ID: 945972684

View in Genome Browser
Species Human (GRCh38)
Location 2:216245761-216245783
Sequence TATTGGGCACAGAGGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945972679_945972684 -7 Left 945972679 2:216245745-216245767 CCTTGCTTGCAGCTTCTATTGGG No data
Right 945972684 2:216245761-216245783 TATTGGGCACAGAGGGAGCTGGG No data
945972675_945972684 30 Left 945972675 2:216245708-216245730 CCTGCAGTCTGGATGATCCTGCT No data
Right 945972684 2:216245761-216245783 TATTGGGCACAGAGGGAGCTGGG No data
945972676_945972684 13 Left 945972676 2:216245725-216245747 CCTGCTTCTGTGCTTGCCAGCCT No data
Right 945972684 2:216245761-216245783 TATTGGGCACAGAGGGAGCTGGG No data
945972677_945972684 -3 Left 945972677 2:216245741-216245763 CCAGCCTTGCTTGCAGCTTCTAT No data
Right 945972684 2:216245761-216245783 TATTGGGCACAGAGGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945972684 Original CRISPR TATTGGGCACAGAGGGAGCT GGG Intergenic
No off target data available for this crispr