ID: 945958150

View in Genome Browser
Species Human (GRCh38)
Location 2:216105488-216105510
Sequence GTGGTGATGGTATGTGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 309}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945958150 Original CRISPR GTGGTGATGGTATGTGTGTT GGG (reversed) Intergenic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900187461 1:1339086-1339108 CTGCTCATGGTCTGTGTGTTGGG - Intronic
900514873 1:3076889-3076911 GGGGTGATGGTGGGTGTTTTTGG + Intronic
900881795 1:5386927-5386949 GTGTGTATGGTATGTGTGTGTGG + Intergenic
901117386 1:6858467-6858489 GTGGTGTGTGTGTGTGTGTTGGG + Intronic
901312070 1:8277086-8277108 GTGGTGTGTGTATGTGTGTGTGG - Intergenic
901850067 1:12009388-12009410 GTGGTGATGCTGAGTGTGTTTGG + Intronic
902385212 1:16072425-16072447 GTGGTGGTGGTCAGTGGGTTTGG + Intronic
902751060 1:18511431-18511453 GTGGTGTGTGTGTGTGTGTTTGG + Intergenic
903673881 1:25052476-25052498 GGGGTGATGGCATGTGAATTTGG - Intergenic
904559658 1:31387903-31387925 GTGGTGAGGATATGTGGGTGAGG - Intergenic
905259669 1:36708570-36708592 TTGTTGATGGCATGTGTGTTGGG + Intergenic
905906509 1:41621969-41621991 ATGATGATGGTCTGTGTGTTTGG - Intronic
906138834 1:43521097-43521119 GTGTTGGTGGCATGTGTGTGGGG + Intergenic
906201759 1:43965080-43965102 GTGTTGGAGGTGTGTGTGTTGGG + Intronic
906655662 1:47546531-47546553 GTGGTGATGGCAGGTTTGTGTGG + Intergenic
906706611 1:47899693-47899715 GTGGTGGTGGTGTGTGTGGTGGG + Intronic
908162555 1:61425041-61425063 GTGGTAATAGTATTTGTTTTAGG - Intronic
910239333 1:85069534-85069556 GTGGTGATGGTGTGTGCGTGGGG + Intronic
913129455 1:115826819-115826841 GAGGTGATGGTGGGAGTGTTAGG - Intergenic
913662630 1:121018231-121018253 GTGGTGAGGATAAGTGTGCTAGG - Intergenic
914014017 1:143801492-143801514 GTGGTGAGGATAAGTGTGCTAGG - Intergenic
914163806 1:145159705-145159727 GTGGTGAGGATAAGTGTGCTAGG + Intergenic
914652635 1:149710048-149710070 GTGGTGAGGATAAGTGTGCTAGG - Intergenic
915051962 1:153084522-153084544 GTGTTGTTGGTATGTGGGTAGGG - Intergenic
915943536 1:160134212-160134234 GTGGGGATTGTGTGTGTGTGAGG - Intronic
916209518 1:162348776-162348798 GGGGTGATGGAAATTGTGTTAGG + Intronic
916364370 1:164007518-164007540 GTGGTGAAGTTAGGTGAGTTAGG - Intergenic
916519138 1:165547562-165547584 TTTGTGATTGTATGTGTGTATGG - Intronic
917486406 1:175458978-175459000 GTGGTGATGGTTTGGTTGTGTGG - Intronic
919343637 1:196346675-196346697 GTTGTGTTGGTATGATTGTTGGG + Intronic
920989167 1:210919942-210919964 GTCCTGCTGGTGTGTGTGTTTGG - Exonic
921655643 1:217733429-217733451 GAGGTGATGGTATTGGAGTTGGG - Intronic
922466502 1:225848617-225848639 GTGTTAATAGTCTGTGTGTTTGG - Intronic
922629030 1:227085164-227085186 GTGGTATATGTATGTGTGTTGGG - Intronic
922820130 1:228479072-228479094 GTGGCGATGGTATCTGTGCAAGG + Intergenic
922869602 1:228891449-228891471 TTGCTGATGGTGTGGGTGTTTGG + Intergenic
923022896 1:230178683-230178705 GAGGAGGTTGTATGTGTGTTGGG - Intronic
924077068 1:240350838-240350860 GTGGTGAGAGTATGTCTGGTGGG + Intronic
1063623901 10:7671802-7671824 GAGGGGATGGTATGTATGTTGGG + Intergenic
1064012728 10:11748031-11748053 TTTGTGATGCTATGTTTGTTTGG + Intronic
