ID: 945980546

View in Genome Browser
Species Human (GRCh38)
Location 2:216307117-216307139
Sequence GGCCCCAGGAACCACCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 326}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945980538_945980546 3 Left 945980538 2:216307091-216307113 CCGCCCTGGTAGGTGAGTCCCAC 0: 1
1: 0
2: 2
3: 15
4: 120
Right 945980546 2:216307117-216307139 GGCCCCAGGAACCACCTGGAAGG 0: 1
1: 0
2: 2
3: 23
4: 326
945980539_945980546 0 Left 945980539 2:216307094-216307116 CCCTGGTAGGTGAGTCCCACAGC 0: 1
1: 0
2: 0
3: 9
4: 107
Right 945980546 2:216307117-216307139 GGCCCCAGGAACCACCTGGAAGG 0: 1
1: 0
2: 2
3: 23
4: 326
945980540_945980546 -1 Left 945980540 2:216307095-216307117 CCTGGTAGGTGAGTCCCACAGCG 0: 1
1: 0
2: 1
3: 5
4: 73
Right 945980546 2:216307117-216307139 GGCCCCAGGAACCACCTGGAAGG 0: 1
1: 0
2: 2
3: 23
4: 326
945980534_945980546 14 Left 945980534 2:216307080-216307102 CCTCTCTCCTCCCGCCCTGGTAG 0: 1
1: 0
2: 0
3: 25
4: 339
Right 945980546 2:216307117-216307139 GGCCCCAGGAACCACCTGGAAGG 0: 1
1: 0
2: 2
3: 23
4: 326
945980537_945980546 4 Left 945980537 2:216307090-216307112 CCCGCCCTGGTAGGTGAGTCCCA 0: 1
1: 0
2: 0
3: 17
4: 149
Right 945980546 2:216307117-216307139 GGCCCCAGGAACCACCTGGAAGG 0: 1
1: 0
2: 2
3: 23
4: 326
945980536_945980546 7 Left 945980536 2:216307087-216307109 CCTCCCGCCCTGGTAGGTGAGTC 0: 1
1: 0
2: 0
3: 6
4: 100
Right 945980546 2:216307117-216307139 GGCCCCAGGAACCACCTGGAAGG 0: 1
1: 0
2: 2
3: 23
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945980546 Original CRISPR GGCCCCAGGAACCACCTGGA AGG Intronic
900358121 1:2274535-2274557 CTCCCCAGGGGCCACCTGGATGG + Intronic
900583093 1:3418943-3418965 GTGCCCAGGAACCTTCTGGAAGG + Intronic
900635485 1:3662815-3662837 GGCCCCAGGACAGACCTGGCTGG + Intronic
901052235 1:6431005-6431027 GGCTCCAGGACCCTCCTGGGAGG - Intronic
902041897 1:13498742-13498764 CACCCCAGGAAACACCTGCAGGG - Intronic
902274672 1:15330920-15330942 TGCCCCAGGAGCCACTTGGCGGG + Intronic
902481996 1:16717006-16717028 GGCCCCAGGACCCTCCTGGGAGG + Intergenic
902482436 1:16718881-16718903 GGCCCTAGGACCCACCAGGCCGG - Intergenic
902515080 1:16985833-16985855 TGCCCCTGGAACCCCCTGGGGGG - Intergenic
903222125 1:21874876-21874898 GGGCCCAGGACTCACCTGGCAGG + Exonic
904079425 1:27862718-27862740 GAACCCAGCACCCACCTGGAGGG + Intergenic
906470274 1:46124029-46124051 GGCCCCAGTAAACACTGGGAAGG + Intronic
907872415 1:58455133-58455155 GATCCCAGGAAACACCTGCAGGG + Intronic
907899087 1:58721026-58721048 GGCCCTAGGAATCACCAGGGAGG + Intergenic
909374513 1:74924332-74924354 GGCTCCAGGACCCAGCTGGGAGG - Intergenic
910228078 1:84956892-84956914 AGCTCCAGGAACTGCCTGGAGGG - Intronic
912942469 1:114057114-114057136 TGCCACAGTAGCCACCTGGAAGG - Intergenic
914246657 1:145891340-145891362 GGCCTCAGGAACAGCCTGGGAGG + Exonic
915349241 1:155214190-155214212 AGCCCCTGGCACCACCTAGAGGG + Intergenic
915352428 1:155234817-155234839 AGCCCCTGGCACCACCTAGAGGG + Exonic
915590960 1:156869980-156870002 GGCCCCTGGAACCATGTTGAGGG + Intronic
915720981 1:157985413-157985435 GGCTCTAGGAACCAACGGGAAGG + Intergenic
916103048 1:161409235-161409257 GGCCCCAGGTCTCACCTCGAAGG - Intergenic
916414331 1:164578581-164578603 GGCCCCTGGAAGCTCCTTGAGGG - Intronic
