534273 22:16383077-16383099 AAAAAGGAGGAGGAGGGGGAGGG - Intergenic
1180675321 22:17582376-17582398 AAAAAAAAGGAGAATGTGGTAGG + Intronic
1180735115 22:18010740-18010762 AGAAAGAAGGAGAATTGAGAAGG + Intronic
1180735897 22:18017164-18017186 TCAAAAAAGGAGAATGGGCATGG - Intronic
1181418550 22:22779674-22779696 AAAAAGAAGGAGAGAAGGGAAGG + Intronic
1181424158 22:22822300-22822322 ACAAAGCATGGGAGTGGGGATGG + Intronic
1181896385 22:26111583-26111605 AAAAAGAAGGAGAAGAAGGAGGG - Intergenic
1182016420 22:27043963-27043985 AGAAAGAAGGACAAAAGGGAAGG - Intergenic
1182102967 22:27670686-27670708 AGAAAGAAGCAGGCTGGGGAAGG - Intergenic
1182212823 22:28690811-28690833 GCAAGGAAGGAAAAAGGGGAGGG + Intronic
1182578904 22:31291945-31291967 CCACAGAAGGAGGCTGGGGAAGG + Intronic
1182586807 22:31348083-31348105 ACAGAGAAAGAGAAAGGGGCCGG + Intergenic
1182806383 22:33074172-33074194 ATAAAGAAGAAGAGTGAGGAGGG - Intergenic
1183166990 22:36155586-36155608 ACAAAGCAGGAAGAAGGGGAAGG - Intronic
1183177726 22:36236918-36236940 ACAAAGCAGGAAGAAGGGGAAGG - Intronic
1183308256 22:37095510-37095532 ACTCAAAAGGAAAATGGGGAGGG + Intronic
1183361079 22:37383877-37383899 CCAAAGAAGGGGCATGGGGCTGG + Intronic
1183705447 22:39472653-39472675 ACAAAGGAGGAGACTGAGGCTGG + Intronic
1184142780 22:42588157-42588179 ACAAAAAAGTAAAATGGGGCCGG + Intronic
1184211795 22:43040441-43040463 AAAAAAAAAGAAAATGGGGAGGG - Intronic
1184328970 22:43813565-43813587 ATAAAGAAGGCAAATGGGGAGGG - Intergenic
1184518494 22:44978284-44978306 ACACTGAAGGAGAATGATGACGG - Intronic
1184605333 22:45570032-45570054 ACATAGAAGAAAAATGGGGCCGG + Intronic
1184863243 22:47188804-47188826 ACAAATAAGGACAATGAGGTTGG + Intergenic
1185048547 22:48541393-48541415 AGAAAGCATGGGAATGGGGAGGG - Intronic
1185135102 22:49065820-49065842 AGAAAGAAAGAGAAAGGAGAAGG - Intergenic
1203238069 22_KI270732v1_random:26667-26689 AAAAAGATGGAGGAGGGGGAGGG - Intergenic
1203315370 22_KI270737v1_random:2719-2741 AAAAAGGAGGAGGAGGGGGAGGG + Intergenic
949431865 3:3985436-3985458 AAACTGAAGGAGCATGGGGAAGG - Intronic
949523770 3:4882732-4882754 ATAAATAAGGAGAAAGGGAAAGG + Intronic
949917214 3:8974446-8974468 GCACAGGAGGAGAATGGAGAAGG - Intergenic
950248257 3:11441641-11441663 AAAAAAAAGGAGAAAGGGGAAGG - Intronic
950274150 3:11644040-11644062 GGAAAGAAAGAGAAAGGGGAGGG + Intronic
950750112 3:15121781-15121803 AAAAAGAAGGAAGGTGGGGAGGG + Intergenic
951152551 3:19308827-19308849 AGAAAGAGGGAGAAGGAGGAGGG - Intronic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
951795925 3:26538228-26538250 AAAGGGAAGGAGAAGGGGGAGGG + Intergenic
951870234 3:27353903-27353925 AGAAAGAAAGAGAAGGGAGAAGG + Intronic
952069535 3:29617468-29617490 ACTAGGAAGGAGCATGAGGAAGG + Intronic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952490888 3:33871488-33871510 AAAAAGGAGGGGGATGGGGAAGG + Intergenic
952516990 3:34114651-34114673 ACTAAGAAGGGTAATGGGTAGGG - Intergenic
952588356 3:34920506-34920528 ATTAAGAAGGAGAATGAGAATGG - Intergenic
953006002 3:38979929-38979951 GCAAAGAAGCTGAATGGGCAGGG - Intergenic
953336421 3:42098151-42098173 AGAAAGGAGGGGAGTGGGGATGG - Intronic
953411054 3:42690712-42690734 ACAGGGAAGGGGAATGGGGTTGG + Intronic
953575790 3:44112227-44112249 AGAGAGGAGGAGAATAGGGAGGG + Intergenic
953854680 3:46492189-46492211 AGAAAGAAAGAGAGTGTGGAAGG + Intergenic
953910719 3:46891584-46891606 AAGAAGAAGGATAGTGGGGAGGG + Intronic
953932422 3:47012348-47012370 ACAGGGAAGGAGTATGGGTAGGG + Intergenic
954055791 3:48023408-48023430 ACAAAAAAGGAGAAAAGAGAAGG + Intronic
954957235 3:54532075-54532097 ACAAAAAAAGAAAATGGGCAGGG - Intronic
955169774 3:56551897-56551919 ACAAAGAGGTAGGTTGGGGAAGG - Intergenic
955565539 3:60240628-60240650 ACAAAGAAAGAGAAGGAAGAGGG + Intronic
955730488 3:61980486-61980508 AGAAAGAGGGAGAAGGAGGAGGG + Intronic
957047336 3:75386185-75386207 AGAAAGAAGGAGAAGAAGGAAGG + Intergenic
957156898 3:76555416-76555438 AGAAAGAAGGAGAAGGGGAAGGG + Intronic
957252523 3:77792151-77792173 ACAAAGAAGGAGAAAGAGAGTGG + Intergenic
957333245 3:78793152-78793174 AGAAAGAAAGAGAAAGGGAAAGG + Intronic
958136195 3:89496005-89496027 AAAAAGAAAGAGAATGAGGGAGG - Intergenic
958485849 3:94706863-94706885 AGAAAGAAGGAGAGTGGGAGAGG + Intergenic
958701412 3:97595733-97595755 ACGAAATAAGAGAATGGGGAAGG + Intronic
959158474 3:102695480-102695502 ACAAAGAAAGACAATGACGAAGG + Intergenic
959208347 3:103342512-103342534 AGAGAGAAGGAAAAAGGGGAGGG - Intergenic
960418611 3:117415625-117415647 AAAAAGAAAGAGAAAGGGAAGGG - Intergenic
960737154 3:120793315-120793337 ACATGGATGGAGAGTGGGGAAGG - Intergenic
961115353 3:124324359-124324381 ATAGAGAGGAAGAATGGGGAGGG - Intronic
961183162 3:124891947-124891969 AAAAAGAAGGAAAAGAGGGAGGG + Intronic
961560153 3:127723204-127723226 TCAAAGAGGGAGAAAGTGGAGGG - Intronic
961581547 3:127887454-127887476 ACAAAGAAGGAGGATGTGGCTGG + Intergenic
