ID: 945965751

View in Genome Browser
Species Human (GRCh38)
Location 2:216184881-216184903
Sequence CAGGGCATACAGAAGAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 407}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945965751_945965758 -5 Left 945965751 2:216184881-216184903 CCTCCCTTCTTCTGTATGCCCTG 0: 1
1: 0
2: 0
3: 37
4: 407
Right 945965758 2:216184899-216184921 CCCTGCATCTGAGGGAGGTGTGG 0: 1
1: 1
2: 4
3: 119
4: 992
945965751_945965762 15 Left 945965751 2:216184881-216184903 CCTCCCTTCTTCTGTATGCCCTG 0: 1
1: 0
2: 0
3: 37
4: 407
Right 945965762 2:216184919-216184941 TGGGCAGAGCTGGCTCTTGTAGG 0: 1
1: 0
2: 1
3: 33
4: 302
945965751_945965760 -4 Left 945965751 2:216184881-216184903 CCTCCCTTCTTCTGTATGCCCTG 0: 1
1: 0
2: 0
3: 37
4: 407
Right 945965760 2:216184900-216184922 CCTGCATCTGAGGGAGGTGTGGG 0: 1
1: 0
2: 0
3: 24
4: 337
945965751_945965756 -10 Left 945965751 2:216184881-216184903 CCTCCCTTCTTCTGTATGCCCTG 0: 1
1: 0
2: 0
3: 37
4: 407
Right 945965756 2:216184894-216184916 GTATGCCCTGCATCTGAGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 119
945965751_945965763 29 Left 945965751 2:216184881-216184903 CCTCCCTTCTTCTGTATGCCCTG 0: 1
1: 0
2: 0
3: 37
4: 407
Right 945965763 2:216184933-216184955 TCTTGTAGGTTGCATTTCCCAGG 0: 1
1: 1
2: 3
3: 20
4: 241
945965751_945965761 5 Left 945965751 2:216184881-216184903 CCTCCCTTCTTCTGTATGCCCTG 0: 1
1: 0
2: 0
3: 37
4: 407
Right 945965761 2:216184909-216184931 GAGGGAGGTGTGGGCAGAGCTGG 0: 1
1: 2
2: 17
3: 173
4: 1340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945965751 Original CRISPR CAGGGCATACAGAAGAAGGG AGG (reversed) Intronic
901002816 1:6157096-6157118 CAGGGAAGGAAGAAGAAGGGTGG - Intronic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
904349992 1:29898941-29898963 GAGGGCAGAGAGGAGAAGGGAGG + Intergenic
906214959 1:44033319-44033341 CAGGGAATCCATATGAAGGGAGG + Intergenic
908711930 1:67025095-67025117 CAGGTCATACGGGAGTAGGGTGG - Intronic
909477810 1:76101164-76101186 CAGGGGTTACGGTAGAAGGGAGG - Intronic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
910220051 1:84880822-84880844 CAGAGGGTACAGAAGAAGGAAGG + Intronic
910330918 1:86071855-86071877 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
910606339 1:89088831-89088853 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
911484394 1:98487553-98487575 AAGGGCATGGAGAAGAAGAGGGG + Intergenic
912235253 1:107844165-107844187 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
914320651 1:146556412-146556434 TAGAGCAAACTGAAGAAGGGTGG - Intergenic
914457972 1:147854715-147854737 GAGGGCAAGCAGAAGCAGGGAGG + Intergenic
915694912 1:157730099-157730121 GAGAACATACAGAAGAAGAGTGG + Intergenic
916215374 1:162389106-162389128 CAGTGCAAACAGTAGCAGGGAGG - Intergenic
917023455 1:170614823-170614845 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
917498450 1:175564239-175564261 CAGGGCAGGCAGCAGGAGGGAGG - Intronic
918079128 1:181192213-181192235 CAGGGAACACAGAAGATGTGAGG - Intergenic
918134928 1:181663375-181663397 TAGTGCATCCAGGAGAAGGGAGG - Intronic
918632154 1:186730806-186730828 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
920808405 1:209257049-209257071 CAGAGCAGACAGCAGACGGGAGG + Intergenic
921152103 1:212411029-212411051 GAGGTCATACAGGAGTAGGGTGG - Intronic
921626101 1:217379514-217379536 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
922236455 1:223726256-223726278 CAGACCCCACAGAAGAAGGGAGG - Intronic
922718974 1:227890705-227890727 CAGGGCAGAAAGAAGAGGGTGGG + Intergenic
922806649 1:228393801-228393823 TGGGGCATACAGAAGAAGGCAGG - Exonic
923288266 1:232518508-232518530 CAGGGCGTAGAAAACAAGGGAGG - Intronic
923366651 1:233268308-233268330 CAGGCCATTCAAAAGATGGGAGG - Intronic
923863872 1:237918745-237918767 GTGGGCATACAGTAGAAGGTGGG - Intergenic
924445622 1:244127784-244127806 CTGGGGATACAGAGGAAGGTGGG - Intergenic
924455025 1:244212475-244212497 CAGGGCAGACAGACAAAGAGTGG + Intergenic
924687717 1:246312475-246312497 CAGGGCATACAGAAGTTTGGGGG + Intronic
1063006595 10:1977458-1977480 CAGGGCATACAGTATAAAGACGG - Intergenic
1063464548 10:6234271-6234293 CAGGGCTCACAGCAGAAGGCAGG - Exonic
1064973407 10:21089047-21089069 CAGAGGAGACAGAAAAAGGGAGG + Intronic