918433440 1:184486207-184486229 TGGCCCAGGAACCACCTAAAAGG - Intronic
920172640 1:204081501-204081523 GGCCCCACGGACCCCCTGGCGGG + Intronic
920329542 1:205196064-205196086 GGACACAGGAACCAGCTTGAAGG + Intronic
920989310 1:210921605-210921627 GACCTCAGGAACCACCCAGATGG - Intronic
923022845 1:230178304-230178326 GGCCCCTGGCAGTACCTGGAGGG - Exonic
924255680 1:242180599-242180621 GTCCATAGGAATCACCTGGACGG + Intronic
1063133421 10:3197142-3197164 GGCCTGAGGACCCACCTGCAGGG - Intergenic
1065655283 10:27941987-27942009 GGCCCCAGGAAAGACGGGGATGG + Intronic
1067720257 10:48722792-48722814 GACCCCAGGAAGCTCCTGGCAGG + Intronic
1069588801 10:69629716-69629738 GGCAGAAGGAACCACCTGCAGGG - Intergenic
1070555618 10:77525566-77525588 GGCCCCAGGCACCAGCTGTGTGG - Intronic
1071825655 10:89322839-89322861 TCTCCCAGGAAGCACCTGGAGGG + Intronic
1071831591 10:89377684-89377706 CGTCCCTGGAACCACCTGGCGGG + Intronic
1072201717 10:93166069-93166091 GATCCCAGGAAACACCTGCAAGG + Intergenic
1072634018 10:97165771-97165793 GGCCCCAGGACCCAGATGGTGGG - Intronic
1072723712 10:97798062-97798084 TTCCACTGGAACCACCTGGAAGG + Intergenic
1075048103 10:119162032-119162054 GGCTCCAGGAATCAGCTGCAGGG + Intronic
1075590178 10:123685423-123685445 GGCGCAGGGAACCACCTGCATGG + Intronic
1075728434 10:124622566-124622588 GGCCCAAGGAACGATTTGGAGGG - Exonic
1075881241 10:125853117-125853139 GCCCCCGTGAACCACCTGTAAGG - Exonic
1076713896 10:132353713-132353735 GGGCCCAGGGAGCACCGGGAAGG + Intronic
1077037732 11:503402-503424 GGCCCCTGGTACCAACTGGGAGG + Exonic
1077101936 11:826259-826281 GGCCCCTGCACCCACCTGAAGGG - Intronic
1077158675 11:1102855-1102877 GGGCCCAGGACACACCTGGAGGG - Intergenic
1077429793 11:2510696-2510718 GGCCTCAGAGACCAGCTGGAAGG - Intronic
1077470875 11:2759931-2759953 GGCCTCAGGATCTGCCTGGATGG + Intronic
1077489347 11:2853277-2853299 GGCCCCAGAAGGCACCAGGATGG - Intergenic
1077598356 11:3554187-3554209 GACCCCAGGAATATCCTGGAAGG - Intergenic
1078128644 11:8593883-8593905 GGCCCCAGGAGACACTCGGAGGG + Intronic
1078540501 11:12209577-12209599 GGCCGCAGGAACACCCTGGAAGG + Exonic
1079569325 11:21922830-21922852 GGCCCCAGTCACTCCCTGGAAGG + Intergenic
1079981289 11:27154022-27154044 ATCCCCAGGCACCACCTGGGAGG + Intergenic
1080933389 11:36837231-36837253 TCCCCCAGGAAGCACCTGAATGG - Intergenic
1083694947 11:64436549-64436571 GGCCCCAGGAACCCCCTCCAGGG - Intergenic
1083981271 11:66172586-66172608 AGCCCCAGCCACCAACTGGATGG + Intronic
1084254436 11:67930051-67930073 GACCCCAGGAATATCCTGGAAGG - Intergenic
1084524458 11:69687003-69687025 GACCCCAGGAACCACAGGGCAGG + Intergenic
1084785305 11:71438533-71438555 TGCTCCAGGAACCCCCTGTAGGG - Intronic
1084785908 11:71441570-71441592 GGCCCCAGGAACCATCTCTGAGG + Intronic
1084818432 11:71665832-71665854 GACCCCAGGAATATCCTGGAAGG + Intergenic
1087729253 11:101759943-101759965 TGCCCCAGGAAGCACCAGTAGGG + Intronic
1088830495 11:113532332-113532354 GCCCCCAGGAACCCCCAGGAAGG - Intergenic
1089149147 11:116351338-116351360 GCCCCCAGGGACCACAAGGATGG + Intergenic
1089184233 11:116604006-116604028 AGCCCCAGGCAGAACCTGGAGGG + Intergenic
1090251774 11:125256527-125256549 GGCACCAGGAACTCACTGGATGG - Intronic
1093547133 12:20361556-20361578 GGGCCCAGGAAAGACTTGGATGG + Intergenic
1094204287 12:27824261-27824283 TGCCCCAAGCCCCACCTGGAAGG - Intergenic