961922095 3:130437857-130437879 ACAAAGCAGGATAATAGGGATGG - Intronic
961963815 3:130881366-130881388 ACAAAGGAGGGGAAGGGGGAGGG - Intronic
962267988 3:133957068-133957090 AGAAAGAAGGGCAATGGGAATGG - Intronic
962371900 3:134827750-134827772 GCAGAGACTGAGAATGGGGAGGG + Intronic
962539448 3:136364058-136364080 ACAAAAAACAAGAATGGAGAAGG - Intronic
962930373 3:140030428-140030450 AGACAGAAGGAGAGTGGGTAGGG + Intronic
962937521 3:140094324-140094346 GCAAAGTAGGAGAAAGGGCATGG - Intronic
962938075 3:140100000-140100022 AAAACGAAGGAGAAAGAGGATGG - Intronic
963235578 3:142952754-142952776 AAAAACAAGAAGAGTGGGGAGGG + Intronic
963652943 3:148006989-148007011 AGAAAGAAGGAGGAAGAGGAAGG - Intergenic
964620246 3:158714061-158714083 ACAAAGAGGGAGACTGAGAAAGG + Intronic
964877549 3:161385457-161385479 ACTAGGAGGGAGAAAGGGGAAGG + Intergenic
964969508 3:162542268-162542290 AGAAAGAAGGAACAAGGGGATGG - Intergenic
965076004 3:163977303-163977325 TAAAAGAAGGAGAAGGGGGCTGG - Intergenic
965086316 3:164103495-164103517 CCAAAGAAGGAGCACGGTGAGGG - Intergenic
965648368 3:170908421-170908443 AGAAAGAAGGAGAATGGATGGGG - Intronic
966092249 3:176154282-176154304 GCAAGAAAGGAGTATGGGGAAGG - Intergenic
966510579 3:180757866-180757888 AGAAAGAAAGAGAAGGGGAAGGG + Intronic
966510593 3:180757962-180757984 AGAAAGAAAGAGAAGGGGAAGGG + Intronic
966655444 3:182352335-182352357 AAAAAGAAGAACAATGGGGTCGG + Intergenic
967004613 3:185372305-185372327 AAAAAGGAGGAGGAAGGGGAAGG - Intronic
967288705 3:187898531-187898553 ATAAAGAAGGATTATGTGGAGGG + Intergenic
967356486 3:188577818-188577840 AGAAAGAAGAAGGAAGGGGAGGG - Intronic
967435542 3:189441786-189441808 ACAAAAAAGAAGCTTGGGGATGG + Intergenic
967534400 3:190585929-190585951 ACAAAGCATGAGAATGGTAAAGG - Intronic
967869029 3:194214430-194214452 ACCAAGAAGGAGGAAGGCGAGGG + Intergenic
968604077 4:1523360-1523382 AAACAGAAGAAGAATGGGGCAGG - Intergenic
968650318 4:1757782-1757804 TCAAGGCAGGAGAAGGGGGAGGG - Intergenic
968665298 4:1818128-1818150 ACCATGAGGAAGAATGGGGAAGG + Intronic
969154382 4:5197132-5197154 ATGAAGAAGGACAATAGGGAGGG + Intronic
969558030 4:7926721-7926743 AGAAAGAAGGGGAAGGGGAATGG - Intronic
970015485 4:11507848-11507870 AGAAAGAGAGAGAGTGGGGAGGG + Intergenic
970149937 4:13079062-13079084 CCAAAGAGGGAAAATTGGGAAGG - Intergenic
970235884 4:13957632-13957654 ACAGAGACAGAGAAAGGGGAGGG - Intergenic
970369215 4:15391020-15391042 TCAAAGCAAGAAAATGGGGAAGG + Intronic
970546940 4:17139376-17139398 ACTTAGAAGGAGAATGGTAAAGG + Intergenic
970898772 4:21134212-21134234 ACTAAGAAGGAGGAAGAGGAGGG - Intronic
970918638 4:21366793-21366815 ACAAAGAGAGAGAGAGGGGAGGG + Intronic
971251264 4:24975321-24975343 AGACAAAAGGAGAAGGGGGAAGG + Intronic
971251415 4:24975986-24976008 AAAAAGAAGGAGAAGGGAGAGGG + Intronic
972493407 4:39609941-39609963 ATAAGGAATGAGAATAGGGAGGG - Intronic
972790241 4:42364867-42364889 AGAAAGAAAGAGAAAGAGGAAGG - Intergenic
972794811 4:42404910-42404932 AGAAAGAAAGAGAAGGGGGCTGG + Intergenic
973655607 4:53044575-53044597 AAAGAGAAGGGGAATGGGAAGGG - Intronic
973842150 4:54873322-54873344 TCACAGAAGCAGACTGGGGAGGG - Intergenic
974186541 4:58454579-58454601 GCAAAGAAAGAGAGAGGGGAAGG - Intergenic
974385804 4:61201164-61201186 AAAAAGAAAGAGAAGGGGGGTGG + Intergenic
974459702 4:62171707-62171729 ACCACGAAGGAGACAGGGGAAGG - Intergenic
974556843 4:63461651-63461673 AGAGAGAAGGAGAAGGGGGAAGG + Intergenic
975258686 4:72270658-72270680 ACCAAGAAGGAGAATACAGAAGG + Intergenic
975359385 4:73450189-73450211 CCAAAGGAGGAGAATGGGGAAGG - Intronic
975391468 4:73822890-73822912 AAGAAGAGGGAGAAAGGGGAGGG + Intergenic
976336190 4:83890326-83890348 AAAAAGAATGAAAATGGTGAAGG - Intergenic
976494502 4:85712010-85712032 AAAAAGAAAAAGAATAGGGAGGG - Intronic
976598890 4:86919619-86919641 AAAAAGAAGCAGAATGGGGCCGG - Intronic
976633781 4:87266791-87266813 GAAAGGAAGGAGAATGGTGAAGG - Intergenic
976633843 4:87267529-87267551 AATAAGAAGGAGAAGGGAGATGG - Intergenic
976871357 4:89797344-89797366 AGAAGGAAGGAGAATTGGGTAGG - Intronic
977317388 4:95467412-95467434 ACAGAGAGAGAGAATGGGGCTGG + Intronic
977556520 4:98492332-98492354 ACAAAGAACAAGAGTAGGGAGGG + Intronic
977573110 4:98650158-98650180 ATAATGAAGGACCATGGGGAAGG + Intronic
978075318 4:104521959-104521981 GCAAAGAGGGAAAAGGGGGAGGG - Intergenic
978350421 4:107815628-107815650 ACAATGAAGGAGATTGGGAATGG + Intergenic
978413918 4:108455559-108455581 ACAGAGAAGAGGACTGGGGATGG - Intergenic
978798664 4:112733364-112733386 ACAAAGAAGCAGAATTGGATAGG - Intergenic
979346325 4:119591817-119591839 AGAAGGAAGGAGAATGGGGAGGG + Intronic
979474646 4:121140766-121140788 AAAAAAAAGGAAAAGGGGGAGGG + Intronic
980145489 4:128978561-128978583 ACAACCAAGGAGAATGAGGGAGG + Intronic
981658107 4:147135224-147135246 AAAAAGTAGGAGAAAGGGGAAGG - Intergenic
983192757 4:164772221-164772243 AGGAAGAGGGAGAAGGGGGAGGG + Intergenic
