ID: 945977102

View in Genome Browser
Species Human (GRCh38)
Location 2:216279581-216279603
Sequence TTCCATCCGGGTCTCCCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 81}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945977102_945977106 5 Left 945977102 2:216279581-216279603 CCAACAGGGAGACCCGGATGGAA 0: 1
1: 0
2: 0
3: 16
4: 81
Right 945977106 2:216279609-216279631 TGATTCATTCTGGCTGCAGCTGG 0: 1
1: 0
2: 2
3: 19
4: 210
945977102_945977105 -5 Left 945977102 2:216279581-216279603 CCAACAGGGAGACCCGGATGGAA 0: 1
1: 0
2: 0
3: 16
4: 81
Right 945977105 2:216279599-216279621 TGGAAGCATTTGATTCATTCTGG 0: 1
1: 0
2: 1
3: 21
4: 262
945977102_945977107 6 Left 945977102 2:216279581-216279603 CCAACAGGGAGACCCGGATGGAA 0: 1
1: 0
2: 0
3: 16
4: 81
Right 945977107 2:216279610-216279632 GATTCATTCTGGCTGCAGCTGGG 0: 1
1: 0
2: 0
3: 27
4: 204
945977102_945977108 11 Left 945977102 2:216279581-216279603 CCAACAGGGAGACCCGGATGGAA 0: 1
1: 0
2: 0
3: 16
4: 81
Right 945977108 2:216279615-216279637 ATTCTGGCTGCAGCTGGGATTGG 0: 1
1: 0
2: 2
3: 32
4: 254
945977102_945977109 16 Left 945977102 2:216279581-216279603 CCAACAGGGAGACCCGGATGGAA 0: 1
1: 0
2: 0
3: 16
4: 81
Right 945977109 2:216279620-216279642 GGCTGCAGCTGGGATTGGCCTGG 0: 1
1: 0
2: 12
3: 32
4: 431
945977102_945977110 23 Left 945977102 2:216279581-216279603 CCAACAGGGAGACCCGGATGGAA 0: 1
1: 0
2: 0
3: 16
4: 81
Right 945977110 2:216279627-216279649 GCTGGGATTGGCCTGGCCAGTGG 0: 1
1: 1
2: 0
3: 34
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945977102 Original CRISPR TTCCATCCGGGTCTCCCTGT TGG (reversed) Intronic
900525148 1:3124864-3124886 TCCCATCCGGGCAGCCCTGTGGG + Intronic
902715323 1:18268802-18268824 TTCCATCCGGATAAGCCTGTGGG - Intronic
904765472 1:32843170-32843192 TTTCATCAGGTTTTCCCTGTAGG + Intronic
905868811 1:41391448-41391470 TTCAATCCTGGTCTCCCTTTGGG - Intergenic
906995691 1:50791545-50791567 TTCCATCAGTATCACCCTGTAGG + Intronic
911659534 1:100485692-100485714 TTCCATTCTGGGCTCCTTGTGGG - Intronic
918464078 1:184804204-184804226 TTAAATCCTGGTCTCCATGTTGG - Intronic
920170594 1:204070082-204070104 CTCCATCCTGGTCTCCAGGTGGG - Intergenic
1063048644 10:2420510-2420532 TTCCATCTGGTTTCCCCTGTAGG - Intergenic
1065234788 10:23638133-23638155 TTCCATCAGTCTCTCCCTCTCGG + Intergenic
1067692595 10:48511475-48511497 CTCCATCCGACTCTCCCTATTGG + Intronic
1068949118 10:62759899-62759921 TTCCAGCCAGGCCTCCCTGTTGG - Intergenic
1069550354 10:69360057-69360079 CTCCCTCCGGGTCACCCCGTCGG + Intronic
1070641714 10:78175202-78175224 TGCCTTCCTGGTCTCCCAGTAGG - Intergenic
1071877027 10:89853083-89853105 TTCCTTCCTGTGCTCCCTGTTGG - Intergenic
1072796051 10:98355385-98355407 TTACATCATGATCTCCCTGTGGG - Intergenic
1085791069 11:79498299-79498321 TTCCCTCCATGTCTCTCTGTGGG - Intergenic