1094796802 12:33983382-33983404 GGCACCAGGAAACATTTGGAAGG + Intergenic
1094858434 12:34431679-34431701 GGGCCCAGGGACCAACTTGAGGG - Intergenic
1096688925 12:53307609-53307631 GGGCCCAGGAACCCCCTGCTGGG - Exonic
1096925041 12:55135149-55135171 TGTCCTGGGAACCACCTGGATGG + Intergenic
1098594776 12:72259323-72259345 GGATCCAGGAGCCACCTTGAAGG - Intronic
1101235549 12:102785617-102785639 TGGTCCAGGAACCACATGGAAGG + Intergenic
1102414660 12:112750304-112750326 GGTCCCAGGAAACACTAGGAGGG + Intronic
1103049730 12:117768630-117768652 GGCTCCTGGAAGCATCTGGATGG + Intronic
1104492133 12:129203487-129203509 GGTCCCAGGAAGCATGTGGAGGG + Intronic
1104929513 12:132330155-132330177 GGGCCCTGGAGCCACCAGGAGGG + Intergenic
1104958453 12:132477067-132477089 GGAGCCGGGAGCCACCTGGAGGG - Intergenic
1106128447 13:26920377-26920399 GGCCCCTGGAGCCATCTGGGTGG + Intergenic
1107815783 13:44243276-44243298 TGCCGCAGGAAGCACCTGCACGG - Intergenic
1108233105 13:48370887-48370909 GCCCCTAGGAAGCATCTGGATGG - Intronic
1108941802 13:55964306-55964328 TGTCCCAGGAAACACCAGGATGG + Intergenic
1109073843 13:57806847-57806869 CACCTCAGGAACCACCTAGAGGG + Intergenic
1112167689 13:96937061-96937083 AGCCCCAGCCACCACCTTGATGG - Intergenic
1113715952 13:112508052-112508074 GGCCCCAGGCAGCACTGGGATGG - Intronic
1113810448 13:113139072-113139094 GACCACAGGGACCAACTGGAAGG - Intronic
1113855987 13:113445702-113445724 GGCCCCAGCCACCAGCAGGAAGG - Intronic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1115392244 14:32866489-32866511 TGTCCCAGAAAACACCTGGATGG - Intergenic
1118005595 14:61562131-61562153 GGCTCCAGGAAGCACATGAAGGG + Intronic
1118297606 14:64585015-64585037 GGCCCCAGTAACCACCTCTTTGG + Intronic
1119727933 14:76933357-76933379 AGCCCCAGGGCCCAGCTGGAGGG + Intergenic
1124377315 15:29136351-29136373 GGCCCCAGGCCTCACCTGGCTGG + Exonic
1124632852 15:31347219-31347241 GGGCCTGGGAACCTCCTGGAGGG + Intronic
1124936592 15:34178365-34178387 GGCCCCATGAATCTCCTGGTGGG - Intronic
1124995601 15:34720419-34720441 TGACCCAGGAATCACCTGAAAGG - Intergenic
1125687080 15:41569932-41569954 AGCCCCTTGAACCAGCTGGATGG + Intronic
1125721329 15:41846530-41846552 GGACCCAGGGCCCACCTGCAGGG + Intronic
1127946989 15:63765358-63765380 GCCCCCAGCAACCATCTGAATGG + Intronic
1128555845 15:68631149-68631171 GCTCCCAGGGAACACCTGGATGG + Intronic
1128665865 15:69538065-69538087 GGCCTCAGGCACCAGCTGAAAGG + Intergenic
1129393691 15:75233208-75233230 GGCTCCAGGGACCACGGGGAAGG - Intergenic
1130094020 15:80842889-80842911 GACCCCTGGGACCTCCTGGAAGG - Intronic
1131248273 15:90814559-90814581 AGCCCCAGGAAGCCCCAGGAAGG - Intronic
1132126038 15:99225492-99225514 GGACTCAGGAGCCAGCTGGAAGG + Intronic
1132344877 15:101102156-101102178 GGCCCGAGGACCCAGCTAGAGGG + Intergenic
1132427496 15:101730829-101730851 GGGCACAGGAACCAGCTTGAAGG + Intergenic
1132734187 16:1377512-1377534 GGCCCCAGAAAACAGCTGCAGGG - Intronic
1132871781 16:2118618-2118640 GGGCCCAGGTCCCACCTGGCTGG + Intronic
1133114272 16:3567276-3567298 GGCCCCAGGAACTCAATGGATGG + Intronic
1133223124 16:4327747-4327769 GGCCGCGGGGACCACCGGGACGG - Intronic
1133237205 16:4392860-4392882 GGCCCCAGCCAGCAGCTGGAAGG + Intronic
1133347655 16:5081215-5081237 GGCCCCTGGGGCCACCTGGCAGG - Intronic
1133373749 16:5266473-5266495 GACCCCAGGAATATCCTGGAAGG + Intergenic