1065121067 10:22530754-22530776 GAGGGCAAACAGAAGCCGGGTGG - Intergenic
1066498718 10:35969705-35969727 GAGGTCATACTGAATAAGGGAGG + Intergenic
1068350059 10:55831426-55831448 GAGGTCATGCAGAAGCAGGGTGG - Intergenic
1068495306 10:57778992-57779014 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1069614639 10:69799271-69799293 CAGGGCTCCCAGAAGAAAGGGGG - Intergenic
1069925004 10:71843285-71843307 CAGGCCAGACAGAAGAGAGGGGG + Intronic
1072009146 10:91288268-91288290 GAGGGAAAACAGAAGAAGAGAGG - Intergenic
1072044795 10:91643987-91644009 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1074114106 10:110442997-110443019 CAGGGCTGAGAGAGGAAGGGAGG - Intergenic
1075250092 10:120861045-120861067 AAGGGGATGCAGAAGAATGGGGG + Intronic
1077428395 11:2499017-2499039 GAGGGCACACAGAAGCAGGTGGG - Intronic
1078061003 11:8043982-8044004 AAGAGCAGCCAGAAGAAGGGGGG - Intronic
1078257901 11:9675719-9675741 CAGGGAATGCAGGAGAAGGAAGG - Intronic
1078932863 11:15926316-15926338 CAAAGCAGACAGAAGAAGGTGGG + Intergenic
1079378840 11:19918903-19918925 CAGAGCATAAAGCAGAAGGAAGG - Intronic
1080529468 11:33161163-33161185 CAGGGTATATAGAAGAGTGGTGG - Intronic
1080825909 11:35849222-35849244 CAGGGCATACACAAGAAAGTAGG - Intergenic
1081927680 11:46844361-46844383 CAAAGCATACAGATGAAGAGAGG - Intronic
1081990340 11:47333953-47333975 CAGACCATTCAGAAGAAGGTCGG - Exonic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1083499097 11:63087281-63087303 GAGGGCAGGCAGAAGCAGGGTGG + Intronic
1083670080 11:64294887-64294909 CAGGGCAGAGAGAGGGAGGGAGG + Intronic
1083769981 11:64861436-64861458 CAGGGCATACAGCAGGCAGGTGG - Intronic
1084190417 11:67496121-67496143 GAGGGCACACACAGGAAGGGAGG - Intronic
1085294453 11:75423240-75423262 CAGGGGATGGAGAAGAAGGTAGG + Intronic
1085324359 11:75595286-75595308 CAGGGCATTCACTAAAAGGGTGG - Intronic
1085443153 11:76581111-76581133 CAGGGTATAAAGAAAAACGGTGG - Intergenic
1086743359 11:90395549-90395571 CAGAGTATACACATGAAGGGTGG - Intergenic
1086960982 11:92979988-92980010 CACGGGGTACAGAAAAAGGGAGG - Intronic
1088702462 11:112425917-112425939 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1088707361 11:112475885-112475907 GAGGGTAGACAGAAGAAGGTGGG - Intergenic
1089406556 11:118202532-118202554 CAGGGCAGAGATAAGAATGGGGG + Intronic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089766113 11:120766748-120766770 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1089965892 11:122655098-122655120 CAGGGCAGAAAGAAGAGGGAAGG - Intergenic
1090081241 11:123614216-123614238 CAGGGGAGGCAGAAGAAGAGGGG + Intronic
1090350163 11:126102902-126102924 CTGGGCAAAGAGAAGAAAGGAGG + Intergenic
1091213613 11:133885545-133885567 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1092276232 12:7062897-7062919 CAGGAGACACTGAAGAAGGGAGG + Exonic
1092304277 12:7283398-7283420 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1092567777 12:9686143-9686165 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1092629031 12:10358826-10358848 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1093134174 12:15430261-15430283 AAAGGCAGGCAGAAGAAGGGTGG + Intronic
1093666977 12:21825934-21825956 CTAGGCATAAAGAGGAAGGGAGG + Intronic
1094210576 12:27885756-27885778 CTGGGAACAAAGAAGAAGGGTGG - Intergenic
1094467680 12:30770994-30771016 CAGGGCATCTTGAAGCAGGGAGG - Intergenic
1095474222 12:42568844-42568866 CAGGGACTACAAAAGATGGGAGG - Intronic
1097090070 12:56497741-56497763 GTGGGCATACAGTAGAAGGTGGG + Intergenic
1097229200 12:57498884-57498906 CAGGACACAGAGAGGAAGGGAGG - Intronic
1099107809 12:78518769-78518791 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
1099528085 12:83740826-83740848 GAGGGCAAACAGAAGAGGGTGGG + Intergenic
1099745056 12:86690608-86690630 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1099749942 12:86760684-86760706 CAGGGCATAGAAAAGAAAAGGGG + Intronic
1100102574 12:91126706-91126728 CTGGGCAAACAGAAGAGGGAGGG + Intergenic
1100768822 12:97898597-97898619 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1101145728 12:101838867-101838889 CAGAGCAAACAGAATAAGGGGGG - Intergenic
1101244688 12:102874428-102874450 CAGGCCATATAAAAGAAAGGAGG - Intronic
