ID: 945977237

View in Genome Browser
Species Human (GRCh38)
Location 2:216280428-216280450
Sequence CTACGCACTGAGTGTGACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 88}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945977234_945977237 -5 Left 945977234 2:216280410-216280432 CCTGATTGGGTTCCGCTCCTACG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 945977237 2:216280428-216280450 CTACGCACTGAGTGTGACCTAGG 0: 1
1: 0
2: 0
3: 9
4: 88
945977232_945977237 1 Left 945977232 2:216280404-216280426 CCCGATCCTGATTGGGTTCCGCT 0: 1
1: 0
2: 0
3: 0
4: 46
Right 945977237 2:216280428-216280450 CTACGCACTGAGTGTGACCTAGG 0: 1
1: 0
2: 0
3: 9
4: 88
945977233_945977237 0 Left 945977233 2:216280405-216280427 CCGATCCTGATTGGGTTCCGCTC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 945977237 2:216280428-216280450 CTACGCACTGAGTGTGACCTAGG 0: 1
1: 0
2: 0
3: 9
4: 88
945977229_945977237 21 Left 945977229 2:216280384-216280406 CCAACTGAGGGATCAGATGACCC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 945977237 2:216280428-216280450 CTACGCACTGAGTGTGACCTAGG 0: 1
1: 0
2: 0
3: 9
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945977237 Original CRISPR CTACGCACTGAGTGTGACCT AGG Intronic
903230879 1:21921716-21921738 CTCCCTACTGAGTGTGTCCTGGG + Intronic
904038061 1:27569233-27569255 CTCCACACTGTGTGTGACCTTGG + Intronic
904392302 1:30194107-30194129 CCACACACTGGCTGTGACCTTGG - Intergenic
905737382 1:40339089-40339111 CCACATACTGACTGTGACCTTGG + Intergenic
905879289 1:41453169-41453191 CTGCACACAGACTGTGACCTTGG - Intergenic
907477736 1:54716915-54716937 CTTCTCACTGAGCCTGACCTTGG - Intronic
910758532 1:90714417-90714439 CTAAGGACTGAGAGTGACCCTGG - Intronic
911464374 1:98233397-98233419 CTCCTCACTGGGTGGGACCTTGG + Intergenic
917991030 1:180378906-180378928 CTAGGTAATGAGTGTGACATGGG - Intronic
918886579 1:190201635-190201657 CTACACACAGCATGTGACCTTGG - Intronic
920175542 1:204099202-204099224 CTACTCACTGGCTATGACCTTGG + Intronic
920720812 1:208385119-208385141 TTAAGCATTGAGTGTGCCCTGGG - Intergenic
1067555074 10:47263920-47263942 ATACTCACTGAGTGTAAACTGGG + Intergenic
1070705135 10:78631972-78631994 CTGTGCACTGAGTGTGACGTGGG + Intergenic
1070834372 10:79438651-79438673 CTAAGCACTGACTGTGTCCAGGG - Intronic
1076338469 10:129726488-129726510 CAAAACACTGAATGTGACCTGGG - Intronic
1076379517 10:130015496-130015518 CCCTGCACTGAGTGTGACCTGGG - Intergenic
1076837600 10:133028947-133028969 CTGCTCACTCAGTGTGAACTGGG - Intergenic
1079112332 11:17611972-17611994 CGATGCACTTAGTGTGAGCTCGG - Intronic
1080922491 11:36722969-36722991 ATCCTCACTCAGTGTGACCTTGG - Intergenic
1084376587 11:68782328-68782350 TTACGCACTTACTGTGACCTGGG - Intronic