983661268 4:170132734-170132756 AAAAAGGAGGAGAAACGGGAAGG - Intergenic
983974225 4:173913147-173913169 ACATAGTAGGACAATGGAGAAGG + Intergenic
984070306 4:175103258-175103280 AGAAAGAAGGAGAAGGGGAAGGG + Intergenic
984382498 4:179013416-179013438 AGAAAGAAAGAGAAAGGGAAAGG + Intergenic
984632615 4:182076496-182076518 ATAAAGAAGGAGAAAGAGGCTGG - Intergenic
984725162 4:183013450-183013472 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
984951396 4:185010463-185010485 ACAAAGAAGGAGATGGGGAAGGG + Intergenic
985102040 4:186468040-186468062 GGGAAGAAGGAGAGTGGGGAAGG - Intronic
985520905 5:373619-373641 ACAGAGGAGGAGACTGGGGCTGG + Intronic
985846326 5:2352239-2352261 ACAAAGAACGAGGATGAGGCGGG + Intergenic
986244250 5:5991055-5991077 ACCAAAAGGGAAAATGGGGAAGG - Intergenic
986613878 5:9597110-9597132 ACAGAGGAGGAGGAAGGGGAAGG - Intergenic
987190883 5:15477198-15477220 AGGGAGAAGGAAAATGGGGAGGG - Intergenic
987900571 5:24005886-24005908 ACAAAGAATTAGAATTTGGAAGG - Intronic
987917806 5:24238633-24238655 AGAAAGTGGGAGAAAGGGGAAGG - Intergenic
987986625 5:25155290-25155312 ACAAAGAAGGGACATGTGGATGG + Intergenic
988089614 5:26519699-26519721 AGAAAGAAGGAGAAGGAAGAAGG + Intergenic
988297287 5:29382064-29382086 CAAAAGAAGGAGAATATGGATGG - Intergenic
988620882 5:32822179-32822201 ACAAAGAACGGGAATTTGGAGGG - Intergenic
988857883 5:35246988-35247010 AGAAAGAAGGAAATGGGGGAAGG + Intergenic
989375704 5:40757542-40757564 ACAAGGAAAGGGAAAGGGGAAGG + Intergenic
989410470 5:41114082-41114104 GGAAAGAAGGAGGATGGAGAGGG - Intergenic
989511080 5:42288300-42288322 ACAAAGAAGGAATAAGAGGAAGG + Intergenic
989726546 5:44594148-44594170 GCAATGAAGTAGAGTGGGGAAGG - Intergenic
989746273 5:44834027-44834049 ACAATGAATGAGAAAGGGGGAGG - Intergenic
989756218 5:44958775-44958797 AAAAAGAAGGAGGAAGGAGAAGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990258623 5:53997660-53997682 ATGAAGGAGGTGAATGGGGAAGG + Intronic
990575550 5:57120372-57120394 ACAAAAAAACAGAAAGGGGACGG + Intergenic
990598776 5:57336651-57336673 AAAAAGGTGGAGAATGGGGAGGG - Intergenic
990762325 5:59143192-59143214 AGAAAGAAGGAAAAGAGGGAGGG - Intronic
990797905 5:59565173-59565195 AAAGAGAAGGAGAATGGGACAGG + Intronic
991169012 5:63599161-63599183 ACAAAGAAGAGGGAGGGGGAGGG - Intergenic
991503694 5:67302967-67302989 ACAGAGAGGGAGAAGGGGTAGGG + Intergenic
991933159 5:71775227-71775249 ACAGAGAAAGAGAATAAGGAGGG - Intergenic
992103942 5:73435257-73435279 AAAAAGAAGGATTAAGGGGATGG + Intergenic
992154103 5:73937966-73937988 ACCAAGAAGGAACATGGAGAAGG + Intronic
992210434 5:74474401-74474423 ATAAGGAAGGAGCATGGAGAAGG + Intergenic
992491645 5:77250361-77250383 TCATAGAGGGAGAATGGGAAGGG - Intronic
992705467 5:79387006-79387028 AGAAAGAAGGAAGAGGGGGAAGG - Intronic
992865635 5:80954448-80954470 ACACAGCAGGAGAATCAGGAAGG + Intergenic
993052318 5:82939896-82939918 ACAGAGAGAGAGAAGGGGGAGGG - Intergenic
993854367 5:93055158-93055180 ATAGAGATGGAGAATGGGAATGG - Intergenic
994311707 5:98280003-98280025 AGAAAGAAAAAGAATGGAGAAGG - Intergenic
994327503 5:98465447-98465469 ACAAAGAATGGGAATAGGGCTGG + Intergenic
994667369 5:102722222-102722244 ACAAAGAAGGAGAAATATGAAGG + Intergenic
994884910 5:105548428-105548450 GCAAAGAGTGAGAATGGGTAGGG + Intergenic
995541282 5:113188553-113188575 ACACAAAAGCAGAAAGGGGAAGG + Intronic
996313092 5:122129043-122129065 ATAAAGCAGGAAAATGTGGAAGG - Intergenic
996442604 5:123509124-123509146 ACAATGAAGTAGAACGGGGAAGG - Intergenic
996769238 5:127068432-127068454 ACCAAGCTGGAAAATGGGGAAGG + Intronic
997225740 5:132208372-132208394 AGAGAGGAGGAGAAGGGGGAGGG + Intronic
997465702 5:134086701-134086723 GAAAAGAAGGAGAAGGGGAAGGG - Intergenic
998034909 5:138906991-138907013 AGAAAGAAGGAGGAGGAGGAAGG - Intronic
998105029 5:139462940-139462962 AGAAGGGAAGAGAATGGGGATGG - Intergenic
998251547 5:140557101-140557123 AGACAGACGGAGAATGGGGGGGG - Intronic
998549869 5:143067041-143067063 ACCAAGAAGCAGAAGCGGGAGGG - Intronic
998597683 5:143550767-143550789 AAAAAGAAGGAGGAAGAGGAGGG - Intergenic
998620413 5:143788454-143788476 AAAGAAAAGAAGAATGGGGAAGG + Intergenic
998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG + Intronic
998919207 5:147049271-147049293 AGAAAGAAGGAAATTGAGGATGG + Intronic
999076608 5:148802155-148802177 ACAAATAAGGAGAATGAGTATGG - Intergenic
999183663 5:149689398-149689420 ACAAGGAAGGGGCATGGGGCGGG + Intergenic
999291184 5:150427597-150427619 ACCAAGAAGGAGAATGGGGAAGG - Intergenic
999745785 5:154590753-154590775 ACAAAGGAGGGGGAGGGGGAGGG - Intergenic
1000124069 5:158226477-158226499 GCAAAGAATGGGGATGGGGAAGG + Intergenic
1000354782 5:160384012-160384034 ATAAAGAAGGAATATGGGGCTGG + Intergenic
1001266436 5:170277846-170277868 AAAGAGAAGGAGGAAGGGGAGGG + Intronic
1001296037 5:170499729-170499751 ACAAAGAGGAAGAAAGGAGAGGG + Intronic