1102397188 12:112596666-112596688 CAAGCAATATAGAAGAAGGGTGG - Intronic
1106336667 13:28789462-28789484 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1107181791 13:37469847-37469869 CAAGGCAGGCAGAAGAAGGAGGG + Intergenic
1112298035 13:98205848-98205870 CAGGAAATAAAGAATAAGGGTGG - Intronic
1113062648 13:106339966-106339988 CAGAGGATACAAACGAAGGGAGG + Intergenic
1114064022 14:19044763-19044785 CAGGGCATGCAGAACTATGGTGG + Intergenic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114098237 14:19355233-19355255 CAGGGCATGCAGAACTATGGTGG - Intergenic
1114744901 14:25136567-25136589 AAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1115339001 14:32272570-32272592 GAGGGCACACAGAAACAGGGTGG + Intergenic
1116675297 14:47898862-47898884 GAGGTCATACTGAAGTAGGGTGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1117852320 14:59987595-59987617 CAGGAAATATAGAAGATGGGAGG - Intronic
1118509615 14:66457163-66457185 CATGGCAGAAAGATGAAGGGTGG - Intergenic
1119113153 14:71994623-71994645 GAGGTCATACAAAAGTAGGGTGG + Intronic
1119140316 14:72261377-72261399 CAGGTCATACAAAAGGAGGAGGG + Intronic
1119211645 14:72836439-72836461 CAGGGCAGGCAGGAGCAGGGAGG - Intronic
1120483895 14:85086109-85086131 ATGGGCATATAGAAGAATGGAGG - Intergenic
1121092329 14:91191257-91191279 CAGGGCAGAAAGTAGAATGGTGG + Intronic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1122917935 14:104867354-104867376 CAGGGAACACAGAGGCAGGGCGG - Intronic
1123860443 15:24460718-24460740 CAGGGCATGCAGAAGGGGTGTGG + Intergenic
1123864073 15:24499337-24499359 CAGGGCATGCAGAAGGGGTGTGG + Intergenic
1124084119 15:26531195-26531217 CAGGGCAAGCAGAAACAGGGTGG + Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125517710 15:40332001-40332023 GAGGGCACACAGGAGGAGGGAGG - Intronic
1127705812 15:61546336-61546358 AAGGGCTTAGAGAAGAGGGGAGG - Intergenic
1127764613 15:62172926-62172948 GAGGTCATACTGAAGTAGGGTGG - Intergenic
1129039173 15:72670884-72670906 CAGTGCAGACAGGAGAAGGAGGG - Intergenic
1129609061 15:77038636-77038658 CAGGCCATCCAGCAGAGGGGAGG + Intergenic
1129876450 15:78978789-78978811 CAGGGCACACAGAGGAGGGAGGG - Intronic
1130283531 15:82537464-82537486 CAAGGCATCAAGCAGAAGGGAGG + Intronic
1131507063 15:93028521-93028543 CAGCCCAGACAGAGGAAGGGTGG + Intergenic
1132967536 16:2666998-2667020 GTGGGCATACAGCAGAAGGTGGG + Intergenic
1133221824 16:4322148-4322170 CAGGGGATCCTGAGGAAGGGGGG + Intronic
1133234069 16:4379568-4379590 CAGGGCAGACAGAAGAAAGCAGG - Intronic
1134307558 16:13046825-13046847 CAGGCCATGCAGAGGAAGAGTGG - Intronic
1135200192 16:20430644-20430666 TAGGGAACAAAGAAGAAGGGAGG + Intronic
1135218498 16:20592965-20592987 TAGGGAACAAAGAAGAAGGGAGG - Intergenic
1137484464 16:48880228-48880250 CTGGGCTCACAGAAGAAGGCGGG + Intergenic
1139222146 16:65194541-65194563 GAGGGCGAGCAGAAGAAGGGTGG - Intergenic
1139730961 16:68944825-68944847 CAGGGCATACACAGACAGGGTGG + Intronic
1140012882 16:71153693-71153715 TAGAGCAAACTGAAGAAGGGTGG + Intronic
1141225814 16:82113881-82113903 GAGGGCATACAGGAGTAGGGTGG - Intergenic
1141417495 16:83887688-83887710 CGGGGAATTCAGAAGGAGGGAGG + Intergenic
1141672681 16:85500971-85500993 CAGGCCATACTGGAGTAGGGTGG - Intergenic
1141685339 16:85566824-85566846 CAGGGAACATAAAAGAAGGGAGG + Intergenic
1143890092 17:10096365-10096387 CCTGGCAAACAGAAGAGGGGAGG - Intronic
1144434202 17:15224397-15224419 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1146659698 17:34657536-34657558 CAGGGCAAAGGGCAGAAGGGAGG - Intergenic
1146745350 17:35323883-35323905 CAGGTCACACAGATGAAGGATGG + Intergenic
1146746419 17:35334220-35334242 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1147647115 17:42040509-42040531 CAGGGCATCCAGCAGCAGGTGGG + Intronic
1147862806 17:43533434-43533456 CAGGGATTACAGGAGAAGGAAGG + Intronic
1147955085 17:44128642-44128664 CCAGGCAAAGAGAAGAAGGGAGG - Intergenic
1149268545 17:54953394-54953416 CAGGTTACACAGAAGAAGGGGGG - Intronic
1150220846 17:63495221-63495243 CGGGGCACACAGAAGGAGAGGGG - Intronic
1152900367 17:82937653-82937675 CAGGGCACACAGGAGAATCGGGG - Intronic
1153497322 18:5712746-5712768 CAGGCCATTTAGAAGAATGGTGG + Intergenic
1153798378 18:8646574-8646596 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1155621282 18:27783565-27783587 TAGGTCATACTGGAGAAGGGTGG + Intergenic