1089585138 11:119505798-119505820 CTTCTCACTCTGTGTGACCTGGG - Intergenic
1090567150 11:128006932-128006954 CTCCTCACTGGGTGGGACCTTGG + Intergenic
1105444271 13:20438830-20438852 CTGCGAGCTCAGTGTGACCTTGG - Intronic
1112246820 13:97742855-97742877 CAAGGCACTGAGTGTGTCCTGGG - Intergenic
1113152184 13:107276156-107276178 CTTCCCACTGAGTGTGGGCTGGG - Intronic
1123433964 15:20241432-20241454 CTAAGCACTTTGTGTGACCAAGG + Intergenic
1129207566 15:74046039-74046061 CTGTGCAGTGAGTGTGGCCTAGG + Exonic
1131513050 15:93060174-93060196 CCAGCCACTGAGTGTGTCCTTGG + Intronic
1132622079 16:872596-872618 CTCCGTCCTGAGTGTGACCAGGG + Intronic
1134077241 16:11300408-11300430 ATATCCTCTGAGTGTGACCTGGG - Intronic
1134809252 16:17153288-17153310 CCACTCACAGTGTGTGACCTTGG - Intronic
1135436301 16:22428863-22428885 CTGGGGACTGACTGTGACCTTGG + Intronic
1135465903 16:22684541-22684563 CTAGGCACTGAATGTGATTTGGG + Intergenic
1136850654 16:33609678-33609700 CTAAGCACTTTGTGTGACCAAGG - Intergenic
1137692723 16:50440806-50440828 CTGGGAACTGAGTGTGACTTGGG - Intergenic
1138430412 16:56964797-56964819 CCACGCCCTCTGTGTGACCTTGG + Intronic
1139752965 16:69120284-69120306 CCACCCACTGGGTGTGAACTCGG - Exonic
1203112267 16_KI270728v1_random:1458132-1458154 CTAAGCACTTTGTGTGACCAAGG - Intergenic
1142999751 17:3785442-3785464 CTAGGCACAGAGTGAGACTTGGG + Intronic
1151282508 17:73087529-73087551 CTGCGGACTGAGGGTGATCTGGG + Intronic
1155541441 18:26872602-26872624 TCACCCACTGAGTGTGGCCTTGG - Intergenic
1157343918 18:46806217-46806239 CTACTCATTCACTGTGACCTTGG + Intergenic
1161734449 19:5982498-5982520 CTACACACTGTGGGTGACCAGGG - Intergenic
1165030180 19:32992556-32992578 CTAAGCACTTTGTGTGACCAAGG + Intronic
927222716 2:20728785-20728807 CTACCCAGTGTGTGTAACCTTGG - Intronic
929007936 2:37413757-37413779 CCACTCCCTGACTGTGACCTTGG - Intergenic
935466705 2:103406621-103406643 CCATTCACTCAGTGTGACCTTGG + Intergenic
935738085 2:106122249-106122271 GTTCTCACTGAGTGTGTCCTTGG - Intronic
937048538 2:118868248-118868270 CTACCCACTAAGTGTGGGCTGGG + Intergenic
945977237 2:216280428-216280450 CTACGCACTGAGTGTGACCTAGG + Intronic
946142665 2:217704890-217704912 CTTCTTACTCAGTGTGACCTTGG - Intronic
947673355 2:231956303-231956325 TTACTCACTGTGTGTGACCTTGG - Intergenic
1173932789 20:46835589-46835611 CCACCCACTGTCTGTGACCTTGG + Intergenic
1174954299 20:55079810-55079832 CTAAGCACTGAGAGTGGGCTGGG + Intergenic
1181497925 22:23298455-23298477 CACCACACTCAGTGTGACCTGGG + Intronic
1184040973 22:41943425-41943447 CTACTCACTGGCTATGACCTGGG - Intronic
1184405527 22:44298558-44298580 CCACGCACTGAGCGTGAGCAGGG - Intronic
950028661 3:9837561-9837583 CTAGGCAGTGGGTGTGATCTTGG + Intronic