1134520746 16:14918277-14918299 GGGCCCAGGTCCCACCTGGCTGG - Intronic
1134550829 16:15137696-15137718 GGGCCCAGGTCCCACCTGGCTGG + Intronic
1134708418 16:16316928-16316950 GGGCCCAGGTCCCACCTGGCTGG - Intergenic
1134715633 16:16356961-16356983 GGGCCCAGGTCCCACCTGGCTGG - Intergenic
1134951184 16:18351717-18351739 GGGCCCAGGTCCCACCTGGCTGG + Intergenic
1134959124 16:18395198-18395220 GGGCCCAGGTCCCACCTGGCTGG + Intergenic
1136189409 16:28606717-28606739 GCCCCCAGGAGTCACATGGAGGG + Intronic
1136576766 16:31129947-31129969 GGCCGCTGGAACCAGCTGGGTGG + Intronic
1138433739 16:56985687-56985709 GGCCTCAGAAAGCACTTGGAAGG - Intergenic
1138449426 16:57084590-57084612 GGGGCCAGGAACAACCTGGAGGG - Intergenic
1138459760 16:57141223-57141245 GGCCCCAGGAAAGGCCAGGAAGG + Intronic
1138522049 16:57576633-57576655 GACCCCATGCACCAGCTGGAGGG + Exonic
1139478222 16:67213794-67213816 GACCTCAGGAGCCACCTGGGAGG - Intronic
1139705533 16:68738090-68738112 GCCCCCAGGAACTCCCGGGAGGG - Intronic
1139775020 16:69311525-69311547 GGCCGCACGAAGTACCTGGAGGG - Exonic
1139927349 16:70497159-70497181 GGCCTCAGGAATCAACAGGAAGG + Intronic
1140455317 16:75101971-75101993 AGCCCGAGGACCCACCTGAAAGG - Intronic
1140477956 16:75248459-75248481 GCACCCGGGACCCACCTGGAGGG + Intronic
1141025329 16:80541203-80541225 GGCTCCAGGATCTTCCTGGAGGG + Intronic
1141482022 16:84313146-84313168 GGGCCCAGGACCTACCTGGCGGG - Exonic
1141660837 16:85440710-85440732 GGCCCCAGGAACCATCACGGGGG + Intergenic
1142088504 16:88197621-88197643 GGCCCCAGGAACCATGGGGAGGG - Intergenic
1142213046 16:88817489-88817511 GGCCCCAGGGCCCACCTGCGAGG - Intronic
1142470715 17:161848-161870 GGCCCCAGGAAGCACCTTCAGGG + Intronic
1142763773 17:2055231-2055253 GGCTCGAGGACCCACCTGGGGGG - Intronic
1143718558 17:8794095-8794117 AGGCCCAGGAACCACCAGGCTGG + Intergenic
1145271410 17:21406823-21406845 GGCCCCATGAACTCCCTGGCTGG + Intronic
1147456627 17:40542103-40542125 GGCCCCAGCCAACACCTTGATGG - Intergenic
1148469009 17:47882023-47882045 GACCTCTGGTACCACCTGGATGG - Intergenic
1148912528 17:50950456-50950478 TGCCGCAGGCACCCCCTGGACGG + Intergenic
1150382842 17:64734204-64734226 CTCCCCAGGAACACCCTGGAGGG - Intergenic
1150773326 17:68059940-68059962 CTCCCCAGGAACACCCTGGAGGG + Intergenic
1151389599 17:73777162-73777184 GGCCCGAAGAACAAACTGGAAGG - Intergenic
1151823436 17:76509843-76509865 GGACACAGGAGCCAGCTGGAAGG + Intergenic
1152165967 17:78706302-78706324 CGCCCCAGCAACCACCTCGGAGG + Intronic
1152335036 17:79695870-79695892 CCCCCCAGAAACCACATGGATGG + Intergenic
1152793962 17:82297911-82297933 GGCCCCAGGTTCCTCCTGGACGG + Intergenic
1152811735 17:82385717-82385739 GGCCCCAGGCACAGCCTGGGTGG - Intergenic
1154290464 18:13102054-13102076 GGCACCAGGAACCCCCAGAAGGG - Intronic
1154470152 18:14692994-14693016 GGCCACAGGCACCATATGGAGGG - Intergenic
1155404483 18:25472951-25472973 CTCTCCAGGGACCACCTGGAGGG - Intergenic
1156577433 18:38334297-38334319 GGCACCAGGCACCACTTTGATGG - Intergenic
1157003869 18:43559254-43559276 TGTCCCAGGAAGCACCTGGATGG - Intergenic
1157003893 18:43559395-43559417 AGTCCCAGAAAACACCTGGATGG - Intergenic
1160236939 18:77093246-77093268 GGTCCCAGGGGCCACCTCGAGGG + Intronic
1160682344 19:417648-417670 GACCCCAGAAATAACCTGGAAGG - Intronic