1001302734 5:170548605-170548627 ACTAGGAAGGTGGATGGGGAAGG - Intronic
1001496334 5:172189837-172189859 AGAAAGAAAGAGAAAGGGAAAGG + Intergenic
1001496339 5:172189899-172189921 AGAAAGAAAGAGAAAGGGAAAGG + Intergenic
1001570199 5:172725774-172725796 AAAAAGGAGGAGAAAGGGGTAGG + Intergenic
1001635010 5:173203420-173203442 AGAAAGAGGGAGGAGGGGGAGGG - Intergenic
1001712327 5:173788875-173788897 ACAAAGAGTGAGAGTGGAGAAGG + Intergenic
1003197314 6:3926261-3926283 AGAAAGCAGGAGGATGTGGAGGG + Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003513441 6:6800267-6800289 ACAAAGGAGGATAATGGAAAGGG - Intergenic
1004002042 6:11604802-11604824 AAAAAGAAGAAGAAGAGGGAGGG + Intergenic
1004165121 6:13249999-13250021 ACAAAGACAGAGAGTGGGGTGGG - Intronic
1004542282 6:16562403-16562425 AGAAAGAAGGGGAATGGGGAAGG + Intronic
1004589719 6:17037837-17037859 ACGAAAAAGGAGAATCTGGATGG - Intergenic
1004757059 6:18621804-18621826 CCAAAGAAGTAAAATGAGGATGG - Intergenic
1004945092 6:20603633-20603655 ACCATGAAGGACAATGGTGAAGG + Intronic
1004947110 6:20627843-20627865 ACAAAGAAGTATAATTGGAATGG + Intronic
1005061840 6:21783797-21783819 GCAAAAAAGGAGAAGGAGGAAGG - Intergenic
1005254332 6:23983923-23983945 ACAGAGAGAGAGAATGGGAAGGG + Intergenic
1005358421 6:25007678-25007700 ACCGAGAAGGAAGATGGGGAGGG - Intronic
1005459440 6:26054531-26054553 CCCAAGAAAGAGAAAGGGGAGGG - Intergenic
1005471127 6:26163689-26163711 AAAAAGAAAGAGAAAGGGGAAGG + Intronic
1006627587 6:35408376-35408398 AGAAGGAAGGAGAATGGAGCTGG + Intronic
1006911505 6:37566384-37566406 AGAGAGAAGGGGAGTGGGGAGGG + Intergenic
1007630227 6:43269421-43269443 AGAGAGAAGGAGGAGGGGGAAGG + Intronic
1007756486 6:44102857-44102879 ATAGTGAAGGAGAATGGGGTAGG - Intergenic
1007765717 6:44158705-44158727 ACTGAGAAGGAGAAAAGGGAAGG + Intergenic
1008067058 6:47061276-47061298 ACAAAGTAAGAGACTGGGGGAGG - Intergenic
1008111248 6:47497362-47497384 ACAGGGAAGGAGAAGGGGAAGGG - Intronic
1008326296 6:50185943-50185965 TCTAAGAAGGAGAAATGGGATGG - Intergenic
1008543638 6:52566750-52566772 AGAAAGAAGGAGATATGGGAGGG - Intronic
1008595858 6:53041073-53041095 ACAAAGACGGGTAATGGTGAGGG + Intronic
1009051379 6:58280722-58280744 AGAAAGAAGGAGAATTGGGAAGG + Intergenic
1009782879 6:68293066-68293088 AGGAAGAGGAAGAATGGGGAGGG + Intergenic
1009812400 6:68685459-68685481 AGAAAGACAGACAATGGGGAAGG + Intronic
1010024919 6:71204132-71204154 AGGAAGAAAGAGAGTGGGGAAGG + Intergenic
1010071149 6:71747699-71747721 GGAAAGATGGAGAAAGGGGAAGG - Intergenic
1010614842 6:78000077-78000099 ACAAACATGGAGAAAGGGAATGG + Intergenic
1011038982 6:83010048-83010070 ACATAGGAGGAGGTTGGGGAGGG + Intronic
1011092201 6:83616212-83616234 ACAAAGCAGGACAAGGAGGATGG + Intronic
1011817998 6:91214772-91214794 ACACAGAAGGAAACTGTGGAAGG + Intergenic
1012270205 6:97199935-97199957 AGAAAGCAGAAGAAAGGGGATGG - Intronic
1012289653 6:97437108-97437130 AAAAAGGTGGAGAATGGGTAGGG - Intergenic
1012494379 6:99818516-99818538 AAGAAGAAGAAGAAGGGGGAGGG - Intergenic
1012677826 6:102138945-102138967 ACAAAGAAAGTGAAGGGGGGAGG + Intergenic
1013047874 6:106505563-106505585 ACGAAGATGGGGAATGGGGAAGG - Intergenic
1013311657 6:108900385-108900407 GCAAAGAGGGAGAAAGTGGAGGG - Intronic
1013752546 6:113423796-113423818 ACAAAGAAAGAGAAGGATGAAGG - Intergenic
1013815251 6:114090224-114090246 ACACAGACGGAGAATGTGTAAGG - Intronic
1014014199 6:116511007-116511029 AGAAAGAGGGAGAGTGGGAAGGG + Intronic
1014144985 6:117987361-117987383 AAAAAGAAGGAGAAGAGGAAGGG - Intronic
1014188653 6:118466023-118466045 ACACAGAGGGAGAGCGGGGAGGG + Intronic
1014785351 6:125612221-125612243 ACAAAAAAGGAAAATGGGGGTGG - Intergenic
1014857978 6:126426246-126426268 ACCAAGTAGGAAAATGGAGAAGG + Intergenic
1014881081 6:126725400-126725422 ATAAAGGAGGAGAAAGGGGCAGG + Intergenic
1014916427 6:127155075-127155097 ATAAAACAGGAGAATGGGAAAGG - Intronic
1014939266 6:127419243-127419265 AAAAAGAAAGAAAATAGGGAAGG - Intergenic
1015158700 6:130126917-130126939 AGAAGAAAGGAGAATGGGGGTGG + Intronic
1015163964 6:130182618-130182640 AGAAAGAAGGAGGGAGGGGAGGG + Intronic
1015220443 6:130798588-130798610 AGAAAGAAGAAGAATGTTGAAGG - Intergenic
1015275285 6:131377741-131377763 TTGAAGAAGGAGAAAGGGGAGGG - Intergenic
1015282290 6:131446719-131446741 AGAAAGCAGGACAATGGTGATGG - Intergenic
1015326877 6:131933478-131933500 ATTAAGAAGGAGAATGAGGGTGG + Intergenic
1015379415 6:132549645-132549667 AGAATGAATGAGAATGGAGAAGG - Intergenic
1015526051 6:134175895-134175917 AGAAAGAGGGAAAAGGGGGAGGG + Intronic
1015900756 6:138063293-138063315 AGAAAGAAAGAGAGAGGGGAAGG + Intergenic
1015997888 6:139013627-139013649 AGAAGGAAGGAGAAGGGGAAGGG - Intergenic
1016830115 6:148425728-148425750 AAAAAAAAGGAGGAGGGGGAGGG - Intronic
1017035368 6:150262422-150262444 ATGAAGAAGGAGGGTGGGGAAGG - Intergenic
1017256868 6:152343453-152343475 AAAAAGAAAGAGAATGGGGCCGG - Intronic