955411959 3:58661518-58661540 CCACTTACTGAGGGTGACCTGGG - Intronic
955864829 3:63371718-63371740 CTCCTCACTGAGTGGGACCCTGG + Intronic
956089566 3:65651457-65651479 CAAGGCACTGAGTGTTTCCTGGG - Intronic
960137965 3:114124583-114124605 TTACTGACTGTGTGTGACCTGGG + Intergenic
962120169 3:132552871-132552893 CTCCCCACTGAGTGTGAGTTTGG + Intergenic
965678205 3:171222114-171222136 CTCCTTACTGATTGTGACCTTGG - Intronic
967937243 3:194738869-194738891 CTAGGCACTGATTTTGACCCTGG - Intergenic
977324110 4:95553458-95553480 ATACTAACTGTGTGTGACCTTGG - Intergenic
978834399 4:113131269-113131291 ATAGGCACTGAGTGTGAACAAGG - Intronic
979050083 4:115919440-115919462 CAAAGCAGTGAGTGTGAACTTGG + Intergenic
990547130 5:56834258-56834280 CTAGGAACTGAGTGAGCCCTAGG + Intronic
992052593 5:72955439-72955461 CCAGGCACTGAGTGCGGCCTCGG - Intergenic
997582510 5:135026696-135026718 CTACTGGCTCAGTGTGACCTTGG + Intergenic
997630693 5:135366671-135366693 AAACTCACTGAGTGTGCCCTGGG + Intronic
999228608 5:150047999-150048021 CTCCTTACTGTGTGTGACCTTGG + Intronic
999466739 5:151814258-151814280 CTACGCATTTAGTTTGTCCTAGG - Intergenic
999889090 5:155957346-155957368 CTAAGGAGAGAGTGTGACCTTGG - Intronic
1005066437 6:21822432-21822454 CTATTAACTGTGTGTGACCTTGG + Intergenic
1005979131 6:30822940-30822962 CTAGGCACTGAGTGTTCCCTTGG - Intergenic
1007262684 6:40574943-40574965 CTTCGCCATGAGTGTGACCTGGG + Intronic
1007291732 6:40792524-40792546 CTATGCACTCAATGTGATCTTGG + Intergenic
1012410302 6:98948199-98948221 CTACCCGCTGTGTATGACCTAGG - Intergenic
1019306857 7:339751-339773 CTGGGCACTGAGTGTGTGCTGGG - Intergenic
1037916687 8:22777382-22777404 CTAAGCTGTGAGAGTGACCTGGG + Intronic
1039455210 8:37701298-37701320 CTACGCACTGCACTTGACCTCGG - Intergenic
1048949793 8:139486662-139486684 CAACCCACTGATTGTGACTTTGG - Intergenic
1049204125 8:141355471-141355493 CTACACACTCAGGGTGACCGTGG - Intergenic
1050152758 9:2633394-2633416 CTAGGCACTCAGAGTGGCCTGGG - Intronic
1053348207 9:37393772-37393794 AGACTCACTGTGTGTGACCTGGG - Intergenic
1060638261 9:125217101-125217123 CTATGCACTAACTATGACCTTGG + Intronic
1060971998 9:127743610-127743632 CTAGGCCCAGTGTGTGACCTTGG - Intronic
1062162665 9:135088512-135088534 TCACTCGCTGAGTGTGACCTTGG - Intronic
1186300045 X:8190665-8190687 CTATGAACTCAGTGTGACCTTGG + Intergenic
1189794427 X:44633813-44633835 CCACCCACTGGGTGTGAACTCGG + Intergenic
1190640215 X:52477137-52477159 CTCCGCACTAAGGGTGACGTGGG + Intergenic
1190647457 X:52535728-52535750 CTCCGCACTAAGGGTGACGTGGG - Intergenic
1191755978 X:64592840-64592862 CTACTGGCTGTGTGTGACCTGGG + Intergenic
1197958853 X:131981999-131982021 CTAACTACAGAGTGTGACCTAGG - Intergenic
1198032286 X:132765061-132765083 CTAAGCACTGGGTAAGACCTGGG + Intronic