1157081644 18:44531950-44531972 GAAGTCATACAGAAGTAGGGTGG + Intergenic
1157439195 18:47697130-47697152 CAGGGCACAGAGAAGAGGGTGGG - Intergenic
1157595854 18:48863131-48863153 CAGGACATACCGACGGAGGGAGG - Intronic
1158387657 18:57013274-57013296 CAGGCCGTACAGCAGGAGGGTGG - Intronic
1158470078 18:57728453-57728475 GAGGGCAAAGAGAGGAAGGGAGG + Intronic
1158681827 18:59574938-59574960 GAAGTCATACTGAAGAAGGGTGG + Intronic
1158825877 18:61218480-61218502 GAGGCCATACGGAAGTAGGGTGG + Intergenic
1159855027 18:73576244-73576266 CAGAGCAAACAGAACAAGGCTGG - Intergenic
1160591200 18:79945566-79945588 AGAGGCAAACAGAAGAAGGGAGG + Intronic
1161437643 19:4273227-4273249 CTGGGCTTACAGGAGAAGAGGGG + Intergenic
1161719707 19:5896046-5896068 CAAGGCACACAGAAGGAAGGCGG + Intronic
1161980845 19:7629521-7629543 CTGGGCATCCAGAAAAATGGTGG - Exonic
1162790101 19:13058258-13058280 CAGGGCCTACAGGAGAGGTGAGG - Intronic
1164592423 19:29513921-29513943 CAGGGGATGAGGAAGAAGGGAGG + Intergenic
1164635328 19:29787406-29787428 CATGGCATCCAGAAGAGAGGAGG + Intergenic
1164743578 19:30594731-30594753 CAGGGGAAACAGGAGAAGAGTGG - Intronic
1164905191 19:31961378-31961400 CATGGTGCACAGAAGAAGGGAGG - Intergenic
1165833726 19:38742479-38742501 CCGGGGATACAGAGTAAGGGAGG + Exonic
1165986015 19:39769598-39769620 CAGGAAATCCAGAAAAAGGGTGG + Intergenic
1166297740 19:41897145-41897167 CAGGGCACAGAGCAGAGGGGTGG - Intronic
1166750361 19:45161595-45161617 CAGGGCACACAGAGGCAGGGCGG + Intronic
1167200157 19:48059563-48059585 CAAAGCAGACAGAAGAAGGTGGG + Intronic
1167684375 19:50946915-50946937 CAGGGCACAGAGAAGAAATGGGG + Intronic
925592072 2:5519835-5519857 AAGGTCATACAGGAGTAGGGTGG - Intergenic
926474254 2:13302789-13302811 TAGGGCATAGAGAAGCAGAGAGG - Intergenic
926970680 2:18464164-18464186 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
927012885 2:18924297-18924319 CATGGCTTTCAGAAGGAGGGAGG - Intergenic
928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG + Intronic
928415966 2:31091994-31092016 CACGGCAGAAAGATGAAGGGTGG - Intronic
928469189 2:31556665-31556687 CAGAGCTTCCAGAAGAAGTGTGG + Intronic
929256220 2:39813973-39813995 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
929837934 2:45425661-45425683 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
929861260 2:45679790-45679812 GAGGGAACACAGAAGAAGGAAGG - Intronic
930223386 2:48767867-48767889 GAGGGCAGGCAGAAGCAGGGTGG - Intronic
930605916 2:53492965-53492987 CAGGGGATAAAGAAGAGGGGAGG + Intergenic
931920374 2:67008848-67008870 AAGGTCATAAAGAAGAAAGGAGG + Intergenic
933245539 2:79970699-79970721 CAGGCCATACTGGAGAATGGAGG + Intronic
933639053 2:84740448-84740470 CAGGGCACTGAGAAGAAGGGTGG + Intronic
935013515 2:99157722-99157744 ACGGACATACAGAAGAAGGAGGG - Intronic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
938481283 2:131663747-131663769 CAGGGCATGCAGAACTATGGTGG + Intergenic
939055427 2:137359535-137359557 AAGCGCTTACTGAAGAAGGGTGG + Intronic
939237091 2:139508733-139508755 CAAGGCATACAGAGGAGGGAGGG + Intergenic
939640930 2:144638977-144638999 TAGGGCAAGCAGAAGCAGGGTGG - Intergenic
939937848 2:148313935-148313957 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
940565240 2:155351827-155351849 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
941239471 2:163017909-163017931 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
941427328 2:165365043-165365065 AAATGCATACAGAAGATGGGGGG + Intronic
941518799 2:166511843-166511865 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
941990567 2:171552421-171552443 ATGGGGAGACAGAAGAAGGGAGG - Intronic
942044229 2:172090170-172090192 CCGGGCATGCAAAAGCAGGGAGG - Intergenic
942218968 2:173750602-173750624 CAGGGCATAGAGAGGAAAGAGGG + Intergenic
942898673 2:181089066-181089088 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
943006101 2:182389799-182389821 CAGTGCAGACAGAATAAGGCAGG + Intronic
943147767 2:184066433-184066455 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
944764265 2:202848983-202849005 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
945205453 2:207326891-207326913 CAAGGCATTCAGAGCAAGGGTGG - Intergenic