1017436754 6:154422655-154422677 TCAAAGAAAGCAAATGGGGAGGG + Intronic
1017467803 6:154710960-154710982 ACAGGGAAGGAGGATGGGGCTGG - Intergenic
1017547293 6:155466364-155466386 ACAAAGGAGGAGAAAGAGAAAGG - Intergenic
1017965876 6:159265597-159265619 ACAAAGAAAGAGAAGGAGGGCGG + Intronic
1018038116 6:159898803-159898825 AGAAAGAAGAAGAAGGGAGAAGG - Intergenic
1018039472 6:159909384-159909406 AGAAAGGAAGAGGATGGGGAAGG - Exonic
1018623884 6:165758688-165758710 AGAAGGAAGGAGAAGGAGGAGGG + Intronic
1019007697 6:168815561-168815583 AGAAACAAGGAGAATGTGGATGG - Intergenic
1019495487 7:1337766-1337788 AGAAAGAAGGAGAGAGAGGAGGG - Intergenic
1019800509 7:3084819-3084841 AAAAAGAAGGGGAATGGAGTGGG - Intergenic
1019820983 7:3242505-3242527 ACAAAGAAAGAGAGAGAGGAAGG - Intergenic
1020087159 7:5316708-5316730 ACAAAGAATGGGAAAGGGGAGGG + Intronic
1020368505 7:7406574-7406596 AAAATGATGGAGAATGGGGTAGG + Intronic
1021289380 7:18823989-18824011 AAGAAGAAGGAGAAGGGGAATGG + Intronic
1021312560 7:19111880-19111902 ACAAAGAAGGAGAATCTAAAGGG + Intronic
1021482786 7:21136264-21136286 ACAAAGAAGGTGCAGGGTGAAGG + Intergenic
1021912596 7:25401388-25401410 ACAATAAAGGAGGATGGCGAAGG - Intergenic
1022015413 7:26345006-26345028 ACGAAGACGGAGGAGGGGGAGGG - Intronic
1022144662 7:27524902-27524924 AAAAAGCAGGATAACGGGGATGG - Intergenic
1022287405 7:28967021-28967043 ACAAAGAAAGAAATGGGGGATGG + Intergenic
1022636599 7:32142178-32142200 AGGCAGAAGGAGAAGGGGGAAGG + Intronic
1022670301 7:32449363-32449385 AGGAAGAAGGAGAAGGGGAACGG + Intergenic
1022939659 7:35221512-35221534 ACAAAGAAAGACAATGGGTTTGG + Intronic
1023028085 7:36070022-36070044 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1023098783 7:36691504-36691526 ACAAAGGAGGAGAAAGAGAATGG + Intronic
1023149127 7:37183190-37183212 GCACAGAAGGAGAAGGAGGAAGG + Intronic
1023188993 7:37559153-37559175 AAAAAGAAAGAGAAGGAGGAGGG - Intergenic
1023575501 7:41622087-41622109 AGAAAGAAGGGGAATGAGAAAGG + Intergenic
1023609267 7:41957340-41957362 AGAAAGCAGGAGAGTGGGCAAGG - Intergenic
1023625209 7:42108727-42108749 AAAAAGAAAGAGAAAGGGAAAGG + Intronic
1024104344 7:46067032-46067054 AGAGAGATGAAGAATGGGGAGGG - Intergenic
1024130888 7:46352149-46352171 AGAGAGAAAGAGAAAGGGGAGGG + Intergenic
1024707847 7:51980627-51980649 AGAAAGAAGGAGAAAGAGAATGG - Intergenic
1025307294 7:57873035-57873057 AAAAAGGAGGAGGAGGGGGAGGG + Intergenic
1025716067 7:63956657-63956679 AAAAATAAGGAGACTGGGCATGG - Intergenic
1026179387 7:68025375-68025397 AGAAAGAAGGAGAGTGGCTAGGG - Intergenic
1026234714 7:68516889-68516911 ACAAAGGAGAAGCAAGGGGAAGG + Intergenic
1026277755 7:68895052-68895074 AGAAAGAAGGAGGGTAGGGAAGG - Intergenic
1026455676 7:70570627-70570649 ACAGAGAAGGGTAAAGGGGAAGG - Intronic
1026895130 7:74006001-74006023 AGAAAGAAAGAGAAGAGGGAAGG + Intergenic
1026901496 7:74039918-74039940 AGAAAGAAGGAGGATGGAGCTGG + Intronic
1026975521 7:74495457-74495479 ATGAAGAAGGTGAATGGTGAGGG - Intronic
1026988233 7:74568351-74568373 AAAAAGAAGGAGAAAGGGCCGGG + Intronic
1027306015 7:76898315-76898337 ACAAGGAAGGAGGCTGGGCATGG + Intergenic
1027736157 7:81935557-81935579 ACAAAGTTGGGGAATGGGGAAGG + Intergenic
1027941777 7:84691473-84691495 AGAAGGAGGGAGAATGGGGGTGG - Intergenic
1028000852 7:85496252-85496274 AGAAAGAAAGAGAAAGGGAAAGG - Intergenic
1028055826 7:86241328-86241350 AAAAAGAAGGAGAAGGGGAGAGG + Intergenic
1028074602 7:86496439-86496461 AGAAAGAAAGACAGTGGGGAGGG + Intergenic
1028478551 7:91278355-91278377 GTAAAGAATGAGAATGTGGAAGG - Intergenic
1028538187 7:91912726-91912748 ACAAAGAAGGAAAAAAGGCAAGG + Intergenic
1029007763 7:97228509-97228531 GGAAAGTAGAAGAATGGGGAGGG + Intergenic
1029089303 7:98035614-98035636 AAAAAGAAAGAGAAGGGGGTTGG + Intergenic
1029274047 7:99393737-99393759 ACAAAAAAGGAGATGGGGGTGGG - Intronic
1029310958 7:99663804-99663826 ATAAAGAAGGAGATTGGGGAAGG - Intronic
1029575785 7:101402426-101402448 CCAGAGAAGGGGAAAGGGGAAGG - Intronic
1029732005 7:102444648-102444670 AAAAAGAAGAAGCCTGGGGAAGG - Intronic
1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG + Intronic
1029966397 7:104745245-104745267 AGGAAGAAGGAGAAAGAGGAAGG - Intronic
1030339441 7:108360224-108360246 ACAGAGAAGGAGAAGTGAGAAGG + Intronic
1030780069 7:113589749-113589771 TCACAGAAAGATAATGGGGAGGG - Intergenic
1031372467 7:120984830-120984852 ACAATGAATGAGAAAGGGCATGG - Intergenic
1031425772 7:121603815-121603837 ATAAAGAAGGCTAAGGGGGATGG - Intergenic
1032457258 7:132082790-132082812 ACAAAGAAGAAAAAGGAGGAAGG + Intergenic
1032799041 7:135303395-135303417 ACAAAGAAGGAAGAGGGGGAAGG + Intergenic
1032988198 7:137361979-137362001 AAAAGGAAGGAAAATGGGGAGGG - Intergenic
1033168133 7:139059153-139059175 GCAGAGTAGGAGGATGGGGAGGG - Intronic
1033268632 7:139910854-139910876 ACAAAGAAGGAAAATGGCAGAGG - Intronic
1033411463 7:141121954-141121976 ACAAAGACAAAGAATGGGAAAGG - Intronic