1064655761 10:17554044-17554066 GTGGTGATGTTAGGTATGGTGGG - Intergenic
1065785159 10:29206099-29206121 GTGGTGATGGTATGAGGGAGTGG - Intergenic
1066046407 10:31599267-31599289 CTGATGATCGTAAGTGTGTTAGG - Intergenic
1068199323 10:53762865-53762887 GTGGTGCTGGTATCTGTTTCTGG - Intergenic
1068964031 10:62894056-62894078 GTGAAGAGGGTAAGTGTGTTGGG - Intronic
1070765455 10:79053693-79053715 GTGTGTGTGGTATGTGTGTTGGG + Intergenic
1074757999 10:116641533-116641555 GTGAGGATGGGGTGTGTGTTGGG - Intronic
1075224910 10:120620082-120620104 TTGGTTGTGCTATGTGTGTTCGG - Intergenic
1075391526 10:122096014-122096036 GTGGTGAGGCTCTGTGTGTGAGG + Intronic
1075580932 10:123617875-123617897 GAGGGGGTGGTATGTGTGTTTGG - Intergenic
1076482080 10:130791559-130791581 GTGGTGGGGGAATGTGTGATAGG - Intergenic
1077020373 11:414522-414544 GTGGTAATGGGAGGTGTGTGTGG - Intronic
1078065753 11:8078224-8078246 GTGGTGATGAAATGTTTGTGAGG - Intronic
1078497785 11:11837610-11837632 GTGGAGAGGGTGTGTGTGTAGGG + Intergenic
1079184370 11:18222846-18222868 GTGGTGTGTGTATGTGTGTGTGG + Intronic
1080719806 11:34837900-34837922 GTGGTGATGGTGGTGGTGTTGGG - Intergenic
1080976374 11:37345687-37345709 GAGGTGATTGCATGTGTTTTGGG + Intergenic
1083244687 11:61417292-61417314 GTGGTGATGGTGTTCCTGTTAGG - Intronic
1084373440 11:68760166-68760188 GTGGTGATGGGATGGGTAATGGG - Intronic
1086961428 11:92982811-92982833 GTTGTGATTGTGTGTGTGTAGGG - Intronic
1089685711 11:120145417-120145439 GTGGGGAGGTTATTTGTGTTAGG + Intronic
1090383250 11:126341649-126341671 GTGGTGAAGGTGTATGTTTTCGG - Intronic
1091061736 11:132469814-132469836 GTGGTGTGTGTATGTGTGTGGGG + Intronic
1091117484 11:133027599-133027621 GTGTGCATGGTGTGTGTGTTTGG + Intronic
1091316283 11:134616167-134616189 GTGGTGGTTGTGTGTGTGTAGGG + Intergenic
1092303081 12:7271085-7271107 GTTGGCATTGTATGTGTGTTTGG - Intergenic
1093939646 12:25039395-25039417 GTGGAGACGGTATCTGTGTAAGG - Intronic
1095049620 12:37544368-37544390 GTGGTGTGTGTGTGTGTGTTTGG + Intergenic
1095207165 12:39451442-39451464 GTGGTGGTGGTGTGTGTGTTGGG - Intergenic
1098005987 12:65997559-65997581 GTGGTGATGGGATATGTGGTGGG - Intergenic
1100697893 12:97115435-97115457 GTGGTGATGCTAGGGGTGTATGG + Intergenic
1102547175 12:113665556-113665578 ATGGAGATGGTGTGTGTGTGTGG - Intergenic
1103293653 12:119867688-119867710 GGGGTGGTGGTGTGTGAGTTTGG - Intronic
1104106508 12:125664987-125665009 CTGGTGATGAGAAGTGTGTTTGG + Intergenic
1104615802 12:130267504-130267526 GTGGGGAGTGTGTGTGTGTTCGG - Intergenic
1104942419 12:132401319-132401341 GTGATGAGTGGATGTGTGTTTGG - Intergenic
1106255436 13:28018516-28018538 GTGGTGAAGATATGTGACTTTGG - Exonic
1106555938 13:30808587-30808609 TTGCTGATGGACTGTGTGTTGGG + Intergenic
1107851152 13:44575019-44575041 GTGCTGCTGGTGTGAGTGTTGGG - Exonic
1108478799 13:50846025-50846047 GTGGGGATGTGATGTGTGATGGG - Intergenic
1108617042 13:52143393-52143415 GGGGAGGTGGTATGTGTGTGGGG - Intronic
1108801429 13:54100945-54100967 TTGTTGATGGTATGTGGTTTTGG + Intergenic
1109362263 13:61309846-61309868 ATGGTCATGATATGTATGTTTGG + Intergenic
1111981923 13:95025391-95025413 GTGGTGGGGGTATGTGTGTGGGG - Intronic