1160738860 19:676882-676904 GGCACCAGGACCGACCCGGACGG - Intronic
1160972421 19:1775535-1775557 GCCCCCAGGGGGCACCTGGAGGG + Exonic
1161065068 19:2233451-2233473 GGCCCCAGGATCCACCTAACTGG - Exonic
1161325581 19:3662123-3662145 AGCCCCGGGGACCACCAGGAGGG - Intronic
1161403357 19:4078561-4078583 TGGCCCAGAAACCACCGGGAAGG + Intergenic
1161509360 19:4662057-4662079 GGCCCCAGGAGGCATCAGGAGGG - Intronic
1161729818 19:5952411-5952433 AGTCCCAGGAACCACCTTAAAGG - Intronic
1162496230 19:11024787-11024809 GGCCCCAGGCCCCACCTGCCTGG + Intronic
1162636657 19:11974011-11974033 GGCACCAGCAAACACCTGGTGGG - Intronic
1163629895 19:18412947-18412969 GACCCCAGGAAGCTCCTGGTAGG + Intergenic
1163698262 19:18774791-18774813 GGCCCCTGGAACCTCCCAGACGG - Intronic
1163767924 19:19173561-19173583 GGCCCAAGGAACCCCCAGGCTGG - Intronic
1164792128 19:30996346-30996368 GACCCCAGGAAGCACCAGTAGGG + Intergenic
1165138879 19:33687542-33687564 GGCCGCAGGAACCAACTGCTCGG + Intronic
1165749831 19:38253057-38253079 GGCCCCAGGGCCCAGCTGGCGGG + Intronic
926395936 2:12442315-12442337 GGCCCCAGGAGCCACTGAGATGG + Intergenic
927164219 2:20300489-20300511 GCCCCCAGCAACCATCTGAATGG - Intronic
927640376 2:24841879-24841901 GTCCCCAGGCACCACAGGGAGGG - Intronic
929943735 2:46354615-46354637 GCACCCAGCAACCACCTGTACGG + Intronic
930057043 2:47260099-47260121 TGCCCCATCAACCACCTGGCAGG - Intergenic
932413028 2:71558452-71558474 GGCCCCAGATCCCACCTGCAAGG + Intronic
932486135 2:72085400-72085422 GGCTCCAGCAACCCCCTGGGAGG + Intergenic
932604105 2:73152604-73152626 GGACACAGGAACCAACTTGAAGG + Intronic
932619225 2:73256062-73256084 GGCCCCAGTACCTACCTGGGAGG - Exonic
932701852 2:73997571-73997593 GGACCCAGGATACACCAGGAAGG - Intronic
939572446 2:143856590-143856612 GGAATCAGGAACCACTTGGATGG + Intergenic
941896691 2:170636439-170636461 GGCTCCAGGCACCATCTGGAAGG - Intronic
944725951 2:202471122-202471144 GGACACAGGAGCCAGCTGGAAGG + Intronic
945980546 2:216307117-216307139 GGCCCCAGGAACCACCTGGAAGG + Intronic
946546245 2:220747253-220747275 GACCCAAGGAATCACCTGAAAGG - Intergenic
947772515 2:232681886-232681908 CACCCCAGGACCCTCCTGGAGGG - Exonic
947875048 2:233462251-233462273 CGGCCCAGGTACCACCTGGAGGG - Intronic
948559906 2:238845914-238845936 GGCCCCGGGGACGCCCTGGAAGG - Intergenic
948788851 2:240366668-240366690 GGCCGCAGGGATCATCTGGAAGG + Intergenic
949007722 2:241659300-241659322 GGCCCCACGGAGCACCTGCACGG - Intronic
1169016516 20:2297148-2297170 GGCCTCAGCCACCTCCTGGAGGG - Intronic
1170119447 20:12895652-12895674 GATCCCAGGAGGCACCTGGAGGG - Intergenic
1170863127 20:20127719-20127741 GGCCCCATCCACCACCTGGCAGG - Intronic
1172215463 20:33232694-33232716 GGCACCAGGAAACAAGTGGAAGG - Intergenic
1173015708 20:39223594-39223616 GGCCCCAGCTACCAGCTGGCAGG + Intergenic
1173050351 20:39553499-39553521 GGCCCCAGCAATCCCCTGGGTGG + Intergenic
1173177838 20:40777860-40777882 GGTCCCAGGAAGCACCAGTAGGG + Intergenic
1173661511 20:44737556-44737578 AGCCCTAGGAAGGACCTGGAAGG + Intergenic
1175344210 20:58259906-58259928 GGCCCTGGGAACCACTTGTATGG + Intergenic
1175519111 20:59588402-59588424 GGCCCCAGGGACCAGGGGGACGG - Intronic
1176852289 21:13929986-13930008 GTCCCCAGTAAACACCTGGTTGG - Intergenic
1179642856 21:42758735-42758757 CGCCCCAGGATCCACCTGCCAGG + Intronic