1034849396 7:154479903-154479925 GCTGAGAAGGAGGATGGGGAGGG - Intronic
1034944920 7:155255652-155255674 AAGAAGAAGGGGAAAGGGGAAGG + Intergenic
1035111098 7:156482532-156482554 AGAAAGAAAGAGAAAGAGGAAGG + Intergenic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1035993890 8:4523859-4523881 CCAAAGAAGGAGAAAGGAGTTGG - Intronic
1036019002 8:4821041-4821063 ACCAAGAAGAACAATGTGGAGGG + Intronic
1036213646 8:6862522-6862544 AGCAAGATGGAGAATGAGGAAGG + Intergenic
1036410911 8:8499677-8499699 AGAAAGATGGAAAATGGGAAAGG + Intergenic
1037331159 8:17745141-17745163 ACAAGGAAGTGGTATGGGGAAGG - Intronic
1037469627 8:19194680-19194702 ATAAAGAAGAAGAATGACGAGGG + Intergenic
1037554727 8:20011170-20011192 ACTAAGAAGGATAAAGGGTAGGG + Intergenic
1037653745 8:20865445-20865467 AGAAAGAAGGAAAAAGGGGAAGG - Intergenic
1037809037 8:22075310-22075332 AAGAAGAAGAAGAAGGGGGAGGG - Intronic
1037912023 8:22749136-22749158 AGTAGGAAGGAGAGTGGGGATGG + Intronic
1037958183 8:23074916-23074938 AGAGAGAAGGAGAATGAGAAGGG - Intergenic
1037965975 8:23134562-23134584 AAGAAGAGGGAGAATGGAGAAGG + Intergenic
1038163173 8:25059887-25059909 ACAAGATAGGAGAATGAGGAAGG - Intergenic
1038284992 8:26198582-26198604 AAAAAGAAGGAGGAGGAGGAGGG - Intergenic
1038573221 8:28681166-28681188 AAAAAGAAGGAAAATTGGCAAGG - Intronic
1038865220 8:31432352-31432374 ACAAAGCTTCAGAATGGGGAAGG - Intergenic
1039027765 8:33276805-33276827 TCAAAAAGGGGGAATGGGGAGGG - Intergenic
1039131808 8:34273390-34273412 ACCAAGAAGGGGAGGGGGGAGGG - Intergenic
1039611267 8:38921219-38921241 ACAAAGGAGGAGAATGGAGAGGG - Intronic
1039763358 8:40601520-40601542 AGAAAGAGGGAGAAAGGGGAAGG + Intronic
1040770548 8:50970129-50970151 CCACAGAATGAGAAGGGGGAAGG + Intergenic
1040863592 8:52025114-52025136 AGTAAGCAAGAGAATGGGGAAGG - Intergenic
1040947466 8:52898421-52898443 ACCAAAAAGGATAATGGAGAAGG - Intergenic
1041242911 8:55863639-55863661 AAAAAGAAAGAGAAGAGGGAAGG + Intergenic
1041264610 8:56052169-56052191 ACACAGAATGAGCCTGGGGATGG + Intergenic
1041267603 8:56080326-56080348 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1041267607 8:56080332-56080354 AAGAAGAAGGAGGAGGGGGAGGG + Intergenic
1041321185 8:56614131-56614153 AAAAAGAAGAAGAAAGTGGAAGG - Intergenic
1041622978 8:59994930-59994952 ACAGAGAAGGAAAATAAGGAGGG - Intergenic
1041633573 8:60116613-60116635 ATAAAAAAGGAGAATGAGGGTGG - Intergenic
1042130429 8:65582486-65582508 AAGAAGGAGGAGAAGGGGGAGGG + Intergenic
1042161373 8:65899298-65899320 ACATAAAAGGAGAATGGGCCAGG - Intergenic
1042305626 8:67328852-67328874 AGAAAGAAGGAGAATCCGGTAGG + Intronic
1042415690 8:68515300-68515322 AGAAAGAAGGAAAAAAGGGAGGG - Intronic
1042601726 8:70505622-70505644 ATAAAGAGGGAGGAAGGGGAAGG - Intergenic
1042934694 8:74046886-74046908 AAAAAGAATGAGAATGAGAATGG - Intergenic
1044367807 8:91370075-91370097 AGAAAGAAAGAGAAGGGAGAAGG - Intronic
1044501492 8:92964091-92964113 ACAAAAAAGTACAATGGGAAAGG + Intronic
1044878997 8:96702766-96702788 TTACAGAAGGAGAAAGGGGAGGG - Intronic
1045009234 8:97943382-97943404 ACAGAGAAGGAGAAGGAGAAAGG - Intronic
1045322018 8:101089302-101089324 AGAAGGAAGGAGGATGGGGTAGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046230123 8:111345290-111345312 AAAAAGAAGAAGAAAGAGGAAGG + Intergenic
1047107494 8:121749296-121749318 ACAAATAAGCAGGAGGGGGAAGG + Intergenic
1047157162 8:122332282-122332304 AAAGAGAAGGAGAGTGGGGGTGG - Intergenic
1047188751 8:122659103-122659125 ACAAAGAAGGATGATGTGCAAGG - Intergenic
1047236623 8:123047454-123047476 AGAAAGAAAGAGGAAGGGGAGGG - Intronic
1047338789 8:123960173-123960195 TCAAAGAACGAGAAAGTGGAAGG + Intronic
1047512962 8:125529517-125529539 ACAAAGAAGGAAGATGGGTCTGG - Intergenic
1047542005 8:125776930-125776952 ACAAGAAAGGAGAATGTGCATGG - Intergenic
1047583182 8:126239376-126239398 ACAAAGAAGGTAAGTGGGGTGGG + Intergenic
1047642723 8:126837826-126837848 GCAACCAAGGAGAAAGGGGAAGG + Intergenic
1047701389 8:127452689-127452711 GAAAAGCAGGAGAAAGGGGAAGG + Intergenic
1047830850 8:128628144-128628166 AGAGGGAAGGAGGATGGGGAAGG - Intergenic
1047852312 8:128870367-128870389 AGAAAGAAGGAAAGAGGGGAAGG - Intergenic
1047928119 8:129701013-129701035 GCAAAGAGGGAGAAGGGGTAGGG - Intergenic
1048162886 8:132037382-132037404 ACACACAATGAGAGTGGGGAGGG - Intronic
1048779024 8:137980855-137980877 AAAATGAAGGAGAGTGGGGTTGG - Intergenic
1048852224 8:138656186-138656208 AAACAGAAGGAGAGTAGGGATGG - Intronic
1049132174 8:140855835-140855857 ACAGAGAAGGATGGTGGGGATGG + Intronic
1049397707 8:142409282-142409304 AAAGAGAAGGAGAGAGGGGAAGG + Intergenic
1049521441 8:143093429-143093451 ACAAAGAAAGAGGAGGGTGACGG - Intergenic
1049688489 8:143948761-143948783 ACAAGGAAGGAGAAAAAGGAGGG + Intronic
1050241327 9:3638696-3638718 ACAAAGAGAGAGAAGGGTGAGGG + Intergenic
1050358547 9:4805390-4805412 AAGAAGAAGGAGAAGGGGAAGGG + Intronic
