ID: 945972821

View in Genome Browser
Species Human (GRCh38)
Location 2:216246867-216246889
Sequence GAGAATGTCATAGGCATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945972821_945972825 -1 Left 945972821 2:216246867-216246889 CCTTCCATGCCTATGACATTCTC No data
Right 945972825 2:216246889-216246911 CTGATGCTGATGGTATTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945972821 Original CRISPR GAGAATGTCATAGGCATGGA AGG (reversed) Intergenic
No off target data available for this crispr