1112659193 13:101487989-101488011 GTGGTGATGGTAAGAATGCTGGG + Intronic
1113539893 13:111098369-111098391 ATGGGCAAGGTATGTGTGTTTGG - Intergenic
1115950612 14:38717165-38717187 GTTGTGATGTTCAGTGTGTTAGG - Intergenic
1116110134 14:40568392-40568414 GTGGTGTGGGTGTGTGTGTGTGG - Intergenic
1118129829 14:62950432-62950454 GTGCTCCTGGTGTGTGTGTTTGG - Exonic
1119126359 14:72130861-72130883 GTTGCATTGGTATGTGTGTTGGG + Intronic
1119269417 14:73288908-73288930 GTGGTGGTGGTGTGTGTCTGTGG + Intronic
1119443515 14:74645766-74645788 GTGGTGGTGGTGTGTATGTTAGG - Intergenic
1119793327 14:77373985-77374007 GTGGTGTTGGTATCTGTTTCTGG - Intronic
1119945883 14:78693550-78693572 TTGGGGATGATATGTGTGTTTGG - Intronic
1121508049 14:94491494-94491516 GTGGTGGTGGTGTGTGTAGTGGG + Intronic
1122176894 14:99927781-99927803 GTGGTGGTGGTATTGGTGGTGGG + Intronic
1122210070 14:100167985-100168007 GGGGTGGGGGTGTGTGTGTTGGG - Intergenic
1122210083 14:100168026-100168048 GTGTTGAGCGTGTGTGTGTTGGG - Intergenic
1122210118 14:100168159-100168181 GGGGTGGGGGTGTGTGTGTTGGG - Intergenic
1124368908 15:29092210-29092232 GGGGAGATGGTACGTGTTTTAGG - Intronic
1127548136 15:60009180-60009202 GGGGTGGAGGCATGTGTGTTTGG - Intronic
1127790496 15:62394216-62394238 GTGGTGTTGTGATGTGTGTGTGG + Intronic
1130970458 15:88728126-88728148 GTGGTGATGGTGTATGTGGTAGG + Intergenic
1131171450 15:90181749-90181771 GAGGAAAGGGTATGTGTGTTGGG + Intronic
1131389056 15:92032493-92032515 GTGGTGAGGGTGTGTATGGTCGG + Intronic
1131646049 15:94345924-94345946 GTGGTGGTGGTGTGTGTGATCGG + Intronic
1132195286 15:99909895-99909917 GTGGTGTTTGTTTGTTTGTTTGG + Intergenic
1132213118 15:100040851-100040873 TTGTTGATGGTATGTGAGTGGGG - Intronic
1133987052 16:10676577-10676599 GTGGTGGTGGTGTGGGTGTTAGG - Intronic
1136115061 16:28089213-28089235 GTGGTGTGTGTATGTGTGTGGGG - Intergenic
1136227659 16:28869797-28869819 GTGGGTCGGGTATGTGTGTTTGG - Intronic
1136400217 16:30012864-30012886 GGCGTGGTGGTATGTGTCTTGGG + Intronic
1136565001 16:31064504-31064526 GTGGCGAAGGTATGTGGCTTTGG - Intronic
1136777499 16:32879617-32879639 GTGGTGGTGGTCTGGGTGTATGG - Intergenic
1137365308 16:47854690-47854712 GTGCTGAGTGTGTGTGTGTTGGG - Intergenic
1137552968 16:49453126-49453148 GGTGGGATGGTGTGTGTGTTGGG - Intergenic
1138191853 16:55019790-55019812 GTGGTGTGTGTATGTGTGTTTGG - Intergenic
1138434763 16:56991306-56991328 GGGAAGAGGGTATGTGTGTTGGG - Intronic
1138703716 16:58892705-58892727 GTGGTGGTGGTAGCTGTGTGGGG - Intergenic
1139839649 16:69868166-69868188 GTGGTGTTTGTGTGTGTGTTGGG + Intronic
1140614268 16:76641487-76641509 GTGGTGTGTGTGTGTGTGTTGGG + Intergenic
1140768430 16:78181274-78181296 GTGGTGACGGTGTGTGTGTGGGG + Intronic
1141014047 16:80431185-80431207 TTGGTGATGGTATTTGAATTTGG + Intergenic
1141735767 16:85851564-85851586 GTGGTGATGGGGTGTGTGCAAGG - Intergenic
1141983469 16:87564515-87564537 GTGTGGATTGTGTGTGTGTTGGG + Intergenic
1142480766 17:216871-216893 GGGGTGGTGGTACGTGTGTCAGG + Intronic
1146821732 17:35988521-35988543 GGGATGATGGTGTGTGTGTTGGG + Intronic
1147440533 17:40444433-40444455 ATGGTGGTGGGGTGTGTGTTGGG + Intronic
1147572959 17:41582677-41582699 GTGTTGATGGTATCAGTGCTTGG - Intronic