1050451158 9:5782702-5782724 ACAAAAACAAAGAATGGGGAAGG + Intronic
1050475928 9:6041041-6041063 AGAAGGAAGGAGAAAGAGGAAGG - Intergenic
1051072405 9:13187562-13187584 AAAAAGAAAGAGAAGGAGGAGGG - Intronic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1051662117 9:19435409-19435431 ACACAGAAGGAAAAAGAGGAAGG + Intronic
1052294100 9:26878597-26878619 AGGAAGATGGAGAATGGGAAGGG - Intronic
1052439771 9:28481070-28481092 ACAAGGTTGGAGAATGGGCATGG + Intronic
1052520463 9:29541490-29541512 AGAGAGAAGGAGAAAAGGGAGGG - Intergenic
1052774939 9:32723873-32723895 ACAATGACAGAGAAGGGGGAGGG - Intergenic
1052917482 9:33934669-33934691 ACAAACAAACAAAATGGGGAGGG + Intronic
1052976791 9:34417057-34417079 AAGAAGAAGGAGAAGGGGAAGGG - Intronic
1053378318 9:37627218-37627240 ACAAAGAAGGAGGAAGATGAGGG - Intronic
1053512535 9:38700873-38700895 TCAGAGAAGGAGGCTGGGGATGG - Intergenic
1054488587 9:65752154-65752176 ACAAAGAAAGAAAAAGAGGAAGG + Intergenic
1054598817 9:67098261-67098283 AGAAAGAAGGGGAAAAGGGAGGG - Intergenic
1054820280 9:69515227-69515249 AGAAAGAATGGGAATGTGGAGGG - Intronic
1054866953 9:70012734-70012756 TCAGAGAAGGAGAAAGGGGGAGG - Intergenic
1055048777 9:71958714-71958736 GGAAAGAAAGAGAAAGGGGAGGG - Intronic
1055307371 9:74943688-74943710 TCTTAGAAGCAGAATGGGGATGG - Intergenic
1055410318 9:76021935-76021957 TCAAAGAAAGAGAAAGAGGATGG - Intronic
1055477595 9:76678373-76678395 AAAAGGAAGGAGAAAGGGAAAGG + Intronic
1055576583 9:77666025-77666047 ACCAAGAAGAAGGAAGGGGAAGG - Intergenic
1055811603 9:80155323-80155345 ACAAAGAATGAAAGTGAGGAGGG - Intergenic
1055897712 9:81198529-81198551 AAAAAGGAGGAGAAGGAGGAAGG + Intergenic
1056112283 9:83407917-83407939 AAAGAGAAAGAGAAAGGGGAGGG - Intronic
1056499407 9:87193070-87193092 AGAAAGAGGGAGAATGGGCAGGG + Intergenic
1056691093 9:88809223-88809245 ACAGAGCAGGAGAGCGGGGAGGG - Intergenic
1056691297 9:88810857-88810879 AAAAACAAGGAGGAAGGGGAAGG - Intergenic
1057777942 9:98026056-98026078 AGAAAGAAAGAAATTGGGGAAGG + Intergenic
1057869202 9:98706122-98706144 AAAAAGAAGGAGGAGGAGGAGGG + Intronic
1057937664 9:99254237-99254259 AACTAGGAGGAGAATGGGGAGGG - Intergenic
1058535355 9:105953904-105953926 ACCAAGAAAGACAATGGGGCAGG - Intergenic
1058579319 9:106437639-106437661 AGAAAGAAGAAGAAGGGGGGAGG - Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058748535 9:108016006-108016028 GCAAGGAAGGGGGATGGGGAGGG - Intergenic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059058110 9:111005570-111005592 AAAAAAAAGAAGAATTGGGAAGG + Intronic
1059185058 9:112260620-112260642 ACTAAGCAGGGGAATAGGGAAGG + Intronic
1059370650 9:113830609-113830631 AAAAAGAAGAATAAAGGGGAAGG + Intergenic
1059433957 9:114265489-114265511 GCAAAGAAGCAGAAGAGGGAAGG - Intronic
1059592491 9:115677250-115677272 GCAAAGAGGGATCATGGGGATGG - Intergenic
1059625954 9:116066296-116066318 AGAAAGAAGCAGAATTGGGCAGG - Intergenic
1059694317 9:116716237-116716259 AGGAAGACGGAGAGTGGGGATGG + Intronic
1059900066 9:118914466-118914488 AGAAAGAAGGAAAGTGGGGATGG - Intergenic
1060035196 9:120249418-120249440 ACAAAGCAGCAGTTTGGGGAGGG - Intergenic
1060183084 9:121547193-121547215 ACAAAGGAGGGGGAGGGGGAGGG - Intergenic
1060533377 9:124363047-124363069 ACAAAGATGGAGAAGGTGTAGGG - Intronic
1060674322 9:125498817-125498839 AAAGGGAAGGAGAGTGGGGAGGG - Intronic
1060701137 9:125748915-125748937 ACAAACAAGGCGAAAGGAGAGGG - Intronic
1060839516 9:126782661-126782683 AAAAGGAGTGAGAATGGGGAGGG + Intergenic
1061141546 9:128770590-128770612 AGAAGGAAGGACCATGGGGAAGG - Intronic
1061380020 9:130250107-130250129 AGAAAGAAGGGGAAGGGGAAGGG - Intergenic
1061404100 9:130384193-130384215 ACACAGAAGGACACTGGGTAGGG - Intronic
1061510021 9:131054757-131054779 AAAAAGAAAGAGAGAGGGGAAGG + Intronic
1061733872 9:132638777-132638799 AGCAAGAAGGAAAATGGGGTGGG + Intronic
1061739094 9:132686448-132686470 ACAAAGGAGGAGGTTGGGGAAGG - Intronic
1062050630 9:134444725-134444747 AGAAGGAAGGAGAAGGGGGAAGG - Intergenic
1062638357 9:137503420-137503442 AGAAAGAAGGAGAATGAGGAGGG + Intronic
1203490551 Un_GL000224v1:100867-100889 AGGAAGGAGGAGAATGTGGAAGG + Intergenic
1203503174 Un_KI270741v1:42746-42768 AGGAAGGAGGAGAATGTGGAAGG + Intergenic
1185472169 X:390535-390557 ATAAAAAGCGAGAATGGGGAGGG + Intergenic
1185545438 X:940231-940253 AGAAAGAAGGAGAGAGGAGAGGG - Intergenic
1185716444 X:2346602-2346624 ACAAACAGGAAAAATGGGGAGGG - Intronic
1185861260 X:3581705-3581727 AGAAAGAAGGGGAATGATGAAGG + Intergenic
1186026494 X:5319377-5319399 CCAAGCAAGGAGAATGGGGCAGG + Intergenic
1186068292 X:5790140-5790162 AGAAAGAAAGAGAAAGAGGAAGG + Intergenic
1186677594 X:11835380-11835402 AGAAAGAAGGAGATGGAGGAGGG - Intergenic