1179981122 21:44896549-44896571 GGCCCCAGGAGCTCCATGGAAGG - Intronic
1180189285 21:46154896-46154918 GGCCCTAAGGGCCACCTGGAAGG - Intronic
1181161611 22:20963185-20963207 GGCCCCAGGAAGACCCAGGAGGG - Intergenic
1181164624 22:20976719-20976741 TCCCCCAGGAACCTCCTGAAGGG - Exonic
1181480931 22:23198641-23198663 TGCCCCAGGCACCACCAGCATGG - Intronic
1181789026 22:25248668-25248690 GGACACAGGAACCAGCTTGAAGG - Intergenic
1182004364 22:26946985-26947007 GGTCCCAGGAAACACCAGAAAGG - Intergenic
1183377240 22:37472428-37472450 AGCCCCCAGACCCACCTGGAGGG + Exonic
1183617928 22:38956332-38956354 GGCAGCAGGAGCCACCGGGAAGG + Intronic
1183647584 22:39135298-39135320 GAGCCCAGGAGCCCCCTGGAGGG - Intronic
1183658653 22:39205749-39205771 GGACCCAGGTTCCAGCTGGAGGG + Intergenic
1184139662 22:42571249-42571271 GGCGCCAGGAATCTCCGGGAGGG + Intronic
1184586075 22:45448941-45448963 GGCCCCTGGAACCTCCTGAGGGG + Intergenic
1184731830 22:46374903-46374925 GGCCTCGGGAAGCACCTGGGAGG + Intronic
1184846412 22:47090531-47090553 AGGCCCAGCATCCACCTGGAGGG - Intronic
1185360249 22:50402406-50402428 GGCCCCAGGAGCCATAAGGAAGG + Intronic
950019272 3:9775581-9775603 TGCACCAGGAATCACCTAGAAGG + Intronic
950664536 3:14487286-14487308 GTCCCCAGGCCCCGCCTGGAAGG + Exonic
950713554 3:14831393-14831415 CACCCCAAGAACCACTTGGAAGG - Intronic
950752092 3:15137660-15137682 GACCCCAGGAATATCCTGGAAGG + Intergenic
953853115 3:46480899-46480921 GCCCCCATGGCCCACCTGGAGGG - Intronic
954450860 3:50570999-50571021 GGCCCCTGGACCCAGCTGGGTGG - Exonic
957068515 3:75546625-75546647 GACCCCAGGAATATCCTGGAAGG - Intergenic
958610348 3:96416693-96416715 TGTCCCAGGAAGCACCTAGATGG - Intergenic
959147018 3:102559371-102559393 GGACACAGGAAGAACCTGGATGG - Intergenic
959943595 3:112104859-112104881 TGCCCCAGGAAGCAGGTGGAAGG - Intronic
960117010 3:113905220-113905242 GGCCAAAGGAACCAACTTGAAGG - Intronic
960568089 3:119156490-119156512 TCTCCCAGGAAGCACCTGGATGG - Intronic
961284899 3:125793659-125793681 GACCCCAGGAATATCCTGGAAGG + Intergenic
961335927 3:126179846-126179868 GGCCCCAGGAGCCACGTTGTGGG + Intronic
961649153 3:128408816-128408838 CGCCCCAGGAGCCACCTAGTGGG - Intergenic
962117583 3:132528097-132528119 ACCCCCAGGACCTACCTGGAAGG - Intronic
962289732 3:134123887-134123909 GGCCCAAGGTGCCACCTTGAGGG - Intronic
963639062 3:147836578-147836600 TACCCCAGGAAGCACATGGATGG - Intergenic
966216721 3:177511034-177511056 GGCATCTGGAACCATCTGGAGGG + Intergenic
967951508 3:194844653-194844675 TGCACCAGGAATCACCTGGGAGG - Intergenic
968463220 4:736426-736448 GACCCCAGGAAGCACTTGGTGGG + Intronic
968594903 4:1477237-1477259 GGCCTCAGGGGCCACCTGCATGG + Intergenic
968688421 4:1976903-1976925 AGCCCCTGGAACCTCCAGGAGGG + Intronic
969012856 4:4081176-4081198 GACCCCAGGAATATCCTGGAAGG - Intergenic
969441144 4:7217442-7217464 GGCCCCTGGAACCAGCAGGCAGG - Intronic
969741002 4:9026591-9026613 GACCCCAGGAATATCCTGGAAGG + Intergenic
971143292 4:23948177-23948199 GGTCCCAGGAACCATGTGGTTGG + Intergenic
977610546 4:99025639-99025661 GCCCCCAGCAACCATCTGAATGG + Intronic
981240938 4:142474893-142474915 TGCCCCAGAAACCACCTGGATGG + Intronic
984828560 4:183950548-183950570 TGCCCCAGGAAGCCACTGGAAGG + Intronic
991722752 5:69509005-69509027 GTGCACAGGAATCACCTGGAGGG - Intronic
992290471 5:75274261-75274283 GGCACCAGGAACCCACTGAAAGG - Intergenic