1087102358 11:94378091-94378113 ATCCATCTGGGGATCCCTGTGGG + Exonic
1089366080 11:117921858-117921880 TTCCATCCTGATGTCCCTGTTGG - Intronic
1095859966 12:46905719-46905741 TTCCATCCTCATCTCTCTGTTGG - Intergenic
1119912379 14:78361461-78361483 TTTCATCCGCATCTCCCTCTTGG - Intronic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1128808867 15:70555513-70555535 TTCCCTCCAGAGCTCCCTGTGGG - Intergenic
1130242582 15:82210369-82210391 TTCCTCCTGGCTCTCCCTGTTGG + Intronic
1130457810 15:84130498-84130520 TTCCTCCTGGCTCTCCCTGTTGG - Intergenic
1132679553 16:1134165-1134187 TTTGCTCTGGGTCTCCCTGTGGG - Intergenic
1134317787 16:13135518-13135540 TTCCATCCAGATCTCCTTGCTGG + Intronic
1138638937 16:58367387-58367409 TCCTAGCAGGGTCTCCCTGTTGG - Intronic
1141937488 16:87251126-87251148 TTCCCTCAGGGTCTTCCTGTTGG - Intronic
1142222641 16:88863199-88863221 TTCCCTCCGCGTCTCCCCGTGGG - Intergenic
1142222653 16:88863235-88863257 TTCCCTCCGCGTCTCCCCGTGGG - Intergenic
1144355973 17:14446713-14446735 TTCCATTCTGGTCTCTATGTTGG - Intergenic
1144763375 17:17720048-17720070 TTCCACCTGGGTGTCCCTGGTGG + Intronic
1145255359 17:21319322-21319344 TCTCATCCTGGTTTCCCTGTGGG + Intergenic
1145321249 17:21768630-21768652 TCTCATCCTGGTTTCCCTGTGGG - Intergenic
1145765493 17:27456221-27456243 CTCCACCCGGGGCTCCCGGTTGG + Intergenic
1148440743 17:47710543-47710565 TGCCAGCTGGGTTTCCCTGTCGG + Exonic
1152401793 17:80070899-80070921 GTCCATCTGGGCCTGCCTGTGGG + Intronic
1152844454 17:82591264-82591286 TTCCATAGGGGTCTCCATGGAGG + Intronic
1156451761 18:37270591-37270613 TTCCATCACGGGCTCCCTGAAGG + Intronic
1156747235 18:40407081-40407103 TTCCATCCCATTCTCCCTGTGGG - Intergenic
1157689393 18:49668784-49668806 TTCCATCCCACTCTCCCTCTAGG + Intergenic
1162034378 19:7931438-7931460 TTCCAGGGGGGTCCCCCTGTGGG - Intronic
1164014034 19:21236127-21236149 TTAGATCAGGGTTTCCCTGTAGG - Intronic
1166266040 19:41685122-41685144 CTCCATCCTCGTCTCGCTGTGGG - Intronic
1168189675 19:54728536-54728558 TTCACTCCGTGTCTCTCTGTGGG - Intronic
1168461452 19:56562441-56562463 TTCCATGTGGGCCTCTCTGTAGG + Intergenic
925159643 2:1675092-1675114 TTCCATCCAGCAATCCCTGTGGG - Intronic
925284889 2:2709425-2709447 CTCCTTCCAGGGCTCCCTGTTGG - Intergenic
931605709 2:64050177-64050199 TCCAATCCGTGTCTCTCTGTGGG - Intergenic
933633309 2:84680675-84680697 TTCCATTCTGGTCTCCCTGCTGG - Intronic
934517823 2:94999712-94999734 TCCCAGCCGACTCTCCCTGTAGG - Intergenic
935062803 2:99622888-99622910 TTCCACCGGGAGCTCCCTGTCGG - Intronic
941590912 2:167418983-167419005 TTCCATTAGAGTCTCACTGTAGG + Intergenic
945977102 2:216279581-216279603 TTCCATCCGGGTCTCCCTGTTGG - Intronic
946170886 2:217894785-217894807 TTCCACCCAGGTCTGCCTGCTGG - Intronic
1171186824 20:23128855-23128877 TTCCACCAGGGTCACCCAGTGGG - Intergenic
1172303010 20:33863046-33863068 ATCCATGGGGGTGTCCCTGTGGG - Intergenic