945482287 2:210357986-210358008 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
945965751 2:216184881-216184903 CAGGGCATACAGAAGAAGGGAGG - Intronic
945991683 2:216400838-216400860 CAGGGAATACAGAATCAGGAAGG - Intergenic
946252380 2:218421521-218421543 CAGGGAAGACAGGAGAAGTGAGG + Intronic
946391201 2:219418057-219418079 CAGGGGAGACAGCAGAAGAGAGG - Intergenic
946691203 2:222309628-222309650 CAGGACATTCAAAAGCAGGGTGG + Intergenic
946762328 2:223006920-223006942 CAGGACATTCAGAAGAAGAATGG + Intergenic
947344171 2:229173743-229173765 CAGGGCACACCGAAGTGGGGAGG - Intronic
947734293 2:232446734-232446756 CAGGGGACACAGAAGAGGGCAGG - Intergenic
948383854 2:237569405-237569427 CAGGGGATAGGGAAGAGGGGTGG + Intergenic
1170251886 20:14292517-14292539 CAGGGCATACATAAAAAGAAAGG - Intronic
1170773193 20:19352014-19352036 CAGGGGATACCGATGAAGGAGGG + Intronic
1170872066 20:20214877-20214899 CAGGGCAGGCAGAAGGAGAGTGG + Intronic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1173539570 20:43841269-43841291 TAGGGCATGCTGCAGAAGGGAGG - Intergenic
1174388738 20:50203773-50203795 GAGGCCATCCATAAGAAGGGTGG - Intergenic
1175531056 20:59674520-59674542 AAGGGGAGACAGAAGAAGCGGGG - Intronic
1176193324 20:63824626-63824648 CAGAGCACCCAGAAGAACGGGGG - Intronic
1176407545 21:6429656-6429678 CAGGGGTTACAGAAGAAGCGTGG + Intergenic
1176891697 21:14327002-14327024 GAGGGCACGCAGAAGCAGGGTGG + Intergenic
1176970013 21:15254103-15254125 CAGGGAAAACAGAGGAAAGGAGG + Intergenic
1177352882 21:19967699-19967721 GAGGTCATACTGAAGTAGGGTGG + Intergenic
1179285351 21:39973200-39973222 CAGGGGAGACAGATGCAGGGCGG - Intergenic
1180011359 21:45053670-45053692 CAGGGCAGACTGTGGAAGGGAGG - Intergenic
1180482514 22:15767397-15767419 CAGGGCATGCAGAACTATGGTGG + Intergenic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1181406642 22:22689700-22689722 CAGGGCTGACAGAAGAGGAGAGG - Intergenic
1182083206 22:27543604-27543626 CAGGGAAGAAAGAGGAAGGGAGG - Intergenic
1182095694 22:27623848-27623870 CAGGGCATAAAGGGGAAGGGAGG - Intergenic
1182358737 22:29734571-29734593 CAGGCCATGCAGGAGAAGCGGGG + Intronic
1183725994 22:39590018-39590040 CTGGGCCTGCAGAAGGAGGGTGG + Intronic
1184001164 22:41674670-41674692 CAGAGCAGACAGAAGCAGGGTGG - Exonic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
1184976656 22:48067022-48067044 GAGGTCCTACAGAAGAAGAGAGG + Intergenic
1185059914 22:48601018-48601040 TTGGTCATCCAGAAGAAGGGAGG + Intronic
1185117539 22:48946143-48946165 CAGGGCATACGGAGGGAGGGAGG + Intergenic
949307184 3:2655377-2655399 AAGGGCATACAGAACCAAGGAGG - Intronic
949953046 3:9245292-9245314 CAGTGCAGGCAGTAGAAGGGTGG - Intronic
949954967 3:9259995-9260017 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
950478944 3:13232936-13232958 CAGGACATAAAGTAGAATGGTGG + Intergenic
952655073 3:35776420-35776442 CAGGGAAAGCAGAGGAAGGGTGG + Intronic
952845040 3:37681245-37681267 CAGAGCATAGACAAGAAGGCTGG + Intronic
953102438 3:39842755-39842777 GAGGGCAGACAGAAGCAGGGGGG - Intronic
953201663 3:40783318-40783340 AAGGGCAGACAGTAGAAGGGAGG + Intergenic
953916402 3:46923559-46923581 CAGGACACACAGAAGCAGCGAGG + Intronic
954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG + Intronic
955570131 3:60295830-60295852 CTGGGCATACATAGGAAGGAGGG + Intronic
956329719 3:68092802-68092824 ATGTGCATACAGAAGAAGGCAGG + Intronic
956845996 3:73183494-73183516 CAGGGCATAGAGCAGAGTGGAGG - Intergenic
957199062 3:77108649-77108671 CAGGGCATACTGCAGGAGTGAGG + Intronic
957776415 3:84760854-84760876 CAGGGCAAGCAGAAGCAGGGTGG + Intergenic
958706861 3:97666645-97666667 GAGGTCATACTGAAGTAGGGTGG - Intronic
959345664 3:105191471-105191493 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
962065528 3:131975568-131975590 CAGGGCCTGCAGAAGCAGTGTGG - Intronic
962280523 3:134048672-134048694 CACGGCAAACAGGGGAAGGGTGG - Intronic
962765633 3:138560207-138560229 GAGGGCAAACCGAAGGAGGGTGG + Intronic
962947131 3:140182456-140182478 CAGGACAGACTGAAGAAGGCTGG - Intronic
963410933 3:144926793-144926815 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
963629376 3:147713457-147713479 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
963998639 3:151740288-151740310 GAGGGCGAACAGAAGCAGGGTGG - Intronic