995187957 5:109290867-109290889 GGCCACAGGAACCACCTCACTGG - Intergenic
995804757 5:116038948-116038970 GGCCCCAGGGACTCCCTGAAAGG - Intronic
996819712 5:127612863-127612885 GGCACCAGCAGCCAGCTGGATGG + Intergenic
997265214 5:132491106-132491128 GGCCCCAGGAGCCAGCCGGCTGG - Intergenic
998178190 5:139914911-139914933 GGCCCCTGTAACCAGCTGGGGGG - Intronic
999290546 5:150422648-150422670 GGACCCAGGAGCCAACTTGAAGG + Intergenic
999760820 5:154699716-154699738 GGCTCCATGGAACACCTGGAGGG + Intergenic
1001341402 5:170849554-170849576 GGACACAGGAACCAACTCGATGG + Intergenic
1005433766 6:25786516-25786538 GGCCCAAGGGACCACCTAGAAGG + Intronic
1005727054 6:28659708-28659730 GACCCCAGTACACACCTGGAAGG + Intergenic
1006367288 6:33622928-33622950 GGCACCAGGAGGGACCTGGATGG - Intronic
1006916847 6:37600277-37600299 AGCCCCAGGACCCACCTGGTGGG + Intergenic
1007595642 6:43049711-43049733 GGCCCCAGGGAGCACTTGGTAGG + Intronic
1009445645 6:63739185-63739207 GGACACAGGAACCAGCTTGAAGG - Intronic
1009546756 6:65030278-65030300 GCCACCAGGAAGCACCTGGTTGG - Intronic
1010262117 6:73829456-73829478 GCCCCCAGGAATCACTGGGAAGG - Intergenic
1012578417 6:100831608-100831630 GGCCCCAGGAATCATTTTGATGG - Intronic
1013760016 6:113507262-113507284 GGCCCCAGGTTCAATCTGGAAGG - Intergenic
1016432915 6:144007329-144007351 GGCCCCAGAAAGCACCCGGGAGG + Intronic
1017407589 6:154136593-154136615 GGGCCCAGGAACCAAGCGGAGGG - Intronic
1017559893 6:155615666-155615688 GGCCCCAGGCCCCACATGGCTGG - Intergenic
1017874267 6:158511895-158511917 AGACCCAGGAAGCAACTGGAGGG - Intergenic
1019056102 6:169224649-169224671 GGCCCAAGGAAGGAGCTGGATGG - Intronic
1019491992 7:1318624-1318646 GGACACACGAACCTCCTGGAGGG - Intergenic
1019538730 7:1541912-1541934 GGCCCCAGGCACCACCTTGCAGG - Exonic
1019561629 7:1662188-1662210 GGGCGCAGGAACCACCTGCAGGG + Intergenic
1019618472 7:1977935-1977957 GTCCCCAGGAGCCACGTGGGAGG - Intronic
1023125628 7:36951513-36951535 GGCCACTGGAACCACCTGGAGGG + Intronic
1026073792 7:67147347-67147369 GGATCCAGGAACCTCATGGATGG - Intronic
1026703088 7:72664820-72664842 GGTTCCAGGAACCTCATGGACGG + Intronic
1027052286 7:75027931-75027953 GGCCCCAGACCCCACTTGGAGGG + Intronic
1027246162 7:76369064-76369086 GGTCCCAGGAGCCGGCTGGAAGG + Intergenic
1027948934 7:84787362-84787384 GGCCTAAAGAACCACCTTGAAGG - Intergenic
1028019242 7:85749967-85749989 TGTCCCTGGAAACACCTGGATGG + Intergenic
1028142985 7:87291930-87291952 TGTCCCAGGAAGCACCTAGATGG + Intergenic
1029071505 7:97902803-97902825 GACCCCAGGAATATCCTGGAAGG - Intergenic
1029184863 7:98731339-98731361 GGCTCCCGGGACCAGCTGGAGGG + Intergenic
1029807197 7:103010020-103010042 TGGCCCAGGAAACACCTGGATGG + Intronic
1031997860 7:128244696-128244718 GGACCCAGGAACCACAAAGAAGG + Intronic
1034556895 7:151855758-151855780 GGCGGCAGGAACCACAGGGATGG + Intronic
1035278456 7:157762810-157762832 GGCCCCAGGCACCGCATGCAGGG + Intronic
1036246203 8:7119182-7119204 GACCCCAGGAACATCCTGGAAGG + Intergenic
1036254596 8:7195247-7195269 GACCCCAGGAATATCCTGGAAGG - Intergenic
1036362895 8:8092241-8092263 GACCCCAGGAATATCCTGGAAGG + Intergenic
1036888064 8:12574832-12574854 GACCCCAGGAATATCCTGGAAGG - Intergenic
1036895667 8:12632947-12632969 GACCCCAGGAATATCCTGGAAGG - Intergenic