1148094312 17:45041796-45041818 GTGGTGGTGGTAAGTGGGTAAGG + Intronic
1148157996 17:45434241-45434263 GTGGTGATGGTCTTTGCGTGGGG + Intronic
1148445471 17:47734454-47734476 GTGGTGGTGGTGTGTGTGTACGG + Intronic
1148812380 17:50301868-50301890 GAGGTGAGGGTGTGGGTGTTGGG - Intergenic
1148815794 17:50327103-50327125 GTGGAGGTGGTTTGTGTGTTAGG - Intergenic
1148896429 17:50841782-50841804 GGGATGAGGGTATCTGTGTTGGG - Exonic
1149060751 17:52418885-52418907 TTGGTGATGCTATCTGTGTTAGG - Intergenic
1149567318 17:57649547-57649569 GTGTTAAGTGTATGTGTGTTGGG - Intronic
1150389597 17:64782510-64782532 GTGGTGATGGTCTTTGCGTGGGG + Intergenic
1152217636 17:79043591-79043613 GTGTGGATTGCATGTGTGTTGGG + Intronic
1152436799 17:80281281-80281303 GTGTGGAGGGTATGTGTGTGGGG - Intronic
1154290945 18:13106285-13106307 GTGGTGGTGGTAGTTGTGTGGGG - Intronic
1154291002 18:13106574-13106596 GTGGTGGTGGTAGCTGTGTGGGG - Intronic
1154291018 18:13106654-13106676 GTGGTGGTGGTACCTGTGTGGGG - Intronic
1154291031 18:13106737-13106759 GTGGTGGTGGTAGCTGTGTGGGG - Intronic
1155234979 18:23810243-23810265 GTGGAGCTGGAATTTGTGTTTGG + Intronic
1157791446 18:50535238-50535260 GTGGTGTGGGGGTGTGTGTTGGG + Intergenic
1158959037 18:62572607-62572629 GTAGTGATGGTATTTCTGTTTGG + Intronic
1159369515 18:67513314-67513336 AAGGTGTTGGTCTGTGTGTTTGG + Exonic
1159880876 18:73857440-73857462 GTGGAGGTGGTAAGTGTGTGAGG - Intergenic
1160027864 18:75233485-75233507 ATGCCGATGTTATGTGTGTTGGG + Intronic
1161666839 19:5582331-5582353 GTGGTGAAGGGATAGGTGTTTGG - Intergenic
1161827003 19:6574635-6574657 GGGAAGATGCTATGTGTGTTAGG - Intergenic
1162065621 19:8123698-8123720 CTGGAGATGGGAAGTGTGTTTGG - Intronic
1163513448 19:17749110-17749132 TGGGTGATGGTATGTGGGTCAGG - Intronic
1163637099 19:18442028-18442050 GTGTTGGGGGTGTGTGTGTTGGG - Intergenic
1164825008 19:31278486-31278508 GTTGTGATGGTAGGTGTGACAGG + Exonic
1166474862 19:43114819-43114841 GAGGTATTGGAATGTGTGTTTGG + Intronic
1166503599 19:43358125-43358147 GTGTTCATGGTATGTTTGTGTGG - Intronic
1166506855 19:43376636-43376658 GTGTTCATGGTATGTTTGTGTGG + Intergenic
1167033400 19:46978497-46978519 GTGGTGGTGGCGTGTGTGATGGG + Intronic
1168667930 19:58218338-58218360 GTGATGATGGTAGGGGTGCTGGG + Intergenic
925090874 2:1155254-1155276 GGGGTGTGGGTATGTGTGTGTGG - Intronic
925848050 2:8051749-8051771 GTGATGAGGGTATCTGTGTGTGG + Intergenic
925923633 2:8654888-8654910 TAGGAGATGGTAGGTGTGTTGGG - Intergenic
926839582 2:17064608-17064630 GTGGTGATGGGGTGGGTGGTAGG + Intergenic
927245490 2:20954284-20954306 GTGGTGTGTGTATGTGTGTTGGG + Intergenic
927554430 2:24022258-24022280 GTGGTGTTTGTATCTGTGTTGGG + Intronic
929009269 2:37424903-37424925 ATGGTCCTGGTGTGTGTGTTGGG + Intergenic
929039496 2:37729862-37729884 GTGGTGGTGGTGTGTCTGTTAGG - Intronic
930137403 2:47916068-47916090 GTGGTGGTAGGATTTGTGTTTGG + Intergenic
932262795 2:70341414-70341436 GGAGTGATGGGAAGTGTGTTGGG + Intergenic
932424024 2:71617942-71617964 GTAGAGGTGGTGTGTGTGTTTGG + Intronic
932707415 2:74037482-74037504 GAGCTGGTGGTATGTGTGGTTGG + Intronic
935962709 2:108443339-108443361 TTGGTTATTGTTTGTGTGTTTGG - Intergenic