965806647 3:172548932-172548954 CAGTGAATACAGAAAAAGTGGGG + Intergenic
965910788 3:173772788-173772810 CAGTGAATACAGAAAAAGGATGG - Intronic
966308953 3:178572148-178572170 CAGCATATACAAAAGAAGGGTGG + Intronic
966309322 3:178576191-178576213 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
967419653 3:189259293-189259315 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
968312756 3:197697605-197697627 CCGGCCTTACTGAAGAAGGGAGG + Intronic
968771991 4:2513330-2513352 CAGGGCATACAGGAGTATAGGGG - Intronic
969155385 4:5205458-5205480 CAGGGCACACAGAGACAGGGAGG + Intronic
969164902 4:5299092-5299114 AAGGGCAAGCAGAAGCAGGGTGG - Intronic
970027445 4:11638685-11638707 GAGGGCACATAGAAGAAGTGTGG - Intergenic
970679290 4:18489024-18489046 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
972372531 4:38438493-38438515 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
972698167 4:41468255-41468277 CAGGGCAGAAGGAAGAAAGGAGG - Intronic
972962661 4:44473557-44473579 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
973629023 4:52801797-52801819 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
973669365 4:53199908-53199930 CATGGCAGAGAGAAGGAGGGAGG + Intronic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
977792852 4:101128592-101128614 GAGGGCAAGCAGAAGCAGGGCGG + Intronic
979085433 4:116404287-116404309 TAGGGAATACAGAAGGAGAGAGG + Intergenic
979987585 4:127333983-127334005 CAGTGCAAACAGAGGAAGGGAGG - Intergenic
980494243 4:133570584-133570606 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
980663247 4:135894974-135894996 CAGGGCATAGAGAGGAAAAGAGG - Intergenic
980769254 4:137350722-137350744 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
980888224 4:138786034-138786056 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
981235678 4:142412669-142412691 CAGAGAATACAGAAGAAAGATGG - Intronic
981249621 4:142584056-142584078 CAGGGCATATAGAATAAGAAGGG - Intronic
982794622 4:159630013-159630035 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
984526142 4:180861031-180861053 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
984960290 4:185090712-185090734 CAGGGCATCAAGTAGAAGGAAGG + Intergenic
984982032 4:185291594-185291616 CAGCGCATTCAGAAGCAGCGTGG - Intronic
985052100 4:186001092-186001114 CAGTGCTTACAGAAAGAGGGAGG - Intergenic
986289048 5:6383982-6384004 CAGGGCAACTAGAAGCAGGGAGG + Intergenic
986348820 5:6858521-6858543 CAGGGCCTACAGAAGAGCAGTGG - Intergenic
986358458 5:6951964-6951986 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
986421048 5:7582846-7582868 CAGGGCATGCAAATGAAGAGAGG + Intronic
986512017 5:8517428-8517450 CAGAGCAAGCAGAAGCAGGGTGG - Intergenic
986675110 5:10177546-10177568 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
987390950 5:17375163-17375185 CAGAGACTACAAAAGAAGGGTGG - Intergenic
988458769 5:31413222-31413244 CAGGTCTTAAAGCAGAAGGGTGG + Intronic
990803426 5:59631592-59631614 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
991952901 5:71964046-71964068 CAGGGGTTACAGATGATGGGGGG + Intergenic
992381143 5:76239087-76239109 CAGGACATACAGAAGTGGGGGGG - Intronic
992383936 5:76265769-76265791 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
994233615 5:97336682-97336704 GAGGGCAAGCGGAAGAAGGGTGG - Intergenic
995353861 5:111214778-111214800 CTGGGCATACAAAAAAAGGATGG - Intergenic
995933998 5:117486339-117486361 CAGGGCACACAGCAGAATAGAGG - Intergenic
997437726 5:133887122-133887144 CATGTCATACAAAAGAATGGTGG + Intergenic
997951045 5:138242721-138242743 CTGGCCATCCAGAAAAAGGGAGG - Intergenic
999258185 5:150221559-150221581 CAGGGCAGAGAGGAGGAGGGAGG - Intronic
1000698190 5:164415608-164415630 CAGGGCATACTTGAGAGGGGAGG - Intergenic
1000871770 5:166585819-166585841 GAAGTCATACAGAAGAAGGTTGG + Intergenic
1003042130 6:2698157-2698179 CAGGCCAGATAGAAGAATGGAGG + Intronic
1003599374 6:7503218-7503240 CATGGGATGCAGGAGAAGGGAGG - Intergenic
1004220359 6:13741736-13741758 GAGGTCATACTGAAGCAGGGAGG - Intergenic
1005778437 6:29162307-29162329 GAGGGCAAGCAGAAGAAGGGTGG - Intergenic
1006315764 6:33290592-33290614 CAGGGGAGGGAGAAGAAGGGGGG - Intronic
1006371924 6:33650146-33650168 AAGGGCAGAGAGAAGGAGGGTGG - Intronic