1038119135 8:24592125-24592147 GACCTCAGGAAACAGCTGGAAGG + Intergenic
1040284187 8:46091675-46091697 GGCTCCAGCCACCACCTGGGGGG - Intergenic
1042736167 8:71991987-71992009 GGCACCAGGAAATAGCTGGAGGG - Intronic
1043270710 8:78329732-78329754 GGTCCCAGGGACCACAAGGAGGG - Intergenic
1044317130 8:90763223-90763245 GGCCACATTAAACACCTGGAAGG + Intronic
1047925564 8:129679370-129679392 GGGGCCAGGAAACAGCTGGAAGG + Intergenic
1049229943 8:141476788-141476810 GGCCCCGGGAGCCACGGGGAAGG - Intergenic
1049683505 8:143930180-143930202 GGCACCAGGAAGCACACGGAGGG + Exonic
1049794763 8:144492080-144492102 GGCCCCCAGAACCAGCCGGAGGG + Intronic
1049962525 9:750353-750375 AGCCCTAGAAACCACCTGGAAGG + Intergenic
1050182037 9:2933286-2933308 GGGCCCAGCCACCCCCTGGAGGG + Intergenic
1052835996 9:33250531-33250553 TGTGCCAGGCACCACCTGGAAGG + Intronic
1052895994 9:33748887-33748909 GGCACCAGGAACCCATTGGAGGG - Intergenic
1053045971 9:34917624-34917646 GGCCCCGGGAAGCCACTGGAAGG - Intergenic
1053136036 9:35650689-35650711 GGCCCCAGGTCCCACCTGCTGGG - Intronic
1054779991 9:69157134-69157156 GGCCCCTGCAACCATCTGAATGG - Intronic
1056877614 9:90349681-90349703 TGTCCCAGGAAGCACCTGGATGG + Intergenic
1059051626 9:110932855-110932877 GGCCCCAGGAATCACTTTCATGG - Intronic
1059353726 9:113684084-113684106 GGCACCAGAAAGCAGCTGGATGG + Intergenic
1059425709 9:114219783-114219805 GACTCCAGGAAACCCCTGGAGGG - Exonic
1060526421 9:124323705-124323727 GTCCCCGGGAACCTCTTGGAGGG + Intronic
1061074331 9:128332103-128332125 GGCCCTGGGAACCATCAGGAAGG + Intronic
1061259261 9:129470684-129470706 TGACCCAGGGACCACCTGCAGGG - Intergenic
1061809613 9:133154780-133154802 GGCCCCAGGAAGTTCCAGGAAGG + Intronic
1062467066 9:136686224-136686246 TGCCCCTGGAACCACGGGGAAGG + Intronic
1062495725 9:136830679-136830701 TGCCACAGGAACGGCCTGGAGGG + Intronic
1062500633 9:136850539-136850561 GGCCCCAGGATCCACCATCAAGG + Intronic
1062626874 9:137447272-137447294 AGCCCCAGGAGCCACCTGACGGG + Intergenic
1185650086 X:1641482-1641504 GTCCCCATGAACCATCAGGATGG - Intronic
1186553124 X:10527886-10527908 TGATCCAGGAAGCACCTGGAGGG - Intronic
1187302584 X:18065378-18065400 GGCCCCAGGAAAGTCCTGTATGG + Intergenic
1187407079 X:19013984-19014006 GGCCCGAGGCACCACTGGGATGG + Exonic
1189160745 X:38805705-38805727 GGCCCAAGGAACCTCCTGGGAGG + Exonic
1189281098 X:39820708-39820730 GGGCACAGGTACCACCTGGGTGG - Intergenic
1189873013 X:45404359-45404381 TGTCCCAAGAAGCACCTGGATGG + Intergenic
1190492814 X:50999949-50999971 GACCTCAGGAAGCACCTGGGAGG + Intergenic
1190511828 X:51180608-51180630 GACCTCAGGAAGCACCTGGGAGG - Intergenic
1191778528 X:64843977-64843999 AGCCCCTGCAACCTCCTGGAGGG - Intergenic
1191952287 X:66605554-66605576 GTCCTCAGGAACCCCCTGGTAGG - Intronic
1193353900 X:80494249-80494271 GACAACAGGAACCAGCTGGAAGG + Intergenic
1193553194 X:82924509-82924531 GACCCCAGGAACAACTTGGTTGG + Intergenic
1195229271 X:102829793-102829815 TGCCACAGAGACCACCTGGAAGG + Intergenic
1200053874 X:153448688-153448710 AGCCCCAGGCACCACCAGGATGG + Intronic
1200210602 X:154345226-154345248 GGCCCATGCACCCACCTGGACGG + Intergenic
1200220250 X:154386866-154386888 GGCCCATGCACCCACCTGGACGG - Intergenic
1202370395 Y:24192135-24192157 GGCTCCAGGAACCTCCAAGAAGG - Intergenic
1202500389 Y:25477982-25478004 GGCTCCAGGAACCTCCAAGAAGG + Intergenic