ID: 945983241

View in Genome Browser
Species Human (GRCh38)
Location 2:216333043-216333065
Sequence GTTTTCTTCTAGAAGAGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3283
Summary {0: 1, 1: 1, 2: 51, 3: 387, 4: 2843}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945983241_945983242 4 Left 945983241 2:216333043-216333065 CCATAACTCTTCTAGAAGAAAAC 0: 1
1: 1
2: 51
3: 387
4: 2843
Right 945983242 2:216333070-216333092 AAGAATGTTTTCATGATCTTTGG 0: 1
1: 0
2: 11
3: 91
4: 668
945983241_945983244 10 Left 945983241 2:216333043-216333065 CCATAACTCTTCTAGAAGAAAAC 0: 1
1: 1
2: 51
3: 387
4: 2843
Right 945983244 2:216333076-216333098 GTTTTCATGATCTTTGGGACAGG 0: 1
1: 0
2: 1
3: 13
4: 157
945983241_945983243 5 Left 945983241 2:216333043-216333065 CCATAACTCTTCTAGAAGAAAAC 0: 1
1: 1
2: 51
3: 387
4: 2843
Right 945983243 2:216333071-216333093 AGAATGTTTTCATGATCTTTGGG 0: 1
1: 1
2: 2
3: 67
4: 580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945983241 Original CRISPR GTTTTCTTCTAGAAGAGTTA TGG (reversed) Intronic
Too many off-targets to display for this crispr