1007287226 6:40756294-40756316 CAGAGCATTAAGAAGATGGGAGG + Intergenic
1008176281 6:48271341-48271363 AAGGGCAAATAGAAGCAGGGTGG - Intergenic
1009251586 6:61307551-61307573 CAGGACAAAAAGTAGAAGGGAGG - Intergenic
1009455181 6:63848530-63848552 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
1010003834 6:70974315-70974337 GAGGGCAAACTGAAGCAGGGTGG + Intergenic
1010029646 6:71259680-71259702 CTGGGAATACATGAGAAGGGAGG + Intergenic
1010472780 6:76249555-76249577 CAGGAGACACAGAAGACGGGTGG + Intergenic
1010615280 6:78005471-78005493 GAGGGCAAGCAGAAGTAGGGTGG + Intergenic
1011020784 6:82809787-82809809 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1011370289 6:86629869-86629891 CAGGGTATAAAGAAGAAAAGTGG + Intergenic
1011594641 6:89004681-89004703 CAGGCCATAAATAGGAAGGGGGG + Intergenic
1014523981 6:122479044-122479066 AAGGGCAAGCAGAAGCAGGGTGG - Intronic
1014558636 6:122863690-122863712 CAGGGCAAAGTGAGGAAGGGAGG + Intergenic
1014907078 6:127043393-127043415 CAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1016879199 6:148894333-148894355 GAGGTCATACTGGAGAAGGGTGG + Intronic
1017124474 6:151052460-151052482 CAAGGGATACAGAAGAAGGATGG + Intronic
1017747280 6:157458161-157458183 CAGGGTAGGTAGAAGAAGGGAGG + Intronic
1018664329 6:166120795-166120817 CAGGGCATAGATAGGAGGGGAGG + Intergenic
1018853591 6:167659155-167659177 CACTGCAGCCAGAAGAAGGGAGG - Intergenic
1018949377 6:168369232-168369254 CAGTACATACAGAAGGAGGGAGG - Intergenic
1019723532 7:2587744-2587766 CAGGCCATACCTGAGAAGGGTGG + Intronic
1021566060 7:22017581-22017603 CAGGTCAGGAAGAAGAAGGGAGG - Intergenic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022673154 7:32474830-32474852 AAGGGCAGAGAGAAAAAGGGAGG + Intergenic
1023107795 7:36779720-36779742 TAGGGCAGACAGAAGAAATGTGG + Intergenic
1023456874 7:40349056-40349078 GAGGATATACAGAAGGAGGGTGG - Intronic
1023681957 7:42696278-42696300 AAGGGCATGTAGCAGAAGGGAGG + Intergenic
1023905286 7:44517367-44517389 CATGGCACACAGAAGATGGAAGG + Intronic
1024017643 7:45332692-45332714 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1024227301 7:47335666-47335688 CAGAGCATCCATATGAAGGGCGG - Intronic
1024664993 7:51537073-51537095 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1031613852 7:123857477-123857499 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1032189761 7:129757884-129757906 CAGGGCATGCAGAAGCATGGAGG - Intergenic
1032447664 7:131998623-131998645 CAGGGCATGGAGAAGGAGAGGGG + Intergenic
1032957201 7:136984741-136984763 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1034405865 7:150902105-150902127 CAGGACACACAGAAGGAAGGAGG + Intergenic
1034571425 7:151959598-151959620 CAGAGGATACAGATTAAGGGAGG - Intronic
1035669826 8:1408853-1408875 CAGGGCACAGAGAAGAAAGCTGG + Intergenic
1035998403 8:4574419-4574441 GAGGGTAAGCAGAAGAAGGGTGG - Intronic
1037192430 8:16142824-16142846 CTGGGAATACAGAGGGAGGGAGG + Intronic
1037846949 8:22291930-22291952 CAGGGCAATCAGAAGTAGTGGGG + Intronic
1039172958 8:34769505-34769527 TAGGGCAGAGAGGAGAAGGGGGG - Intergenic
1039259637 8:35757378-35757400 CAGGGCATTCACAAGCATGGTGG - Intronic
1039346502 8:36711099-36711121 CAAGGCATACAGCAGAAGGAGGG - Intergenic
1041088146 8:54275984-54276006 CAGGGAATATAGAAGATGAGTGG - Intergenic
1041426363 8:57725202-57725224 CAGGGCAGCCAGGAGAACGGAGG + Intergenic
1041630658 8:60083230-60083252 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1041900718 8:62979009-62979031 GAGGGCAAGCAGAAGCAGGGTGG - Exonic
1042464895 8:69117560-69117582 CAGGACATACTGAATTAGGGTGG + Intergenic
1042874091 8:73424889-73424911 CCGGGCATCCCGAAGCAGGGAGG + Intronic
1042969386 8:74391475-74391497 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1043745023 8:83864025-83864047 CAATGCATACAGAAAAAGTGTGG + Intergenic
1044595354 8:93953565-93953587 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1045742336 8:105375959-105375981 TAGGGCATAGAGAAGTGGGGTGG - Intronic
1046153560 8:110258200-110258222 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1047142120 8:122153075-122153097 CAGGGCACATGGAAGAATGGGGG - Intergenic
1048498709 8:134956920-134956942 CAGGGCAAACAGAAGGGAGGTGG + Intergenic