937896251 2:126978728-126978750 GTGGTCATGGTAAGTGTGGCAGG + Intergenic
942966319 2:181896956-181896978 GAGCTGAAGGTATGTTTGTTTGG + Exonic
945958150 2:216105488-216105510 GTGGTGATGGTATGTGTGTTGGG - Intergenic
946140344 2:217685114-217685136 GTGGTGTGTGTATGTGTGTGGGG + Intronic
947919683 2:233858671-233858693 GTGGTGAGGGTCTGAGTGATTGG + Intergenic
948563824 2:238871075-238871097 GGGGTGATGGTGTGTGTGGGGGG - Intronic
948563943 2:238871652-238871674 GGGGTGATGGTGTGTGTGGGGGG - Intronic
948569506 2:238909038-238909060 GTGGTTGTGGTATGTGTATGTGG + Intronic
948985050 2:241516458-241516480 GTGCTGGGGGTGTGTGTGTTGGG - Intergenic
948985170 2:241517217-241517239 GTGTTGGTGTTGTGTGTGTTGGG - Intergenic
949043835 2:241861236-241861258 TTGGAGATTGTGTGTGTGTTGGG - Intergenic
949050894 2:241896709-241896731 GTGTTGGGGGTGTGTGTGTTGGG + Intronic
1170428531 20:16258237-16258259 TTGGGGATGGGGTGTGTGTTTGG - Intergenic
1171354033 20:24529941-24529963 ATGGTGATGGTGTCAGTGTTGGG + Intronic
1171354041 20:24529983-24530005 GTGGTGATGGTGTCAGTGGTGGG + Intronic
1172635581 20:36407695-36407717 GAGGAGATGGTGTGTGTGCTGGG + Intronic
1172936992 20:38627506-38627528 TGTGTGTTGGTATGTGTGTTGGG + Intronic
1173069036 20:39743655-39743677 GTGGTAATTGTATGTGTGTCTGG + Intergenic
1173897938 20:46564976-46564998 GTGCTGCAGGTATGTGTGCTGGG + Intronic
1177303436 21:19281411-19281433 GGTTTGATGTTATGTGTGTTAGG + Intergenic
1177932983 21:27308197-27308219 GTGGTGATGGTAAGGGTGGGGGG + Intergenic
1178115472 21:29412300-29412322 CTGGTGATAATATGTGTGCTGGG + Intronic
1179393237 21:41013028-41013050 GTGGGGAATGTGTGTGTGTTGGG - Intergenic
1179532118 21:42026871-42026893 GTGGTGTGTGTATGTGTGTGTGG + Intergenic
1179532191 21:42027457-42027479 GTGGTTGTGGTGTGTGTGTAGGG + Intergenic
1183976431 22:41515069-41515091 GTCATGGTGGTATGGGTGTTTGG + Intronic
1184382550 22:44154858-44154880 GTGGTGGGGGTGTGTGTGTGTGG + Intronic
1184796588 22:46736801-46736823 GTGGTGAGGATCTGTGGGTTGGG - Intronic
949267686 3:2178139-2178161 GTGTTGAAGGTATTTGTGTAAGG + Intronic
950627072 3:14255060-14255082 GGGGGGATTGTGTGTGTGTTGGG + Intergenic
950627137 3:14255568-14255590 GTTTTGAGGGTATGTGTGTTGGG + Intergenic
950891762 3:16410404-16410426 GTGGTGATGGTATGGGTGTGGGG + Intronic
951039406 3:17972258-17972280 GTGGGTATGGTGTGTGTGTGTGG + Intronic
953681111 3:45039094-45039116 GTGCTAATGGTAATTGTGTTAGG + Intergenic
956108227 3:65844083-65844105 GTGGAGTTGGTAGGTGTGTCTGG + Intronic
957181412 3:76883048-76883070 GTGATGATGGTGTTTTTGTTTGG - Intronic
959636792 3:108583602-108583624 GTGGTGATGGGAGGTGTGAGGGG + Intronic
960753612 3:120983388-120983410 GTGGTGGTGGTATCTGTTTTTGG + Intronic
961928362 3:130507321-130507343 GTGGTTGTAGTATGTGTTTTAGG - Intergenic
962827723 3:139112115-139112137 GTGGTGTGCGTGTGTGTGTTGGG + Intronic
965570619 3:170168456-170168478 GTGGTGATTTTATGATTGTTTGG - Intronic
965732544 3:171787662-171787684 GTGGTATGTGTATGTGTGTTGGG + Intronic
965783289 3:172310578-172310600 GTGGTGGTGGTAGGTAGGTTTGG + Intronic
965899844 3:173625346-173625368 GTAGTGGTGGTACGTGTGCTGGG - Intronic
966427599 3:179796595-179796617 GAGTTCATGGTATGTGTGTGAGG + Exonic
966623072 3:181986632-181986654 GTGGTGATGCTACGAGTGGTAGG - Intergenic
967089818 3:186125947-186125969 GTGGTGATGGTATGTTTGTGTGG + Intronic
967089837 3:186126088-186126110 GTGATGGTGGTATGTTTGTGTGG + Intronic
967089851 3:186126174-186126196 GTGGTGATGGTATGTTTGTGTGG + Intronic
967089871 3:186126312-186126334 GTGATGGTGGTATGTTTGTGTGG + Intronic
967117507 3:186355224-186355246 GCGGTGATGGTAGTTGTGTGGGG - Intronic
967117523 3:186355309-186355331 GTGGTGATGGTAGTGGTGGTGGG - Intronic
967287166 3:187883750-187883772 GTTGTGTGGGTATGTGTGTTGGG - Intergenic
968067691 3:195767861-195767883 GTGGTGATGGTGGTGGTGTTGGG - Intronic
968977352 4:3828896-3828918 GTGGTGAGGGCATTTGTGGTTGG + Intergenic
969914582 4:10477543-10477565 GTGGCAGTGGTATGTGTGTTGGG - Intergenic
970271743 4:14355352-14355374 ATGGGGATGATACGTGTGTTAGG + Intergenic
972249243 4:37281697-37281719 GTGGAGATGGTATTTGAGCTAGG + Intronic
972516202 4:39812808-39812830 GTGGTGATTGTGTGTGGGTGTGG + Intergenic
972516427 4:39814287-39814309 GTTGTGATTGTATGTGGGTGTGG + Intergenic
972516449 4:39814417-39814439 GTGGTGATTGTGTGTGAGTGTGG + Intergenic
975176601 4:71296683-71296705 GTGGTTAACTTATGTGTGTTTGG + Intronic
977633326 4:99267910-99267932 GTGGTGATGGCATGACTTTTGGG + Intergenic
978582904 4:110249894-110249916 GTGGTGGTGGTTTGTGGGTGAGG + Intergenic
979297669 4:119051956-119051978 GTGCTGAAGATGTGTGTGTTTGG + Intronic
979479571 4:121200532-121200554 CTGGTCAGGGTATGTGTGCTCGG - Intronic
980513899 4:133828050-133828072 GTGCTGATGGTTTGTCTGCTTGG + Intergenic
981048533 4:140289051-140289073 GTGTTAATGGTCTGTGTGTGAGG - Intronic
981217138 4:142183200-142183222 TTGGGGGTTGTATGTGTGTTAGG - Intronic
982221721 4:153130250-153130272 GTGGTGATGCTATTGGTGGTGGG - Intergenic
982856927 4:160395234-160395256 GTGGTGACTGTATGAGTTTTGGG - Intergenic
982943450 4:161588406-161588428 GTGTTGATGGTATCTGGGCTTGG - Intronic
984699636 4:182810420-182810442 GTGGTGAGGGTGTGTGTGTGTGG - Intergenic
986798978 5:11240298-11240320 GTGTTGGGTGTATGTGTGTTGGG - Intronic
986798982 5:11240328-11240350 GTGTTGGGTGTATGTGTGTTGGG - Intronic
986798988 5:11240393-11240415 GTGTTGTGGGTGTGTGTGTTGGG - Intronic
986799053 5:11240889-11240911 GTGCTGAGTGTATGTGTTTTGGG - Intronic
986874054 5:12084616-12084638 GGTGTGTTGGTATGTGTGCTGGG + Intergenic
987811704 5:22845248-22845270 CTGGTGATGTTATTAGTGTTAGG - Intronic
987881978 5:23759919-23759941 GTGGTCATGCTAAGTGTGTTGGG - Intergenic
988528015 5:32003315-32003337 GTGGTGGGGGTGTGTGTGTGGGG - Intronic
991595891 5:68305114-68305136 GTGGTGATGATCTGTTTCTTTGG + Intergenic
992406142 5:76459586-76459608 TAGGTGATGGTATGTGAGTGTGG + Intronic
992559251 5:77933978-77934000 GTGGTGGTGGTGTGTGTGTGTGG - Intergenic
992606552 5:78463148-78463170 GTGTCAATGGTATGTGTGTTTGG - Intronic
993770553 5:91919298-91919320 GTGGAGATGGTGTGGGTGGTGGG + Intergenic
996091994 5:119360528-119360550 ATGGTGATTCTATGTGTATTTGG - Intronic
996676370 5:126179581-126179603 GTGGTCATGGTCTTTGAGTTTGG - Intergenic
997988082 5:138520471-138520493 GTAGTGATGATAAGTGTCTTTGG - Intronic
998113432 5:139519163-139519185 GTGCAGGTGGTATGTGTGATAGG - Intergenic
998148393 5:139743422-139743444 GTGGGGGTGGAATGTGTGTTTGG + Intergenic
999104571 5:149059521-149059543 CTGCTGATGGTAGGTCTGTTAGG - Intronic
999435602 5:151561101-151561123 GTGGTGCTGGAAAGTGTGTTAGG + Intronic
1000289556 5:159857970-159857992 GTGGTGATGATGTGTGTGTGTGG - Intergenic
1000315474 5:160086379-160086401 GGTGTGATGGTATGTGTCTGTGG + Intronic
1001550165 5:172596780-172596802 GTGGTGTGTGTATGTGTGTGTGG - Intergenic
1001550200 5:172597230-172597252 GTGGTGTGTGTATGTGTGTGTGG - Intergenic
1002054691 5:176591996-176592018 GTGGTGATGGTAGTGGTGGTGGG + Intronic
1004178035 6:13357693-13357715 GTGGTGTTTGTGTGTGTGCTGGG - Intergenic
1004644371 6:17545214-17545236 GTGTTTGTGGTATGTGTGTTAGG - Intronic
1006584231 6:35095747-35095769 GTTGTGATGGTCTTTGTGCTAGG - Intergenic
1007102778 6:39261528-39261550 GTGGCAAAGGGATGTGTGTTCGG + Intergenic
1007737737 6:43992241-43992263 GTGGAGATGGGATGTGTGGCAGG + Intergenic
1007915117 6:45554120-45554142 GTGGTGTGTGTATGTGTGTGTGG + Intronic
1009477778 6:64115371-64115393 GTGGTGATGGCAGTGGTGTTTGG - Intronic
1010838462 6:80618334-80618356 GTGGTGGTGGTAGGAGTGCTGGG - Intergenic
1013837010 6:114344404-114344426 GAGGTGATGGTAAGAGTGGTGGG - Intergenic
1017427374 6:154336511-154336533 CTGGGAAGGGTATGTGTGTTGGG + Intronic
1017661430 6:156677923-156677945 GTGGGGAAGGTACGTGTGTATGG + Intergenic
1017664792 6:156709198-156709220 GTGGAGATGGGAAGTGTATTAGG + Intergenic
1017938779 6:159032642-159032664 GTAGTGCTGGTGTGTGGGTTGGG + Intergenic
1018101424 6:160444492-160444514 GAGGTGATGGAATGTGTGCCCGG - Intronic
1021338691 7:19436288-19436310 GTGGGGATGGCATGGGTTTTGGG + Intergenic
1023994918 7:45153582-45153604 GAGGTGATGGTGTGTGTGTGTGG - Intergenic
1024037049 7:45515921-45515943 GGAGTGATGGTATGTGGGGTGGG - Intergenic
1024278667 7:47699920-47699942 GTGGTGATGGTTATTGTGGTTGG - Intronic
1024713318 7:52043183-52043205 GTGGTGATGGTTCCTCTGTTAGG - Intergenic
1024936807 7:54719312-54719334 GTAGTGATGGGATGTGAGGTGGG - Intergenic
1025208676 7:57008319-57008341 GTGGTGGTGGTGGGTGGGTTGGG + Intergenic
1025663271 7:63568559-63568581 GTGGTGGTGGTGGGTGGGTTGGG - Intergenic
1026195251 7:68167520-68167542 GTGGTGACTGTGTGTGAGTTTGG + Intergenic
1026679149 7:72452119-72452141 CTGGTTATGTTAGGTGTGTTAGG + Intergenic
1028278219 7:88886203-88886225 GTGGTGATGGTAGATGGATTAGG + Intronic
1029417397 7:100451575-100451597 GTGGTGGTGGTATGTGCCTGTGG - Intergenic
1029973294 7:104810397-104810419 GAGGTGATGGTATATGTGGCAGG + Intronic
1030167375 7:106568857-106568879 GTGGTGATTTAATGTGTGATTGG + Intergenic
1030408824 7:109148311-109148333 ATCCTGGTGGTATGTGTGTTAGG + Intergenic
1032343824 7:131101195-131101217 TTTGTGCTGCTATGTGTGTTTGG - Intergenic
1032395596 7:131587325-131587347 GTGGTGCTGCAATGTGTGTGTGG + Intergenic
1032395614 7:131587572-131587594 GTGGTGCTGCAATGTGTGTGTGG + Intergenic
1032531816 7:132627177-132627199 AAGGTGATGGGATGGGTGTTGGG - Intronic
1034341582 7:150360229-150360251 GTGGTGTTTGTGTGTGTGGTGGG - Intergenic
1034858338 7:154575313-154575335 GTGGTGTGTGTATGTGTGTGTGG + Intronic
1034858339 7:154575332-154575354 GTGGTGTGTGTATGTGTGTGTGG + Intronic
1034858355 7:154575600-154575622 GTGGTGTGTGTATGTGTGTGTGG + Intronic
1035283184 7:157790089-157790111 GTGGTGGTGACATGTGTGTATGG + Intronic
1035694121 8:1581738-1581760 GTGGTGTGTGTATGTGTGTGGGG - Intronic
1036481693 8:9145833-9145855 GTAGTGATGGGATGGGTTTTTGG - Intronic
1038742782 8:30230532-30230554 GTGGAGTGGGTATGTGTGTAGGG + Intergenic
1038782404 8:30579599-30579621 GTGGGGTGGGCATGTGTGTTTGG - Intronic
1041007333 8:53508062-53508084 GTGGTGGTGGGATGGGTGGTGGG - Intergenic
1042869207 8:73382039-73382061 GTGAGGATGGTAAGTATGTTTGG + Intergenic
1042992393 8:74655728-74655750 GTATGGATGCTATGTGTGTTTGG - Intronic
1043408470 8:79964803-79964825 GTGGTCATAGTGTGAGTGTTGGG - Intronic
1044549141 8:93493041-93493063 GTGGTGAGGGCATTTGCGTTTGG - Intergenic
1044663044 8:94610206-94610228 GTGGTGAGGGGATTTCTGTTTGG + Intergenic
1045687394 8:104726446-104726468 GAAGACATGGTATGTGTGTTGGG + Intronic
1046123499 8:109875010-109875032 TTGGTTGTGGTATGTGTGTCAGG + Intergenic
1046610522 8:116418476-116418498 TTGGTAATGATGTGTGTGTTGGG - Intergenic
1046637251 8:116683603-116683625 TTGGTGATGGTACGTGTGCATGG + Intronic
1047947801 8:129899859-129899881 GTGGTGATGGCCTTTGTGTAAGG + Intronic
1048885247 8:138904336-138904358 GTGGTAAGGGTGTGTGTGTGGGG - Intronic
1053148584 9:35728620-35728642 GTCGTGATGGGATCTGTGTGGGG - Intronic
1053886773 9:42649846-42649868 GGGGTGAGGGTGTGTGGGTTAGG - Intergenic
1054225792 9:62457296-62457318 GGGGTGAGGGTGTGTGGGTTAGG - Intergenic
1054705796 9:68460863-68460885 GTGGTGATAGTGTTTGTGTGTGG + Intronic
1056116220 9:83443860-83443882 GTGGTGAGAGTATGTTTCTTTGG + Intronic
1057168509 9:92946966-92946988 GTGGTGTGTGTATGTGTGGTAGG - Intergenic
1059683025 9:116604804-116604826 GATGGGATGGTGTGTGTGTTGGG + Intronic
1059879693 9:118676939-118676961 GTGTTCATGGTGTGTGTGGTGGG - Intergenic
1060140459 9:121205194-121205216 CTGGTGATGGTGTGTCTGTGGGG - Intronic
1060551875 9:124489547-124489569 GTGGTGGGGGTCTGTGTGGTTGG - Intronic
1061996011 9:134186441-134186463 GTCTTGAGGGTGTGTGTGTTGGG + Intergenic
1188982230 X:36736718-36736740 GTGGTGATGCTGTGTGTGTATGG - Intergenic
1189659954 X:43286230-43286252 GTGGCTGTGGTATCTGTGTTTGG + Intergenic
1190481381 X:50880485-50880507 GAGGTGAGGGTGTGTGTGTGTGG + Intergenic
1190679539 X:52813103-52813125 GGGGTGGTGGTGTGTGTGTGTGG - Intronic
1193464788 X:81835191-81835213 GTGTGGATGGTATGTATGTGTGG + Intergenic
1193870543 X:86792525-86792547 CTGGGAAAGGTATGTGTGTTGGG - Intronic
1194009591 X:88544259-88544281 GTGGTGTGTGTATGTGTGTGTGG - Intergenic
1195623960 X:106988614-106988636 GTGGTGAGGGCTTTTGTGTTAGG - Intronic
1196986836 X:121282652-121282674 GTGGTGATGGGATTTGTCCTTGG + Intergenic
1198031096 X:132754295-132754317 ATGCTGATTGTATGTGTCTTTGG - Intronic
1198072936 X:133167398-133167420 GTGGGGAGGGTATGTATGTAAGG + Intergenic
1198087374 X:133293891-133293913 GTGGTGGTGGGATGGGTGTGGGG - Intergenic
1198157186 X:133972780-133972802 CTGGTGATGGTATCTCTGTCTGG - Intronic
1198558781 X:137825473-137825495 CTAATGATGGTATGTATGTTTGG + Intergenic
1200837844 Y:7750212-7750234 GTGGTGACGGTAGGTGTGTGGGG + Intergenic
1200894243 Y:8357788-8357810 GTGGTTATGTTATGTGGGATGGG + Intergenic
1201714712 Y:17031693-17031715 GAGGTAAGGGAATGTGTGTTAGG - Intergenic