1187025685 X:15433659-15433681 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025690 X:15433682-15433704 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025695 X:15433705-15433727 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025700 X:15433728-15433750 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025705 X:15433751-15433773 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025710 X:15433774-15433796 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025715 X:15433797-15433819 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025720 X:15433820-15433842 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025725 X:15433843-15433865 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025734 X:15433886-15433908 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025752 X:15433955-15433977 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025770 X:15434041-15434063 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025791 X:15434127-15434149 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187029300 X:15469322-15469344 AGAAAGAAAAAGAAAGGGGAGGG - Intronic
1187254748 X:17632145-17632167 AAAGAGAAGGAGAATGTGGAAGG + Intronic
1187328600 X:18315123-18315145 AAAAAGTAGAAGAATGGAGAAGG + Intronic
1187416138 X:19094900-19094922 AAAAAGAAGGAGAAAGTGGACGG - Intronic
1187540553 X:20189165-20189187 AAAAACAAGGAGTATGGGGAAGG - Intronic
1187685407 X:21810969-21810991 AAAAAGAAAGAGAATGGGCTGGG - Intergenic
1187877475 X:23816257-23816279 ATAAATAAGGTAAATGGGGAAGG - Intergenic
1188416876 X:29945961-29945983 ACAAAGAATGAGTATGGGCGGGG - Intronic
1189289094 X:39872740-39872762 ACAAAGAAGGGAAAAGAGGAGGG - Intergenic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189332977 X:40154413-40154435 ACAAAGGGGGAGGAGGGGGACGG - Intronic
1189423902 X:40881264-40881286 AGAAAGAAGGAAGCTGGGGAGGG + Intergenic
1189732694 X:44038098-44038120 ACAATGAAGAAGAATGGCAAGGG + Intergenic
1190048705 X:47133146-47133168 AAAAAGAAGTAGACTGGGGCCGG + Intergenic
1190054651 X:47174630-47174652 CCAAAGAAGGAGGGAGGGGATGG - Intronic
1190220090 X:48507337-48507359 ACAGAAAAGGACAATGGAGACGG + Intergenic
1190245420 X:48687540-48687562 ACAGACAAGGTGGATGGGGATGG + Intronic
1190636729 X:52442133-52442155 AGAAAGAAAGAGAATGAGAAAGG - Intergenic
1190712219 X:53079194-53079216 ATAAAGAAGGGAAAGGGGGATGG - Exonic
1192095669 X:68207975-68207997 AGAAAGAAGGAAAAGGAGGAAGG - Intronic
1192286717 X:69746139-69746161 AGAAAGAAAGAGAATGAGAAAGG - Intronic
1192433879 X:71130319-71130341 ACAAACAAGGATATAGGGGAGGG + Intronic
1192475737 X:71440911-71440933 AGAAAGAAGGAGAAAGAAGAAGG - Intronic
1193053134 X:77122878-77122900 ACAGAGAACAAGAATGGGAATGG + Intergenic
1193448037 X:81629295-81629317 AGAAAGAAAGAGAGTGAGGAAGG - Intergenic
1193574698 X:83183636-83183658 ATAAAATAGGAGAATGGGAAAGG - Intergenic
1193588198 X:83353661-83353683 AAAAAGGAGGAGAATGAGAATGG + Intergenic
1193940536 X:87676616-87676638 AGAAAGAGAGAGAAAGGGGAAGG + Intergenic
1195385883 X:104313284-104313306 ACAAAGAGGGAGGAAGGTGAAGG - Intergenic
1195604572 X:106790446-106790468 AGGAAGAAGGAAAATGGAGATGG - Intronic
1195969393 X:110457351-110457373 AAAAAGAAGAAGAATGGCTAGGG - Intergenic
1196188347 X:112768945-112768967 ACAAAGTAGGAGAATGGAGTAGG + Intergenic
1196945346 X:120818990-120819012 ACAAAGAAAGAGACTTGGGAAGG + Intergenic
1197171915 X:123444147-123444169 ACAAAGAAGGAGGGAGGGGGAGG - Intronic
1197209441 X:123816798-123816820 AAAAAGAAGGAAGTTGGGGAAGG + Intergenic
1197289066 X:124632556-124632578 AGAGAGAAGGAGAAGAGGGATGG - Intronic
1197436560 X:126435651-126435673 ACAAAGAATGAGAATGTTGGAGG + Intergenic
1197719973 X:129738593-129738615 AAAAAGGAGGAGGATGAGGAGGG + Intergenic
1198162998 X:134026073-134026095 AAAAAGAAGGCGAATGTGGGTGG + Intergenic
1199108451 X:143900900-143900922 GCTAAGAAGGATAGTGGGGAGGG + Intergenic
1199191294 X:144974471-144974493 AGAAAGAGGGATGATGGGGATGG - Intergenic
1199427271 X:147717471-147717493 GCAGAGAAGGAGTATGGGGTGGG - Intergenic
1199690172 X:150303742-150303764 GCAAAGATGGAGGAGGGGGATGG - Intergenic
1199783170 X:151081949-151081971 ACACAGAAGGAGAATGGAGAAGG + Intergenic
1199855566 X:151756325-151756347 ACAAAGAATGACATGGGGGAAGG - Intergenic
1200016142 X:153165038-153165060 GGAGAGAAGGAGAGTGGGGAGGG + Intergenic
1200287013 X:154832740-154832762 TCAAATAAGGAGACTGGGGGAGG - Intronic
1200585284 Y:5000222-5000244 ACAGAGGGGGAGAAAGGGGAAGG - Intronic
1200683839 Y:6243647-6243669 ACCAAGAAGGAGAAAGAGTATGG + Intergenic
1200979513 Y:9248796-9248818 TCCAAGAAGGAGAAAGAGGATGG + Intergenic
1201048796 Y:9910739-9910761 ACCAAGAAGGAGAAAGAGTATGG - Intergenic
1201062324 Y:10058717-10058739 TCCAAGAAGGAGAAAGAGGATGG - Intergenic
1201195075 Y:11485302-11485324 AAAAAGGAGGAGGAGGGGGAGGG + Intergenic
1201253854 Y:12088120-12088142 ACAAAGAAAGAGAGAGGGGAGGG - Intergenic
1201385495 Y:13436006-13436028 ACCCAGAAGGTGAATGGGGGCGG + Intronic
1202115245 Y:21465551-21465573 ACTAAGAAGGAGAAAGAGGATGG + Intergenic