1173669676 20:44789994-44790016 TCCCATCCCAGTCTCCCTGCTGG - Intronic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1174819786 20:53716430-53716452 TTCCCTCTGAGTCTTCCTGTTGG + Intergenic
1181394047 22:22605332-22605354 TTCCCTCCAGGTCTCCAGGTAGG + Intergenic
953223970 3:40999485-40999507 ATCCAGCCAGCTCTCCCTGTGGG - Intergenic
956035724 3:65089226-65089248 TTCCAGCCAGGTCTTCCTGTTGG - Intergenic
962378117 3:134875498-134875520 TGCCATCCGGGTTTCCCTGGGGG - Intronic
967555251 3:190849343-190849365 TTCCACCCAAGACTCCCTGTGGG + Intergenic
969706956 4:8817259-8817281 TTCCACCCAGGTCTGCCTGGAGG + Intergenic
969706969 4:8817315-8817337 TTCCACCCAGGTCTACCTGGAGG + Intergenic
971385125 4:26135163-26135185 TTAAATCCAAGTCTCCCTGTGGG - Intergenic
972176353 4:36411484-36411506 TTCCATCAGGGGTTCTCTGTGGG - Intergenic
974290645 4:59925661-59925683 TTCAGTCCGTGTGTCCCTGTGGG + Intergenic
984974141 4:185215352-185215374 TGCCATCCAGTCCTCCCTGTGGG - Intronic
985707964 5:1412516-1412538 CTCCATCCGAGTCTGCCTGCTGG - Intronic
990287146 5:54311138-54311160 TTCCAGCCTGGTGTCCCTGAGGG + Intergenic
999176070 5:149632516-149632538 CTGCATCCGGGCCTGCCTGTGGG + Exonic
1002336997 5:178486648-178486670 TTTCACCCGGCTCTCCCTGTGGG - Intronic
1002439308 5:179256103-179256125 GACCCTCCCGGTCTCCCTGTGGG - Intronic
1003350445 6:5312826-5312848 TTACATCTGGGGCTTCCTGTTGG + Intronic
1004049749 6:12064842-12064864 TTCCATCCCGATTTCCCAGTGGG + Intronic
1004339370 6:14794809-14794831 TTCCATGCGGACGTCCCTGTGGG - Intergenic
1006594292 6:35181834-35181856 TGCCCTCAGGGCCTCCCTGTCGG + Intergenic
1009493611 6:64323829-64323851 ATCCATCCAGATCTCCCTCTAGG + Intronic
1010930120 6:81791373-81791395 TTCCCTCTGGCTCTCCCTCTAGG + Intergenic
1012320921 6:97844484-97844506 TTACATTCGGGTCTCACTCTTGG + Intergenic
1012776513 6:103500864-103500886 TTCTATCAGGGTCTGCTTGTTGG - Intergenic
1018252226 6:161882443-161882465 TTCCCTCCGGGCCTTCCTGCAGG + Intronic
1021094579 7:16521146-16521168 TGCCATGTGGGTCTCCCTGTAGG + Intronic
1021317794 7:19171447-19171469 TTCCATCCAGAACTCCCTGCCGG + Intergenic
1024208415 7:47183238-47183260 TGCCACCTGGCTCTCCCTGTTGG + Intergenic
1029225899 7:99028308-99028330 TTCCAAACAGGCCTCCCTGTCGG - Exonic
1037563976 8:20101393-20101415 TTTCATGCGGGTGTACCTGTAGG + Intergenic
1047192775 8:122693385-122693407 TTCCATCTGCGTCTCCTTTTCGG - Intergenic
1049217981 8:141416514-141416536 TTCCAGCAGCGTCTCCCTGAAGG - Intronic
1049348589 8:142152176-142152198 TTCCTTCCGGCTCTTCCTGGAGG - Intergenic
1058835291 9:108854757-108854779 TTCCATCCTGGCCTCCCTGCAGG - Exonic
1061807900 9:133146793-133146815 TGCCATGTGGGTCTCTCTGTAGG - Intronic
1189654664 X:43230964-43230986 TTCCATCTGTGTATCCCTTTAGG - Intergenic
1191894763 X:65980352-65980374 TTCCATCTGAGTCTCCGTGTAGG - Intergenic