1049216588 8:141411114-141411136 CCTGGCATACAGGAGGAGGGTGG - Intronic
1049444670 8:142624487-142624509 CAGGGCATCCAGACGGAGGCTGG + Intergenic
1049914455 9:303627-303649 CAGGGATTACTAAAGAAGGGAGG + Intronic
1050194288 9:3064457-3064479 CAGAGGTTACAGAAGTAGGGTGG - Intergenic
1051487073 9:17620562-17620584 AAGGGCAGACAGAAGAGGGTTGG + Intronic
1051610406 9:18956464-18956486 CAGGGGATCCAGAAGACTGGTGG - Intronic
1052217288 9:25982668-25982690 CAGGGCAAGCTGAAGCAGGGCGG + Intergenic
1052241285 9:26277249-26277271 GAGGGCAAGCAAAAGAAGGGTGG + Intergenic
1052829332 9:33202356-33202378 CAGGGCAGACAGAGCAAGGGTGG + Intergenic
1052980039 9:34441442-34441464 CAGGGCTTAGTGAAGCAGGGTGG + Intronic
1054857688 9:69918649-69918671 GAGGTCATACAGAAGTGGGGAGG - Intergenic
1056070271 9:82979097-82979119 CACTGCATACAACAGAAGGGAGG + Intergenic
1056249618 9:84734330-84734352 CAGGGCATAAACACAAAGGGAGG - Intronic
1056302713 9:85258445-85258467 CATGGCAAACAGAAGCAGGGTGG - Intergenic
1056617021 9:88177525-88177547 GAGGGCATGCAGGAGAAGGATGG + Intergenic
1056832025 9:89924877-89924899 CAGGGCATACAGAATGGGAGAGG - Intergenic
1057254083 9:93529327-93529349 CAGTGCAGAGAGCAGAAGGGAGG - Intronic
1057415886 9:94861828-94861850 CAGGTCCTACAGAAGCACGGAGG - Intronic
1058941343 9:109815524-109815546 CAGGGTAGACAGAAACAGGGGGG + Intronic
1059602536 9:115795720-115795742 AAAGGCATACAGAAGATGGTGGG + Intergenic
1060279248 9:122204852-122204874 AAAGGCACAGAGAAGAAGGGTGG + Intronic
1061875679 9:133542404-133542426 CAGGGCATGCAGAGGGAGAGTGG + Intronic
1061949212 9:133926842-133926864 CAGAGCACACAGAAGCAGAGAGG + Intronic
1062581637 9:137231537-137231559 CAGGGCGTAGAGAGGGAGGGTGG + Intronic
1186832432 X:13404141-13404163 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1187016913 X:15338290-15338312 GTGGGCAGACAGAAGAAGAGTGG + Intergenic
1189862530 X:45288517-45288539 GAGGTCATACTGGAGAAGGGTGG - Intergenic
1190135996 X:47798577-47798599 CATGGCCTAGAGGAGAAGGGAGG - Intergenic
1191094428 X:56659427-56659449 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1191657374 X:63613313-63613335 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1191802632 X:65098592-65098614 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1192218390 X:69179817-69179839 CAGGGGAGAGAGGAGAAGGGGGG - Intergenic
1193013914 X:76710688-76710710 GAGGTCATACTGAAGTAGGGTGG - Intergenic
1193040540 X:76999266-76999288 CAGGGTAAGCAGAAGTAGGGTGG - Intergenic
1193049174 X:77082976-77082998 CAGGGCATACATAAGTAGCAGGG + Intergenic
1193254102 X:79325977-79325999 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1193361770 X:80587174-80587196 AAGGGCAAGCAGAAGTAGGGTGG - Intergenic
1193404398 X:81083781-81083803 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1193477202 X:81981601-81981623 GAGGGCAAGCTGAAGAAGGGTGG + Intergenic
1193897181 X:87128461-87128483 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1194798481 X:98241138-98241160 CAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1195140021 X:101950016-101950038 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1195810708 X:108825504-108825526 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1195820952 X:108944660-108944682 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1196247258 X:113414874-113414896 CAGGGCATATAGGGGAGGGGTGG - Intergenic
1196339645 X:114582676-114582698 TAGGGCATCCAGAATAAGGAAGG + Intergenic
1196861380 X:120031644-120031666 CAAGGTTTACAGAAGGAGGGAGG + Intergenic
1196946678 X:120833355-120833377 CAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1197505917 X:127305663-127305685 GAGGGCGAACAGAAGCAGGGTGG + Intergenic
1198241830 X:134795557-134795579 CAGTGAATAAAAAAGAAGGGTGG - Intronic
1198260224 X:134959401-134959423 CAGGGCATACAGTGTAAGGCTGG - Intergenic
1198757936 X:140000755-140000777 GAGGGCAAGCAGAAGTAGGGTGG + Intergenic
1199417243 X:147599502-147599524 CAGGGCAGAGAGAGGGAGGGAGG - Intergenic
1199574623 X:149301505-149301527 GAGGGCAAACAGCAGAAGGCAGG + Intergenic
1200224356 X:154409076-154409098 CTGGGGAGACGGAAGAAGGGAGG - Intronic
1201376662 Y:13330374-13330396 GAGGGCAAACAGAAGCAGGGTGG + Intronic
1201543145 Y:15131532-15131554 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic