ID: 945983242

View in Genome Browser
Species Human (GRCh38)
Location 2:216333070-216333092
Sequence AAGAATGTTTTCATGATCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 771
Summary {0: 1, 1: 0, 2: 11, 3: 91, 4: 668}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945983241_945983242 4 Left 945983241 2:216333043-216333065 CCATAACTCTTCTAGAAGAAAAC 0: 1
1: 1
2: 51
3: 387
4: 2843
Right 945983242 2:216333070-216333092 AAGAATGTTTTCATGATCTTTGG 0: 1
1: 0
2: 11
3: 91
4: 668

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945983242 Original CRISPR AAGAATGTTTTCATGATCTT TGG Intronic
901121806 1:6901300-6901322 GAGAAAGTTTTCATGACCTTGGG + Intronic
902464909 1:16611083-16611105 AAAAATGTGTTCATACTCTTAGG + Intronic
902947276 1:19850767-19850789 AAGAATGTTTTACCAATCTTGGG - Intergenic
903155892 1:21442608-21442630 AAAAATGTGTTCATACTCTTAGG - Intronic
903172083 1:21560718-21560740 AAGAATGTCATCATGTTCCTGGG + Exonic
903636727 1:24823876-24823898 AAGAATGTTTCCATGCTTTTAGG - Intronic
904961014 1:34332879-34332901 AACAATGTTTGCATGATTATGGG - Intergenic
905570881 1:39004445-39004467 AAAAATTTTTTTTTGATCTTGGG + Exonic
905787744 1:40771378-40771400 AAGAATGTTTCCATGGCCTCTGG - Intronic
906089890 1:43169998-43170020 GACAATTTTTTCATGAACTTGGG - Intronic
906257761 1:44363483-44363505 AAGAATGGGTTCAAGGTCTTAGG - Intergenic
906446811 1:45907315-45907337 GAGAAAATCTTCATGATCTTGGG - Intronic
906467850 1:46100228-46100250 GAGAATGTTTTTATGATACTAGG - Intronic
906848197 1:49217709-49217731 ACAAATGTCTTCATAATCTTTGG + Intronic
907085003 1:51663563-51663585 GAGAATATTTTCATGGCCTTGGG + Intronic
907593988 1:55703125-55703147 AAGAATTTTCCTATGATCTTAGG + Intergenic
907835461 1:58104333-58104355 AAGACTGATTTCATACTCTTAGG + Intronic
908060653 1:60344760-60344782 CAGAGTGTTTTTATGATATTGGG + Intergenic
908098737 1:60768438-60768460 AAGATTGTTCTCATGGTCTCAGG + Intergenic
908144688 1:61227353-61227375 AAGCTTGATTTCATAATCTTTGG + Intronic
908457190 1:64315293-64315315 CAGAATGTTTTTCTGTTCTTGGG + Intergenic
908905992 1:69009977-69009999 AAGAATATTTTCATGACCTCGGG - Intergenic
909777474 1:79499888-79499910 AAGAAAGTTTTCATTACCTAAGG - Intergenic
909887049 1:80954977-80954999 AAGAATATCTTCATGATCTTGGG + Intergenic
909892446 1:81024536-81024558 TAGAATGATTTCATATTCTTTGG - Intergenic
909997880 1:82303529-82303551 AATAGTGTTTTCATTTTCTTTGG + Intergenic
911405464 1:97432605-97432627 AAGAATATTCTGTTGATCTTGGG + Intronic
911740566 1:101382621-101382643 AAGAAAATTTTTATGATCTTGGG - Intergenic
911932278 1:103920107-103920129 GAGAATTTTTTCATGTTTTTTGG + Intergenic
912051340 1:105532245-105532267 AAGAATGATATAATGAACTTTGG - Intergenic
912051497 1:105534633-105534655 AAGAATTATTTGAAGATCTTTGG - Intergenic
912946635 1:114090210-114090232 AGGAATCTTGTCATGACCTTGGG + Exonic
913491392 1:119383226-119383248 ATGAATGTTTTCTCAATCTTAGG - Intronic
916204758 1:162305569-162305591 AAGAATGGCTTCAGGAACTTGGG - Intronic
916238632 1:162615981-162616003 AAGAATCTTTTCTGTATCTTGGG + Intergenic
916382199 1:164224502-164224524 AAGAATGATATAATGAACTTTGG + Intergenic
916522449 1:165576649-165576671 AAGAAAGTCTTCTTGATCTTGGG + Intergenic
916765868 1:167860056-167860078 AACAATTTTTTCATGAACTGCGG + Intronic
917263483 1:173195100-173195122 AGGGATGTTATCATGAACTTGGG - Intronic
917470102 1:175319202-175319224 AAAAATGTTTTCATGTCCCTAGG + Exonic
918182756 1:182098960-182098982 AAGCATTTTTTCATGTTATTTGG + Intergenic
918788062 1:188790240-188790262 GAGAATGTTTTCATGTTTGTTGG - Intergenic
918886658 1:190202147-190202169 AGGAAGGTTTGCATGGTCTTGGG - Intronic
919423181 1:197397469-197397491 AAGTATGTTTTCATTCTCATGGG - Intronic
919569672 1:199231646-199231668 AATAATGTTTTCATTAGTTTGGG - Intergenic
920152003 1:203918029-203918051 GAGAATATTTTTATGATCTTGGG - Intergenic
920943258 1:210503934-210503956 TAGAAAATTTTCAAGATCTTGGG + Intronic
920995864 1:210990453-210990475 ATGAATCTTTTCTTGACCTTTGG - Intronic
921234199 1:213108184-213108206 AAGAAAATCTTCATGATCTTGGG - Intronic
921513324 1:216059457-216059479 AAGAATGTTTGAATAATTTTAGG - Intronic
921671039 1:217924413-217924435 AAGGATGTTTACATGATCTAAGG + Intergenic
921788298 1:219259607-219259629 AAGAATGATATAATGAACTTTGG + Intergenic
921816896 1:219574495-219574517 AAAAGTGTTTTCATGATCCTTGG - Intergenic
921967744 1:221108722-221108744 AATAATCTTTTCAAGATTTTGGG - Intergenic
922135990 1:222826697-222826719 AAGAATTTTTTAATGATTTGTGG + Intergenic
922207254 1:223459245-223459267 TAGAATATTTTCATAATCTTGGG - Intergenic
922278687 1:224101897-224101919 AAGAATGACTTCAAGATTTTTGG + Intergenic
923263912 1:232294155-232294177 AAGAATGGCATCATGTTCTTTGG - Intergenic
923362382 1:233224383-233224405 AAAAATGTTTTCTTAGTCTTTGG - Intronic
923927611 1:238651919-238651941 TAGATTATCTTCATGATCTTGGG + Intergenic
924043242 1:240004210-240004232 CAGAATGTGTTCATGACCTTAGG - Intergenic
924395586 1:243616400-243616422 AAGAATGTTTTCCCCAACTTTGG + Intronic
1063253346 10:4298804-4298826 GAGAAAGTTCTCATGAGCTTTGG + Intergenic
1064173595 10:13055087-13055109 AAGTAAGTCTTCATGATGTTTGG - Intronic
1064766583 10:18681324-18681346 AAGCATGTTTTCCTGATGGTGGG + Exonic
1064784774 10:18881780-18881802 AAGGATGTTTTCCTTGTCTTTGG + Intergenic
1065158889 10:22898546-22898568 AAGAATGATATAATGAACTTTGG + Intergenic
1065268591 10:24002825-24002847 AAGAATGATATAATGAACTTTGG - Intronic
1065407526 10:25386397-25386419 AAGATTGTTTTGATGATTTCGGG + Intronic
1065438259 10:25723848-25723870 AAGGATGATCTCATGATGTTTGG + Intergenic
1065681304 10:28235689-28235711 GAGAATATCTTCATAATCTTGGG + Intronic
1065980476 10:30890054-30890076 AAGAAAGGTTTTATTATCTTTGG + Intronic
1065982303 10:30911961-30911983 AATAATATTTTCATGTTGTTGGG - Intronic
1066020532 10:31295324-31295346 AAGATTATTTTCAGGTTCTTAGG - Intergenic
1066141771 10:32510826-32510848 TATCATGTTTTCATGATTTTAGG - Intronic
1066186811 10:33017789-33017811 AAGAATTATTTCTTTATCTTTGG + Intergenic
1066616128 10:37296609-37296631 ATGAGTGTTTTCATAATGTTTGG + Intronic
1067136690 10:43614737-43614759 AAGAATATCTTCATGATCTCGGG - Intronic
1067340573 10:45399557-45399579 AAGTAAGTCTTCATAATCTTGGG + Intronic
1068086212 10:52375980-52376002 AAGAAAATTTTCATGTCCTTGGG - Intergenic
1068382633 10:56276797-56276819 AAGAAATCTTTCATGAGCTTAGG + Intergenic
1068566674 10:58583389-58583411 AAGAATGTTATAATGGACTTTGG - Intronic
1068931893 10:62598976-62598998 AGGAATATCTTTATGATCTTGGG + Intronic
1069363897 10:67675940-67675962 TAGAATATATTTATGATCTTAGG - Intronic
1069576406 10:69532864-69532886 GAGAATTTATTCATGTTCTTAGG - Intergenic
1070067219 10:73048564-73048586 AAGAATGTTCTTTTGATCTTAGG + Intronic
1070803949 10:79259585-79259607 GAGAATATCTTCATGATCTGGGG - Intronic
1071020687 10:81051423-81051445 AAGAAACTCTTAATGATCTTTGG + Intergenic
1071462134 10:85908713-85908735 AAGATTGTTTTGGTTATCTTAGG - Intronic
1071720684 10:88141757-88141779 CAGTAGGTCTTCATGATCTTGGG - Intergenic
1073180342 10:101579490-101579512 AAGGATGTCTTCAGGCTCTTAGG - Exonic
1073430442 10:103483021-103483043 TAGAATTTTTTCAGGATGTTTGG - Intergenic
1073518992 10:104107629-104107651 AAGAATATCTTCATGACTTTGGG - Intergenic
1073861000 10:107740556-107740578 AATAATATCTTCACGATCTTGGG + Intergenic
1076251830 10:128990946-128990968 GACATTGTTTTCTTGATCTTGGG + Intergenic
1076465333 10:130677287-130677309 GAGAATGCCTTCTTGATCTTGGG + Intergenic
1077811751 11:5644892-5644914 AAGAATGTATTCATTACCATGGG - Intronic
1078167862 11:8905465-8905487 AAAAAAATTTTCATGACCTTAGG + Intronic
1078263426 11:9733536-9733558 AAGAATGCTTTTATAATCTTAGG + Intronic
1079433235 11:20417603-20417625 AAGAGTCATTTCAGGATCTTTGG - Intronic
1079492556 11:21005600-21005622 AAGACTGTGTTCATGAGCATTGG + Intronic
1080118833 11:28651127-28651149 AAAAGTTTTGTCATGATCTTGGG - Intergenic
1080755182 11:35190437-35190459 AAGATTGTTTTCATAAAGTTGGG + Intronic
1081719295 11:45275554-45275576 AAGAATGTTACAATGATATTTGG - Intronic
1081762038 11:45583377-45583399 CAGAATGGTTTCATGATGTCTGG - Intergenic
1083834827 11:65259673-65259695 AAGAATATTTGCATAAGCTTAGG + Intergenic
1083930831 11:65843649-65843671 TAGAATATCTTCATGACCTTGGG + Intronic
1084991496 11:72929746-72929768 AAAATTGTTTTCAAGCTCTTTGG - Intronic
1085176885 11:74496080-74496102 TAGAATGTCTTCAGGATCTAGGG - Intronic
1085194911 11:74663676-74663698 AAGAACATTTTCATCATCTTTGG + Intronic
1085194948 11:74664283-74664305 ATGTATGTTTTCATTTTCTTGGG - Intronic
1085628737 11:78094755-78094777 AAGATAGCTGTCATGATCTTGGG - Intergenic
1086129022 11:83381929-83381951 AAAATAGTTTTCATCATCTTGGG + Intergenic
1086799938 11:91160516-91160538 ATGAATGTTTTCCATATCTTAGG - Intergenic
1087781997 11:102310819-102310841 AAGAAAATCTTCATAATCTTGGG + Intergenic
1087929660 11:103962311-103962333 TAGAATGTTTTCCTGATCAGAGG + Intronic
1088440548 11:109866090-109866112 AAGAACTTTTTCATTATCATGGG + Intergenic
1088592808 11:111417844-111417866 TGGACTGTTTTCATGTTCTTGGG + Intronic
1088635212 11:111813198-111813220 AAGAATATCTTCAAGATCTTGGG + Intronic
1088924549 11:114287320-114287342 AAGAATATCTTTATGACCTTGGG - Intronic
1089819908 11:121215526-121215548 AAGAATGATTTAATGGACTTTGG + Intergenic
1090671885 11:128953693-128953715 AAGAATTCGTTCTTGATCTTGGG - Intergenic
1091070257 11:132556367-132556389 CTGAATGTTTTGAAGATCTTTGG - Intronic
1091111387 11:132972151-132972173 AATAATGTCTTCCTGATTTTGGG + Intronic
1091166721 11:133482838-133482860 AAGAATATCTTCATGACCTGGGG + Intronic
1091809402 12:3382794-3382816 GAGAAAATTTTCATGATCTAGGG - Intronic
1092072572 12:5644098-5644120 AAAAATATTTTCATGACCTTGGG - Intronic
1092108592 12:5943475-5943497 AAGAATGATATCATGGACTTTGG + Intronic
1092250979 12:6896552-6896574 GAGAATATTTTCATAACCTTAGG + Intronic
1092475956 12:8819278-8819300 AATAATGTTTTCATGATAAGGGG - Intergenic
1092929465 12:13301717-13301739 AAGAATGATATCATGGACTTTGG + Intergenic
1093066178 12:14660842-14660864 CAGAATGTCTTCATTATCTTAGG + Intronic
1093374332 12:18406321-18406343 AATAATGCTTTCATGAACATGGG + Intronic
1093499143 12:19791081-19791103 GAGAATATCTTCATGACCTTGGG + Intergenic
1093534261 12:20203592-20203614 AAGAAAATCTTCATGATCTTGGG - Intergenic
1093676969 12:21953416-21953438 GAGAATATATTTATGATCTTAGG - Intergenic
1094227068 12:28057613-28057635 AAGAATGTTTTCATAGTGTTTGG + Intergenic
1094579041 12:31716910-31716932 GAGAATATCTTCATGAACTTAGG - Intronic
1094767430 12:33613115-33613137 AAGAATGAGTTCATGTCCTTTGG + Intergenic
1095217835 12:39570264-39570286 AAGAATTTTTTCACTATTTTGGG - Intronic
1095223707 12:39652662-39652684 AAGAAAATCTTCATGACCTTGGG - Intronic
1095447240 12:42294484-42294506 AAGTAAATTTTCATGGTCTTGGG + Intronic
1096308009 12:50496001-50496023 AAAAATTATTTCCTGATCTTTGG + Intergenic
1096450609 12:51738080-51738102 AAAAATGATTTCCTAATCTTTGG + Intronic
1096767573 12:53905891-53905913 CAGAATGTCTTTATGATCTCAGG - Intergenic
1097404780 12:59176582-59176604 AAGTAGGTTCTCATGGTCTTGGG + Intergenic
1097437332 12:59566862-59566884 AAAAATATTTTCATGATCTCAGG + Intergenic
1098028258 12:66228576-66228598 AAGAGAGTTTACATTATCTTTGG + Intronic
1098219961 12:68258732-68258754 AAGAATGTCTTTGTGACCTTGGG - Intergenic
1098220987 12:68269735-68269757 CAGAATGTCTTCATGCACTTAGG + Intergenic
1098303065 12:69074156-69074178 AAGAATGATATAATGAACTTCGG + Intergenic
1098375897 12:69814048-69814070 AAGACTGTTTTTATGTTATTAGG - Intronic
1098821393 12:75234824-75234846 AAGAATGTTTTCAAGAAGTCTGG + Intergenic
1099121845 12:78700176-78700198 AAGAATGTATTTATAATATTTGG - Intergenic
1099126707 12:78768397-78768419 TAGAGTATCTTCATGATCTTGGG - Intergenic
1099363380 12:81736029-81736051 AAGATTGTTTTAATTATCCTTGG + Intronic
1099405487 12:82256103-82256125 GATAATGTCTTTATGATCTTGGG - Intronic
1099416758 12:82397933-82397955 AAAAGTGTTTTCATTATTTTAGG + Intronic
1099856091 12:88168722-88168744 AAACAAGTTCTCATGATCTTAGG - Intronic
1099970925 12:89499825-89499847 CAGAATATCTTCATGACCTTGGG + Intronic
1100133682 12:91527453-91527475 AAGAATATTTTTATCATGTTAGG - Intergenic
1100264807 12:92965453-92965475 AAGAATGAGTTCATGTCCTTTGG - Intergenic
1100452907 12:94724866-94724888 AAAAATGCTTTCATGTCCTTAGG + Intergenic
1100648628 12:96559935-96559957 AAGAAAATCTTCATGATCTGGGG - Intronic
1101011235 12:100451716-100451738 AGGAATGTTTTTATGATTTCAGG + Intergenic
1102411036 12:112718905-112718927 AAGAATCTTCTAAAGATCTTTGG + Intronic
1103835545 12:123817132-123817154 AAGAATTTTTTTTTGGTCTTTGG + Intronic
1105487136 13:20845870-20845892 AAAATTGTTTTCAGGATCCTAGG - Intronic
1105498948 13:20954610-20954632 GAGAATTTCTTCATCATCTTAGG + Intergenic
1105689021 13:22817086-22817108 GAGAAGGTTTTCATTATCTTTGG - Intergenic
1106119161 13:26844222-26844244 AAGAATTTTTTCTTTATATTTGG - Intergenic
1106169012 13:27272635-27272657 AAAAATGTTTTTATGAGTTTGGG + Intronic
1106478957 13:30122786-30122808 AATAATGTATTCATCTTCTTGGG - Intergenic
1106616435 13:31334088-31334110 TAAAATATCTTCATGATCTTAGG + Intergenic
1106617884 13:31347173-31347195 AAGAATTTATTCATCATTTTTGG - Intergenic
1106944111 13:34806660-34806682 AAGATAGTTTCCAAGATCTTTGG + Intergenic
1107597550 13:41978770-41978792 AAGATTGTTCTCTTTATCTTTGG + Intergenic
1107659249 13:42622468-42622490 AAGAATGATATAATGAACTTTGG + Intergenic
1107824832 13:44319053-44319075 AAAAATGTTTTCTTAATGTTTGG + Intergenic
1108294825 13:49003622-49003644 AAGAATATCTTCATAACCTTGGG - Intronic
1108917709 13:55636253-55636275 AAGAATGAGTTCATGTCCTTTGG + Intergenic
1109076112 13:57837413-57837435 CTCAATGGTTTCATGATCTTCGG + Intergenic
1109715470 13:66216365-66216387 ATGAATGTTTTCTTGATTCTTGG - Intergenic
1109898111 13:68721891-68721913 AAGATTTTTTTCTTTATCTTTGG + Intergenic
1110126180 13:71944946-71944968 AATCTTGCTTTCATGATCTTGGG - Intergenic
1110267257 13:73552453-73552475 AAGAATGTTGTCCTGAACTTGGG + Intergenic
1110942876 13:81372541-81372563 AAGAAGATATTCATCATCTTAGG - Intergenic
1111145865 13:84179080-84179102 AAGAATGATATAATGAACTTTGG + Intergenic
1111218761 13:85178380-85178402 AGGAGGGTTTTCATGATCTTGGG + Intergenic
1111425933 13:88082309-88082331 AACATTGTTTTCATGTTATTTGG + Intergenic
1111451026 13:88416336-88416358 AAAAATAGCTTCATGATCTTTGG - Intergenic
1111839875 13:93436171-93436193 AAGTAGGTTTCCATGATCATTGG - Intronic
1112045492 13:95592271-95592293 AAGAATGTTTTAATAATCTTAGG + Intronic
1112156998 13:96828844-96828866 AATACTTTTTTCAAGATCTTGGG - Intronic
1112228537 13:97565229-97565251 AAGAATTTATTCATGAGCCTGGG - Intergenic
1112376986 13:98851835-98851857 GAGAATATTTTCATGACCCTGGG + Intronic
1112536946 13:100268490-100268512 AAAAATGTTTTATTGAGCTTTGG + Intronic
1112546757 13:100378592-100378614 AAGAAAGCTTTCATGATATATGG - Intronic
1113631257 13:111886054-111886076 GAGAAAATATTCATGATCTTAGG + Intergenic
1114391696 14:22315690-22315712 CAGTAAATTTTCATGATCTTGGG + Intergenic
1114790972 14:25658001-25658023 AAGAAAGATCTCATAATCTTAGG - Intergenic
1115211883 14:30975368-30975390 AAGAATGATATAATGAACTTTGG + Intronic
1115382333 14:32755232-32755254 AACAATGTTTTCAAGCTCTGTGG + Intronic
1115599895 14:34945506-34945528 CACAATGTTTTCAAGATCATTGG + Intergenic
1115707218 14:36011611-36011633 AAGAATGATTCGATGAACTTTGG - Intergenic
1116598401 14:46884812-46884834 AAAAATGTTATTATGATCTCAGG + Intronic
1117217196 14:53563368-53563390 GAGAAAATCTTCATGATCTTGGG + Intergenic
1117288270 14:54308244-54308266 TAGAATGCTTTCTTGAGCTTGGG - Intergenic
1118014159 14:61641255-61641277 ATGAAAATTTTCATGATTTTAGG - Intronic
1118148126 14:63162698-63162720 AAGAATATTTGCATGGTTTTTGG + Intergenic
1118250691 14:64157378-64157400 CATAATGTTTTCAAGATCATCGG + Intronic
1118406319 14:65427234-65427256 AATAATGCTTTCATGAACATTGG + Intronic
1118525937 14:66642904-66642926 CAGAATATCTTCGTGATCTTGGG + Intronic
1118534832 14:66750164-66750186 AAGAATATTTAGATGACCTTGGG - Intronic
1118947712 14:70403309-70403331 TAGAATGTTTTCATGTATTTTGG - Intronic
1118959156 14:70512834-70512856 AGGAATGTCTTTATGATCTGAGG + Intergenic
1119367671 14:74108365-74108387 AAACATGTTTTCATTTTCTTAGG + Intronic
1120028392 14:79611686-79611708 AGGAATTTATTCATGATCATTGG - Intronic
1120049052 14:79843922-79843944 AAGAATGATATAATGGTCTTTGG - Intronic
1120625089 14:86815465-86815487 AAGCATTTTTTCATGTTTTTTGG - Intergenic
1120653587 14:87163219-87163241 AAGGAAGGTTACATGATCTTGGG + Intergenic
1120706453 14:87750908-87750930 AAAAAGTTTTTCAAGATCTTGGG + Intergenic
1120930800 14:89846358-89846380 AAGAATGTTTCCATCATAATGGG + Intronic
1121046953 14:90795234-90795256 AAAAATGTTTTCAAGACATTGGG + Intronic
1121166158 14:91803300-91803322 AAGAAAGTTTTCATGACCTTAGG + Intronic
1121218814 14:92269647-92269669 AAGAAGGATATCATGAACTTTGG - Intergenic
1121853240 14:97243039-97243061 GAGAATATCTTCATGAACTTTGG + Intergenic
1122022385 14:98849269-98849291 CAGAATATTTTTATGACCTTGGG - Intergenic
1122498112 14:102173646-102173668 AAGAATGATATAATGAACTTTGG - Intronic
1123912194 15:24978755-24978777 AATAATGTTTTCATGACCCGGGG + Intergenic
1124059836 15:26280494-26280516 AAGCATGTCTTCATGATCTTGGG - Intergenic
1124343643 15:28906301-28906323 AAGAATGAGTTCATGTCCTTTGG + Intronic
1124660384 15:31545330-31545352 GAGAATATTTTCAGGACCTTGGG + Intronic
1124715445 15:32056234-32056256 AAAAATATCTTCATGAACTTGGG - Intronic
1124811688 15:32945419-32945441 AACAAAGTTTGCATGACCTTTGG + Intronic
1125194005 15:37025713-37025735 AAAAATGATTTCATGCTCTTTGG - Intronic
1125229559 15:37437642-37437664 ATGTATGTTTTCATTCTCTTGGG + Intergenic
1125811172 15:42542516-42542538 AAGAATTTTTTAATGAACTTTGG - Exonic
1126275715 15:46877839-46877861 AAGAAATTTTTCATGACCATAGG + Intergenic
1126595272 15:50378744-50378766 GAGAATAGTTTCCTGATCTTAGG + Intergenic
1127504921 15:59588897-59588919 AAGGATGTTTTAATTATCTAGGG + Intergenic
1127744920 15:61958170-61958192 TATAATCTTTTCATTATCTTTGG + Intronic
1128230564 15:66031843-66031865 AGGAATGGGTTCATTATCTTGGG + Intronic
1128524169 15:68400332-68400354 AAGAATATCTTCATGATATGGGG + Intronic
1128917613 15:71578770-71578792 AACACTGTTTTAATGATATTTGG + Intronic
1129122821 15:73412587-73412609 GGGAATATTTTCATGACCTTAGG + Intergenic
1129223259 15:74147669-74147691 GAGAATATTTTCATCATCTTAGG - Intergenic
1129479632 15:75812913-75812935 AAGAATATTTACATGATCTTGGG + Intergenic
1129575829 15:76744514-76744536 AAGAATTTTTTCATGTTAGTTGG - Intronic
1129646616 15:77440256-77440278 CTAAATGTCTTCATGATCTTAGG - Intronic
1129773778 15:78220019-78220041 AAGAATGTTTTGACTATTTTAGG - Intronic
1129954933 15:79627792-79627814 AGGAATGTTTTCATGACAATGGG + Intergenic
1130344749 15:83032697-83032719 AAGAATGATATAATGAACTTTGG + Intronic
1130578160 15:85111296-85111318 GAGAATATTTTCACGATCTTGGG - Intronic
1130923010 15:88364930-88364952 AAAGAGGTTTTCATGAACTTTGG + Intergenic
1130969849 15:88723631-88723653 AAAAAAGTCTTCATGACCTTGGG + Intergenic
1131253743 15:90847718-90847740 AAGAATATTTTTATGACCTCAGG + Intergenic
1131653238 15:94425083-94425105 AAGAATATTTTTATGACTTTGGG - Intronic
1131682218 15:94736048-94736070 ACAAATGTTTTCATGCTCTAGGG - Intergenic
1131818342 15:96245989-96246011 ACCAATGTTTTCAAGATCTCTGG - Intergenic
1132108233 15:99081399-99081421 GAGAATGCCTTCATGACCTTGGG + Intergenic
1132212935 15:100038329-100038351 AAGATTGTTTTGATGATTTGAGG + Intronic
1132410561 15:101575382-101575404 AAGAATGTTTTTACAATCTTGGG + Intergenic
1133065140 16:3200798-3200820 AAGAATGTGACCATGTTCTTGGG - Intergenic
1133852467 16:9518234-9518256 CAGAATGCTCTCCTGATCTTGGG - Intergenic
1134236699 16:12471880-12471902 TAGAATGTCTTCATGACCTTGGG - Intronic
1134773497 16:16831524-16831546 AAGACTGTTTTCATTTTCTTTGG + Intergenic
1135068112 16:19328625-19328647 AAGATTTTTTTCTTTATCTTTGG + Intergenic
1139073870 16:63419017-63419039 TAAAATGTTTTCATTTTCTTAGG - Intergenic
1140185657 16:72768404-72768426 AGGAATATTTTCATGACCTTGGG + Intergenic
1140285752 16:73601118-73601140 AAGAATGTTTACATGACCCAAGG - Intergenic
1140643784 16:77007898-77007920 GAAAATATTTTCATGACCTTGGG - Intergenic
1141165461 16:81657791-81657813 AATGATGTTTTCATGCTCCTGGG - Exonic
1141378765 16:83556603-83556625 AAGAATGTGGTGATGAACTTAGG - Intronic
1142991012 17:3730907-3730929 AAGAACATTTTCATTATCTCTGG + Intronic
1143047737 17:4095746-4095768 AAGAATGTATTCATGCTCATTGG - Intronic
1143589357 17:7872274-7872296 GTGAATATTTTCCTGATCTTGGG - Intronic
1143817643 17:9530892-9530914 GAGAACATTTTTATGATCTTGGG - Intronic
1143915398 17:10288549-10288571 AAGAATGATTTAATGAACTTTGG - Intergenic
1144119027 17:12131647-12131669 GAGAATGTTTTCATTACGTTTGG + Intronic
1144501549 17:15791665-15791687 ATGAAAGTTGTCATGACCTTAGG - Intergenic
1145163727 17:20594324-20594346 ATGAAAGTTGTCATGACCTTAGG - Intergenic
1145819327 17:27819416-27819438 GAGAATATCTTCATGACCTTTGG + Intronic
1146735474 17:35234945-35234967 AAGCATTTTTTCATGTTCGTTGG + Intergenic
1146840207 17:36146878-36146900 AGAAATAGTTTCATGATCTTGGG - Intergenic
1148292414 17:46465502-46465524 AAGAATTTTTTTGAGATCTTTGG + Intergenic
1148314598 17:46683194-46683216 AAGAATTTTTTTGAGATCTTTGG + Intronic
1148764882 17:50032174-50032196 CAGAATATATTCATGACCTTGGG + Intergenic
1149140161 17:53422853-53422875 TAGATTGTTTTCATGAGCCTTGG - Intergenic
1149531635 17:57400310-57400332 AAGAAATTTTTCTTGATTTTTGG + Intronic
1151125496 17:71839907-71839929 TAGAATTTTTTCATGACCTGTGG - Intergenic
1152826893 17:82472098-82472120 AAGACTGATTTTATTATCTTAGG + Intronic
1153921619 18:9795615-9795637 GAGCATTTTTTCATGATCATTGG - Intronic
1156040813 18:32820171-32820193 AAGAATGTATTCATGACCTTGGG + Intergenic
1156066751 18:33151061-33151083 AAGAATGATATAATGAACTTTGG + Intronic
1157037477 18:43992492-43992514 GAGACTGTTTTGATGAACTTGGG + Intergenic
1157696807 18:49729627-49729649 GACAAAGATTTCATGATCTTGGG - Intergenic
1158014643 18:52769665-52769687 AAGAAAGTCTAAATGATCTTGGG - Intronic
1158367797 18:56758478-56758500 AAGACTGTTTTCAGGTTTTTGGG + Intronic
1158422593 18:57309115-57309137 AAGAATGTTCTCTTCATGTTTGG + Intergenic
1158622604 18:59046000-59046022 AGGAGTGTTGTCATAATCTTTGG + Intergenic
1160066995 18:75584622-75584644 TTAAATGTGTTCATGATCTTAGG - Intergenic
1161937743 19:7382576-7382598 ATGAATGTTTGCAAGAGCTTTGG - Intronic
1162289953 19:9771476-9771498 AAGAATGATATAATGAACTTTGG - Intronic
1163389870 19:17024119-17024141 AATGATGTTTTCATGAAGTTTGG - Intronic
1163746829 19:19053814-19053836 AAGACTATTTTTATGATCATGGG - Intronic
1163843564 19:19626542-19626564 AAGACTGTTGTCATCATCCTGGG - Exonic
1163975371 19:20846370-20846392 GAGCATTTTTTCATGTTCTTTGG - Intronic
1164499431 19:28803258-28803280 GAGCATGTTTTCATGTTTTTTGG - Intergenic
1164571082 19:29374898-29374920 AAGAATGATTTCATAAACTTAGG + Intergenic
1164795858 19:31028020-31028042 GAGAAAGTTTTCATGACTTTGGG + Intergenic
1165671551 19:37683750-37683772 AAGAATGTATCCCTGTTCTTAGG + Intronic
1166153372 19:40891575-40891597 AATAAGATTTTCATGATCTCAGG + Intronic
1167401428 19:49273611-49273633 AAGAATAACTTCATGATCTGGGG - Intergenic
1168520743 19:57048678-57048700 AAGAATGATATCATGGACTTTGG + Intergenic
925509896 2:4613620-4613642 GAGAATATTTTCATGACATTAGG + Intergenic
926490253 2:13516819-13516841 AAGCATGTTTTTATGATTATGGG - Intergenic
926674580 2:15610345-15610367 AATAAAATTTTCATGACCTTGGG - Intronic
927102935 2:19801690-19801712 AAGAGCTTTTTCATGTTCTTGGG + Intergenic
927229481 2:20807632-20807654 AAGAATTTTTTCATGACTATTGG - Intronic
927845175 2:26467706-26467728 AAGACTGTCTTCATGCCCTTTGG + Intronic
928159699 2:28911124-28911146 GAGAATGTTTTTATAATCCTGGG - Intronic
928482810 2:31699747-31699769 CAGAATTTTTTCTTTATCTTTGG - Intergenic
928788740 2:34924334-34924356 GAGAAAGTTTTCATGGCCTTGGG - Intergenic
929391630 2:41475111-41475133 ATGAATTTTGTCATTATCTTGGG - Intergenic
930428841 2:51247832-51247854 AGGACTGTTTTCATGATCCTTGG - Intergenic
930636943 2:53816686-53816708 GAGAATATTTTCATGATTTTGGG - Intronic
930907671 2:56592041-56592063 GAAAATATTTTCATAATCTTGGG + Intergenic
930992231 2:57670462-57670484 AAAAATATCTTCATGACCTTTGG - Intergenic
931725362 2:65105102-65105124 TAGAATGTTTTAAGTATCTTGGG - Intronic
932017182 2:68042402-68042424 TATCATGTTTTCATGATTTTAGG - Exonic
932520844 2:72410546-72410568 AAGACTGTTTTCATACTGTTTGG - Intronic
932646178 2:73505038-73505060 AAGAATGAGTTCATGTCCTTTGG - Intronic
932650978 2:73556571-73556593 AACAATGCTTTCAAGTTCTTTGG - Intronic
933261820 2:80139841-80139863 AAGCATGTTTGCTTGCTCTTGGG + Intronic
933604215 2:84364471-84364493 AAGAATGTTATAATGAACTTTGG + Intergenic
934233911 2:90212641-90212663 AAACATGTTTTCATGTTCATGGG - Intergenic
934489454 2:94750387-94750409 AAGAATGATTTAATGGACTTTGG + Intergenic
934884900 2:98015984-98016006 TAAAATGGTTTGATGATCTTGGG - Intergenic
936000909 2:108829366-108829388 AAGCATCTTTTTATGAGCTTAGG - Intronic
936289563 2:111210582-111210604 AAGAAAATCTTCATGACCTTGGG - Intergenic
936398185 2:112145634-112145656 AAGAAAATTTTCATGACCTGAGG - Intronic
936847925 2:116859305-116859327 AAGAATGTCTCCATGACTTTGGG + Intergenic
937268303 2:120631114-120631136 AGTAAAGTTTTCATGGTCTTGGG - Intergenic
937813571 2:126225705-126225727 AAGAATGAGTTCATGTCCTTTGG + Intergenic
938159135 2:128968973-128968995 GAAAATGTTCTCATTATCTTTGG - Intergenic
938700597 2:133875608-133875630 AAGACAGTTTTAATGATCATTGG - Intergenic
939403162 2:141721443-141721465 AAGAAGGTTGTCAAGATATTAGG + Intronic
940361410 2:152800013-152800035 AAAATTGTTTTCAAGATTTTGGG + Intergenic
940431537 2:153596499-153596521 AAGACTTTTTTGGTGATCTTCGG - Intergenic
940547877 2:155113469-155113491 AAGAATGTTAACATAAACTTTGG + Intergenic
940634220 2:156277773-156277795 AAGAAAGTTTTCATGACCTATGG + Intergenic
941026878 2:160466244-160466266 AAGAATGATTTTAGGAGCTTTGG - Intronic
941065467 2:160897610-160897632 AAGATTTTTTTCTTTATCTTCGG + Intergenic
941554679 2:166962195-166962217 AAGACTGTTTAGATGACCTTTGG - Intronic
941603695 2:167568804-167568826 AAGAAAATCTTGATGATCTTGGG - Intergenic
941744865 2:169076406-169076428 AACATTGTGTTCATGTTCTTTGG - Intronic
941836638 2:170028867-170028889 AAGAGTGAATTCATCATCTTTGG - Intronic
941945096 2:171087688-171087710 AAGATTGTTTTCTTTATCTTTGG - Intronic
942243737 2:173988233-173988255 AAGAAGGTTTTCATGCAATTTGG - Intergenic
942271960 2:174285247-174285269 AAGTACATCTTCATGATCTTGGG + Intergenic
942826147 2:180179271-180179293 AAGAATATTTTCATTAATTTTGG + Intergenic
943160074 2:184236364-184236386 AAAAATGTATGCATGATCTCAGG + Intergenic
943193905 2:184718716-184718738 AAGTGGGTTTTCATGGTCTTGGG + Intronic
943217027 2:185050862-185050884 AAGAATGTATTAATAATCTCGGG + Intergenic
943437734 2:187886991-187887013 GAAAATGTTTTAATGATCTTAGG - Intergenic
943970632 2:194401574-194401596 AAGAGTGTTTTCATGAAAGTAGG + Intergenic
943989391 2:194668167-194668189 AAGATAGTTCTCTTGATCTTAGG - Intergenic
943992955 2:194720984-194721006 AAGAATGATATAATGAACTTAGG + Intergenic
944220501 2:197299648-197299670 AAGAATGATATAATGAGCTTTGG + Intronic
944269610 2:197766868-197766890 AACTATATTTTCATAATCTTTGG - Intronic
944334471 2:198514330-198514352 GAAAGTATTTTCATGATCTTGGG - Intronic
944428629 2:199609851-199609873 AAAAATGTTTTCCTGATTTTCGG - Intergenic
944501802 2:200368978-200369000 CAGAATGTGTACATTATCTTTGG - Intronic
944508029 2:200434875-200434897 AAGATTGTTTTGACTATCTTAGG - Intronic
944979593 2:205101053-205101075 AAATATGTTTTCCTGTTCTTTGG - Intronic
945337572 2:208610866-208610888 AAGAATGATATAATGAACTTTGG - Intronic
945506511 2:210647929-210647951 AAGAATGGTGTCAAGATCATGGG + Exonic
945708154 2:213261606-213261628 AAGAATGTTTTCCTAAGGTTTGG + Intergenic
945983242 2:216333070-216333092 AAGAATGTTTTCATGATCTTTGG + Intronic
946012267 2:216574927-216574949 AAAACTGGTTTCATGATTTTGGG - Intronic
946988834 2:225304379-225304401 AAGAATTTTCTCATGTTCTTTGG - Intergenic
947279918 2:228439758-228439780 TAAAATGATTTCTTGATCTTTGG + Intergenic
947934273 2:233989975-233989997 AAAAATGTTTTTCAGATCTTAGG + Intronic
948313556 2:237009339-237009361 AAGAAAGAGTTCATGGTCTTAGG + Intergenic
949081371 2:242102930-242102952 AGGAAAGTCTGCATGATCTTGGG + Intergenic
1168958508 20:1851549-1851571 AATAAGGTTACCATGATCTTTGG - Intergenic
1169663771 20:8010769-8010791 AAGAATGTTTCCAAGATCTGTGG + Intronic
1170008392 20:11693831-11693853 AAGAAACTTATCATGATCTTTGG + Intergenic
1170350437 20:15434988-15435010 AAGAATGATATCATGGACTTTGG + Intronic
1171004578 20:21451909-21451931 AAGAACATTTACATGATCTTTGG + Intergenic
1171386874 20:24776229-24776251 AAGAGTGGTTACATGATATTAGG + Intergenic
1171724043 20:28599120-28599142 TAGAATATTTTCCTGATTTTGGG + Intergenic
1172040814 20:32044163-32044185 AAGTAAATTTTCATGACCTTGGG - Intergenic
1172370755 20:34388817-34388839 AAGAATGTTTTTTTGTTCTTAGG + Intronic
1172466598 20:35160141-35160163 CAGAATATCTTCATGACCTTGGG + Intergenic
1172488910 20:35318379-35318401 ATGAATGTGTTGATGATCTCTGG - Intronic
1172826262 20:37789332-37789354 AAGGATGTTTGGATGGTCTTTGG + Intronic
1173295680 20:41754044-41754066 AAGAATGATGTGATGAACTTTGG - Intergenic
1174816668 20:53693041-53693063 AAGAATGATATCATGGACTTTGG + Intergenic
1175450291 20:59060022-59060044 AAGAATGAGTTCATGTCCTTTGG + Intergenic
1176947896 21:15006146-15006168 AAGAATGTATTCATCATGTTGGG - Intronic
1177075056 21:16561711-16561733 AAGCATGACTTCATGATCTCTGG + Intergenic
1177221437 21:18198295-18198317 GAAAATATTTACATGATCTTTGG - Intronic
1177338636 21:19767444-19767466 GAGCATTTTTTCATGATTTTTGG + Intergenic
1177466191 21:21483772-21483794 AAAAATATTTTCATAATCTTTGG + Intronic
1177506868 21:22030646-22030668 AAGAATGAGTTCATGTCCTTTGG + Intergenic
1177624021 21:23635992-23636014 AAGGATATTTTCATGATCGGAGG - Intergenic
1177799446 21:25813486-25813508 CAGAAAATTTTCATGATGTTAGG + Intergenic
1178113060 21:29388864-29388886 ATGATTATTTTCATAATCTTAGG - Intronic
1179388327 21:40963380-40963402 AAGAATGATATCATGGACTTTGG + Intergenic
1179682498 21:43033647-43033669 GAGAATGTTTTCATGTTTTCTGG + Intronic
1181402518 22:22659866-22659888 AAGCATGTTTGCATTTTCTTGGG + Intergenic
1181561403 22:23704181-23704203 GAGCATGTTTTCATGCTCATTGG - Intergenic
1181843270 22:25683936-25683958 GAGAATATCTTCATGATCTTAGG - Intronic
1182343845 22:29645327-29645349 AAGATTGTCTGAATGATCTTGGG - Intronic
1182346267 22:29667833-29667855 AAGAATATCTTTATGATCATAGG - Intronic
1183233693 22:36599712-36599734 AAGAATGTTTTCTTGAGATAGGG + Intronic
1185140585 22:49098890-49098912 CAGAATGCTTTTATGATGTTAGG + Intergenic
949267220 3:2172368-2172390 AAGAATGATTTAATGGACTTTGG + Intronic
949627623 3:5885606-5885628 AATTATCTTTTCACGATCTTGGG + Intergenic
949924316 3:9028862-9028884 CAGAATGCCTTCATGAGCTTGGG + Intronic
950354419 3:12393436-12393458 ACCCATGTTTTCATGATCTGTGG + Intronic
950627355 3:14257490-14257512 AAGAATATCTTCATGACCCTGGG - Intergenic
950877798 3:16292984-16293006 AAGATTGTTTTGATGATTATGGG + Intronic
950927379 3:16755152-16755174 AAATATCTTTTCATGTTCTTTGG + Intergenic
951296621 3:20944028-20944050 AAGAATTTTTTCAAGATCTTTGG + Intergenic
952836680 3:37608453-37608475 AAAACTGTTTTCATCATCTTTGG + Intronic
953279534 3:41540352-41540374 AAGAATGAGTTCATGTCCTTTGG - Intronic
953888191 3:46731201-46731223 GAGAATGTCTTTATGACCTTGGG + Intronic
954086165 3:48245613-48245635 AAGAATGTTTTTCTGATCCTTGG - Intronic
955641010 3:61084002-61084024 TAGAATGTCTTCATGATTTTGGG - Intronic
956226726 3:66968286-66968308 AATAATATTTTCATTATCTTAGG + Intergenic
956738683 3:72258534-72258556 AGAAGTGTTTTCATGTTCTTAGG - Intergenic
957144120 3:76400071-76400093 AAGTTTGTTTTCAAGTTCTTGGG - Intronic
957543343 3:81604635-81604657 AATAATGTTTTCATAGTCGTTGG + Intronic
957563798 3:81859419-81859441 ATAAATTTTTTCATGAACTTGGG - Intergenic
957654274 3:83052275-83052297 AAGATTTTATTCATGCTCTTTGG + Intergenic
958660103 3:97056013-97056035 AAGAAAGTTTTAATAATATTAGG - Intronic
958787822 3:98617466-98617488 AAGGATGTCTTCATGATATTGGG + Intergenic
958792960 3:98673181-98673203 GAGAATATTATCACGATCTTGGG - Intergenic
958883066 3:99695449-99695471 AAGAATTTTTTCACCATCATGGG + Intronic
958942234 3:100329336-100329358 GAGAAAATTTTCATGATCTTGGG + Intergenic
959024658 3:101227071-101227093 TAGAAAGTATTCATGATTTTAGG - Intronic
959269939 3:104193859-104193881 GAGAATATCTTCATGATCTGGGG + Intergenic
960293219 3:115912231-115912253 AAAAAAGTCTTCATGATCTAGGG - Intronic
960421917 3:117456915-117456937 AAGAATGATGTCAACATCTTTGG + Intergenic
960779990 3:121310193-121310215 AATAATATCTTCATGATCATAGG + Intronic
961323403 3:126094261-126094283 AAGAATGATATCCTAATCTTTGG - Intronic
962327550 3:134448244-134448266 AGGAATGTTTTCATGAACTGTGG + Intergenic
962569555 3:136699030-136699052 AAGAATGATATAATGAACTTTGG + Intronic
962651261 3:137495172-137495194 AACAATGTCTTCATGACATTAGG - Intergenic
963495083 3:146048071-146048093 CAGAATGTCTTCATAAACTTTGG + Intergenic
963629437 3:147714051-147714073 AAAAATGTTTTAATGATTTATGG + Intergenic
964642341 3:158922732-158922754 GAGAATATCTTCATGAACTTGGG - Intergenic
964886516 3:161489907-161489929 AAGAATGTTCTCCCAATCTTGGG + Intergenic
965525344 3:169710756-169710778 AAGAATGTTTGCCTAATATTGGG - Intergenic
965612774 3:170562457-170562479 AAAAATGATTTCATGGACTTTGG + Intronic
965806081 3:172543302-172543324 AGGAATGTTTTCAAGTTCTCTGG - Intergenic
966042216 3:175505688-175505710 AAAAATGTGTTCAAGATCCTAGG + Intronic
966164043 3:176997343-176997365 AGCAATGTTTTCATTGTCTTAGG - Intergenic
966451391 3:180066892-180066914 AAGAATGTATGCAGGTTCTTGGG + Intergenic
966540966 3:181089287-181089309 AAGAATGTTTTACTGATATTTGG + Intergenic
967273214 3:187748032-187748054 AAGATTATTTTTATGATTTTTGG + Intergenic
967603081 3:191412839-191412861 AAGGCAGTTTTCCTGATCTTTGG - Intergenic
967780893 3:193438130-193438152 AATAAAGTTTTCAAAATCTTTGG - Intronic
968173734 3:196530524-196530546 AAAAATATTTTCATGACCTTGGG - Intergenic
968499781 4:943730-943752 AAACATGTTTTCATGACTTTTGG - Intronic
969116920 4:4876202-4876224 AAGAATGTCTTCATGTACTGTGG - Intergenic
969270939 4:6101127-6101149 CAGACTATTTTCATGATCTTGGG - Intronic
970077495 4:12240971-12240993 ATGAATGCTTTCAAGATCATGGG + Intergenic
970442144 4:16090529-16090551 AAGAATGTTTTCCTGGCTTTTGG - Intergenic
971008911 4:22408221-22408243 AAGAAGATCTTCATAATCTTGGG + Intronic
971407741 4:26338117-26338139 AAGAATGTTTCCATAATGTTAGG - Intronic
972152935 4:36117738-36117760 AAGAAGTTTTTAATTATCTTTGG + Intronic
972235111 4:37123031-37123053 AAGAATGTTTTTTTGTTCTAGGG - Intergenic
972255158 4:37346474-37346496 AAGATTGTTTTGGTCATCTTGGG + Intronic
972612212 4:40666481-40666503 AAGAATGATATAATGAACTTTGG - Intergenic
972827238 4:42773356-42773378 GAGAATCTTTTCATGATTATTGG - Intergenic
972941596 4:44201977-44201999 AAGTATGTGTTCATGTCCTTTGG - Intronic
973571519 4:52244534-52244556 AAGAATGTTCCCATGATTTTTGG - Intergenic
973575733 4:52287216-52287238 AAGTATGTGTTCACTATCTTTGG - Intergenic
973849040 4:54943073-54943095 AAAAATGTATTCATTATTTTGGG + Intergenic
973887087 4:55334166-55334188 AAGACTATCTTCATGATCCTAGG + Intergenic
973887200 4:55335559-55335581 GAGACTATCTTCATGATCTTGGG + Intergenic
974131136 4:57757399-57757421 AAGGATGATTTCATGTCCTTTGG + Intergenic
975137736 4:70890964-70890986 AAGAATTTTTTAATAATCTCAGG - Intergenic
975621762 4:76303794-76303816 AAGAATGTTTTTAGGATATGTGG + Intronic
976099241 4:81542836-81542858 AAGAATGAATTCATGTCCTTTGG - Intronic
976666231 4:87595623-87595645 AAGAATGATATAATGAACTTTGG - Intergenic
976721631 4:88174485-88174507 AAGAATGAGTTCATGTCCTTTGG - Intronic
977072931 4:92415491-92415513 AAGAATGATATAATGGTCTTTGG - Intronic
977165503 4:93690135-93690157 AAGAATGTTTACATAAAGTTTGG - Intronic
977312414 4:95404024-95404046 AAGAAAGTTTACATGCTTTTTGG - Intronic
977433408 4:96961730-96961752 AAGAAAGCCTTTATGATCTTGGG - Intergenic
977635148 4:99288992-99289014 GAGAATGATATCATGAACTTTGG - Intronic
977655339 4:99515068-99515090 AAGAATGTTATAATGGACTTAGG + Intronic
978381936 4:108138252-108138274 AATAATGTTTTCATGATGTATGG + Intronic
978568401 4:110110014-110110036 GAGAAAGTTTTCATGTTCTAAGG + Intronic
978872625 4:113598451-113598473 GAGAATATTTAGATGATCTTGGG + Intronic
980215162 4:129843355-129843377 ATGAATGTTTTATTGCTCTTTGG - Intergenic
980552297 4:134355047-134355069 AAGAATTTTATCATGATATTGGG + Intergenic
980817781 4:137970633-137970655 AAAAATGTCTTCGTGACCTTGGG - Intergenic
981396557 4:144256322-144256344 AAAAATATCTTCATGACCTTGGG - Intergenic
982212465 4:153050007-153050029 AAGAATATTTTCATGACCATAGG - Intergenic
982417249 4:155150108-155150130 AAGAAAATCTTTATGATCTTTGG - Intergenic
982702903 4:158675823-158675845 AAGTATGTTTTCATTATCTTAGG + Intronic
983383871 4:167032529-167032551 AAGATACTTTTTATGATCTTAGG - Intronic
983419564 4:167500461-167500483 AAGTAGGTTTTCATAGTCTTGGG + Intergenic
983899669 4:173120429-173120451 AGTAATTTTTTCATGATCTGAGG + Intergenic
984346632 4:178536726-178536748 AATAATATATACATGATCTTGGG + Intergenic
984367763 4:178820821-178820843 AAGATAGTTCTCATGAGCTTTGG - Intergenic
984450563 4:179895841-179895863 ATGAATCTTTTCATGAATTTTGG + Intergenic
984643929 4:182200404-182200426 AAGAATGTTCTCTTGGTCTGTGG - Intronic
984863695 4:184262317-184262339 AAGAACCTATTCATGATGTTAGG - Intergenic
985199406 4:187469256-187469278 AAGAATGTTTTCAAGGACCTAGG + Intergenic
985373527 4:189309846-189309868 AGAAATGTTTTCATGTTATTTGG - Intergenic
986217497 5:5733320-5733342 AAGTATCTGTTCATGAGCTTTGG + Intergenic
986232089 5:5875139-5875161 AACAATGTTTTTATGGTTTTTGG + Intergenic
986595947 5:9422142-9422164 AAGAATGCTTTCTTAACCTTTGG + Intronic
987160500 5:15136852-15136874 CAGAATATTTTCATGACCTTGGG + Intergenic
987497285 5:18663897-18663919 AAGGATTTTTTCATGTTTTTTGG - Intergenic
987735986 5:21844177-21844199 AAAAATGATTGCATCATCTTGGG - Intronic
988123623 5:26999903-26999925 AAGAATATCTTAATGACCTTGGG + Intronic
989178564 5:38554680-38554702 CAGAATGTTTACATGAGCATAGG + Intronic
989363791 5:40633595-40633617 AAGAATGATATAATGAACTTTGG + Intergenic
990629696 5:57654448-57654470 AAGAATTTTTTAAAAATCTTTGG - Intergenic
991204245 5:64031880-64031902 AAAAATGTTTTCCTGAGTTTTGG + Intergenic
991624959 5:68591456-68591478 AAGAATTTTTTCAAGTTCTATGG - Intergenic
992825398 5:80544966-80544988 GAGAATGTTTTCAGGACTTTGGG + Intergenic
992874410 5:81039063-81039085 GAGAATATCTTTATGATCTTGGG - Intronic
992972213 5:82073209-82073231 AAGAATTGTTTCATGAACCTTGG - Intronic
993416217 5:87635963-87635985 GAGCATGTCTTCATGATCTTCGG + Intergenic
993562244 5:89424559-89424581 AAGAATGATATAATGAGCTTTGG + Intergenic
993761117 5:91798737-91798759 AAGGATGTTTTGATTTTCTTTGG + Intergenic
993927598 5:93889599-93889621 ATTAATATTTTCATGTTCTTGGG - Intronic
994076886 5:95662313-95662335 GAGAATATTTTCATGACCTTAGG + Intronic
994599467 5:101884316-101884338 AGGCATGTTTTCATTAACTTTGG + Intergenic
994611233 5:102043400-102043422 GAGAGTTTCTTCATGATCTTTGG - Intergenic
994797587 5:104324234-104324256 AAGGATGATTTCTTGATATTTGG + Intergenic
995798958 5:115971409-115971431 AAGAAAGTTTTTATGAGCTTAGG - Intronic
995845559 5:116490283-116490305 AAGAATGTCTTTATGACCTGGGG - Intronic
995848174 5:116516755-116516777 AAGCATATTTTCAGGATGTTTGG - Intronic
996077229 5:119210358-119210380 GAGAAAGTTTTTGTGATCTTAGG - Intronic
996620477 5:125495984-125496006 GAGAATGTCTTTATGACCTTGGG + Intergenic
996826986 5:127694827-127694849 AAAAATGTTTTCTGGCTCTTTGG - Intergenic
997095419 5:130904993-130905015 AAGAAAATTTTCTTGACCTTGGG + Intergenic
997269183 5:132521958-132521980 AAGAATATTTTTGTGACCTTGGG + Intergenic
997673972 5:135698613-135698635 AAGAATATCTTTATAATCTTGGG + Intergenic
997730115 5:136164794-136164816 AATAATATTTTCATGACCTTGGG - Intronic
998315193 5:141176556-141176578 TAAAATGCTTTCATGGTCTTAGG + Intergenic
998600964 5:143584413-143584435 AAGAATGATATAATGAACTTTGG - Intergenic
998738297 5:145168566-145168588 TAGAATGGTTTCTTGATATTTGG + Intergenic
998811420 5:145970296-145970318 AAGAATGATATAATGGTCTTTGG - Intronic
998953025 5:147411186-147411208 GAAAATGATTTCATTATCTTTGG + Intronic
999451276 5:151679976-151679998 TAGAATGTGTTCATCATCTTGGG - Intronic
999510208 5:152242203-152242225 AAGCATATTTTCTTGCTCTTGGG + Intergenic
999634453 5:153606022-153606044 AAGAATATATTCCTGATCTCAGG - Intronic
1000681119 5:164186247-164186269 TAATATGTTTTCATGACCTTAGG + Intergenic
1000861404 5:166460264-166460286 AAGAATGTTTTCCAAATCTCAGG + Intergenic
1001241342 5:170073082-170073104 GAGAATATCTTCATGATCTTGGG - Intronic
1001582813 5:172810787-172810809 TAGAATATTTTTATGATCTCAGG + Intergenic
1001944174 5:175764265-175764287 AAGGTTTTTTTCCTGATCTTAGG + Intergenic
1002588856 5:180273572-180273594 GAGAATGTCTTCATGATCTTTGG - Intronic
1002600113 5:180349489-180349511 AAGAAGGTTTTTCTGAACTTGGG + Intronic
1003172150 6:3728293-3728315 AAGAATGATATCATGGACTTTGG - Intronic
1003240571 6:4342101-4342123 AAAAATATATTCATGAGCTTAGG + Intergenic
1004261837 6:14115330-14115352 GAGAATGTTTTTATGATCTCAGG + Intergenic
1004737048 6:18417647-18417669 AGAAAAATTTTCATGATCTTGGG + Intronic
1004964214 6:20829492-20829514 AAGAAAGTTTTCGTGATATGAGG - Intronic
1005020133 6:21410028-21410050 AAGAATGAGTTCATGTCCTTTGG + Intergenic
1005607309 6:27487742-27487764 TAGAACATCTTCATGATCTTGGG + Intergenic
1005660346 6:27992102-27992124 AAGAATCATTTCTTGGTCTTGGG - Intergenic
1005679886 6:28196162-28196184 AAGAATTTTTTCTTTGTCTTTGG + Intergenic
1005808430 6:29496765-29496787 ACAAATGTTTTATTGATCTTTGG - Intergenic
1006431160 6:33997025-33997047 GAGAATATTTTCATGAACTTGGG + Intergenic
1006586373 6:35117146-35117168 AACAATGTTCTCATCATTTTAGG - Intergenic
1006819063 6:36876250-36876272 AAGAAAGTGATCATGATCTTGGG - Intronic
1007063690 6:38967805-38967827 AAGATTGTTTTAGTTATCTTGGG - Intronic
1008116453 6:47556369-47556391 AAGAATGAGTTCATGTCCTTTGG - Intronic
1008338482 6:50335853-50335875 AAGAATGGTATAATGAACTTTGG + Intergenic
1008609681 6:53174234-53174256 AATAATGTTTTAGTGATATTGGG - Intergenic
1008875819 6:56325224-56325246 AAAAATCTTTTCCTCATCTTAGG - Intronic
1009038546 6:58148410-58148432 AATAATGTTTTCTTAACCTTTGG + Intergenic
1009214435 6:60903277-60903299 AATAATGTTTTCTTCACCTTTGG + Intergenic
1009267659 6:61575920-61575942 AAGAATGATATAATGAACTTTGG + Intergenic
1009572555 6:65406508-65406530 TAAAATGTCTTCATGACCTTGGG - Intronic
1009908499 6:69897061-69897083 AACAAAGTCTTCATGAACTTGGG - Intronic
1010015068 6:71095433-71095455 AAGAATGATTTAATGGACTTTGG - Intergenic
1010139312 6:72595541-72595563 AAGAATGTTTCATTGATATTTGG - Intergenic
1010391778 6:75346011-75346033 AAGGATGTTTTCTAGATTTTAGG - Intronic
1010736206 6:79446346-79446368 AAGAAGGTTGTCAATATCTTTGG + Intergenic
1010915315 6:81609933-81609955 AAGAATGCATTCATAAACTTTGG + Intronic
1011133806 6:84078058-84078080 GAGAATATCTTCATGATGTTAGG + Intronic
1011762364 6:90581744-90581766 AAGAATGTATTGATTATTTTAGG + Intronic
1011951267 6:92967985-92968007 CACAATATTTTCATGACCTTGGG - Intergenic
1012239514 6:96856203-96856225 AAGAATGATATAATGAACTTGGG - Intergenic
1012293179 6:97484295-97484317 AAGAATGATATCATGGACTTTGG - Intergenic
1012301559 6:97594857-97594879 GAGAATGTCTTCATAATCTCGGG + Intergenic
1013190226 6:107796717-107796739 GACAATATCTTCATGATCTTGGG - Intronic
1013498235 6:110720298-110720320 AAGACTTCTTTCACGATCTTTGG + Intronic
1014650813 6:124034879-124034901 GAGCATTTTTTCATGATTTTTGG + Intronic
1014731413 6:125035725-125035747 AAGAACATCTTCATGACCTTGGG - Intronic
1014792268 6:125686777-125686799 AAGAATGATATCATGGACTTTGG - Intergenic
1014953156 6:127583452-127583474 AAGACTTTATTCATGATCTTGGG + Intronic
1015246261 6:131077965-131077987 AAGAATGTCTTCATAATCTTGGG + Intergenic
1015327505 6:131940334-131940356 AAGAATGAGTTCATGTCCTTTGG + Intergenic
1015349272 6:132197568-132197590 ATGAATGTTTTAGTGATCTGTGG - Intergenic
1015696211 6:135982747-135982769 AAAAATGGCTTCATGATCTCTGG - Intronic
1016152031 6:140752591-140752613 AAAAATATCTTCATAATCTTGGG - Intergenic
1016175449 6:141073297-141073319 AAGAAAATTTTCCTAATCTTGGG - Intergenic
1017078708 6:150645371-150645393 AAGAATATTTTCATGTCCTTGGG + Intronic
1017281727 6:152633112-152633134 AAAACTGTTTTAATAATCTTGGG - Intronic
1017871708 6:158492281-158492303 AAGAAAGGCTTCATGACCTTAGG - Intronic
1018587999 6:165384367-165384389 AGGATTGTTTTCATGGTGTTTGG - Intronic
1019030119 6:169002775-169002797 AAGAATATTTTCATCATATGTGG - Intergenic
1020065780 7:5187506-5187528 GAGAATGCCTTCATGATTTTGGG - Intergenic
1020641041 7:10754074-10754096 AAGGATGAATTCATGTTCTTTGG + Intergenic
1020834603 7:13133605-13133627 AAGAAAATCTTTATGATCTTTGG + Intergenic
1021183778 7:17539003-17539025 AAGAATGATACCATGAACTTTGG + Intergenic
1021361627 7:19720740-19720762 AAGAATTCTTTCAGGATCTTTGG + Exonic
1022402951 7:30058357-30058379 CAGAATATCTTCATGACCTTTGG - Intronic
1022578451 7:31522675-31522697 AGGCATGTTTTCATGATGCTAGG + Intronic
1023193372 7:37607965-37607987 AAGAATATTTTTATAATCTTGGG - Intergenic
1023554942 7:41411853-41411875 AATAATGTTGTAATGATCATGGG + Intergenic
1023778059 7:43628938-43628960 AAGAGTATCTTCATGAGCTTGGG - Intronic
1024102017 7:46042303-46042325 AAAAATTTTTTCCTAATCTTTGG + Intergenic
1024736921 7:52315340-52315362 AAGAATGAGTTCATGTCCTTTGG + Intergenic
1024999700 7:55305235-55305257 GAGAATTTTTTCATGATTTTTGG - Intergenic
1026143800 7:67728221-67728243 AAGAATGATATAATGAACTTTGG - Intergenic
1026733721 7:72934553-72934575 AAGAAAATTATCATGACCTTAGG - Intronic
1026784002 7:73289106-73289128 AAGAAAATTATCATGACCTTAGG - Intergenic
1027110032 7:75430593-75430615 AAGAAAATTATCATGACCTTAGG + Intronic
1028194913 7:87894830-87894852 AAGATTTTTTTCTTTATCTTTGG + Intronic
1028274379 7:88835213-88835235 AAAAGTGATTTCATGATCTTGGG - Intronic
1028392086 7:90328210-90328232 AAGAATATCTTTCTGATCTTGGG + Intergenic
1028581707 7:92415854-92415876 AAGAATGCTATCATGGACTTTGG - Intergenic
1028792486 7:94868286-94868308 AAGCATTTTTTCATGTTTTTTGG + Intergenic
1029102444 7:98143252-98143274 CAGAATATTTTTATCATCTTGGG + Intronic
1029562465 7:101311989-101312011 AAGTTTGTTTTAATCATCTTAGG - Intergenic
1030446710 7:109654837-109654859 AAGAAAATTTTCATGACCTGAGG + Intergenic
1030727935 7:112948136-112948158 AAGAATGATATCATGGGCTTTGG - Intergenic
1030794090 7:113765935-113765957 AATAATGTTGTAATGAACTTAGG + Intergenic
1031326760 7:120409651-120409673 AAGCATCTTTTCATGTTTTTTGG + Intronic
1031458831 7:122019595-122019617 AAAAATGTTTTCTTAATTTTTGG - Intronic
1034381152 7:150694029-150694051 AAGATTGATTTCTTCATCTTAGG - Intergenic
1035243497 7:157547491-157547513 AAAAAAGTTCTCATGAGCTTTGG - Intronic
1035539282 8:419724-419746 AGGAAAGTCTGCATGATCTTGGG + Intronic
1036119047 8:5995034-5995056 GAGAATATCTTCATGAACTTGGG + Intergenic
1037006257 8:13784614-13784636 TAGAATGATTTCATTATCCTTGG + Intergenic
1037204693 8:16302278-16302300 AAGAACATTTTTATGCTCTTGGG + Intronic
1037283117 8:17265857-17265879 AATAATGGTTTCATGACTTTGGG + Intronic
1037312101 8:17566875-17566897 ACGAATGTTTTCCTTGTCTTGGG - Exonic
1037498470 8:19463136-19463158 AAGAATGAAATCATGTTCTTTGG - Intronic
1038040931 8:23723323-23723345 AAGAATATTTTCAGGACTTTGGG + Intergenic
1038161052 8:25038330-25038352 AGGAATATCTTCATGATCTTTGG - Intergenic
1038227231 8:25668665-25668687 AAGAATGAGCTCATGGTCTTTGG - Intergenic
1038300827 8:26345984-26346006 AAGAATGTTTAAATAATCTGTGG - Intronic
1038384653 8:27131321-27131343 ATGAATATTTTCATAATCTTGGG + Intergenic
1038605183 8:28994541-28994563 ATGAATGTTTTTATTATATTGGG + Intronic
1038655041 8:29442912-29442934 TAGAATATCTTCATGACCTTGGG + Intergenic
1038684596 8:29704752-29704774 AAGAATGTTGTAATGGACTTTGG - Intergenic
1039232348 8:35462566-35462588 AAGAATATTTTGATGATCACTGG - Intronic
1039677790 8:39689018-39689040 AAGTATCTGTTCATGTTCTTTGG + Intronic
1040857071 8:51959422-51959444 AATCATGTTTTCATGATATTAGG + Intergenic
1041275531 8:56153959-56153981 TAGAATATCTTCATGACCTTAGG + Intergenic
1041577507 8:59416526-59416548 AAGAATATCTTAATGACCTTGGG + Intergenic
1042089136 8:65139716-65139738 AAGAATGATATAATGGTCTTTGG + Intergenic
1042480761 8:69300067-69300089 TAGAAATTTTACATGATCTTAGG + Intergenic
1042695881 8:71554982-71555004 AAGAAACTGTTCATAATCTTTGG - Intronic
1042727001 8:71889361-71889383 ATGAGTGTTTACCTGATCTTTGG + Intronic
1042767988 8:72347443-72347465 GAGAATGTTTTCATGTTTGTTGG + Intergenic
1043088549 8:75868937-75868959 AAGATTCTTTTCATGATATGGGG - Intergenic
1043202182 8:77384102-77384124 AAGAATCATTTAATGAACTTTGG + Intergenic
1043263091 8:78226420-78226442 AATAATGTTTTCATAGTCCTGGG - Intergenic
1043890793 8:85650717-85650739 AAGCATGTGTTCATGCCCTTCGG - Intergenic
1043893695 8:85719786-85719808 AAGCATGTGTTCATGCCCTTCGG + Intergenic
1043896375 8:85741235-85741257 AAGCATGTGTTCATGCCCTTCGG + Intergenic
1043898626 8:85758940-85758962 AAGCATGTGTTCATGCCCTTCGG - Intergenic
1043900239 8:85771134-85771156 AAGCATGTGTTCATGCCCTTCGG - Intergenic
1043902201 8:85786409-85786431 AAGCATGTGTTCATGCCCTTCGG - Intergenic
1043903810 8:85798602-85798624 AAGCATGTGTTCATGCCCTTCGG - Intergenic
1043905422 8:85810796-85810818 AAGCATGTGTTCATGCCCTTCGG - Intergenic
1043907031 8:85822983-85823005 AAGCATGTGTTCATGCCCTTCGG - Intergenic
1044826935 8:96207737-96207759 AAGAATGATTCCAGGATTTTTGG - Intergenic
1045367255 8:101488093-101488115 AAGAATCTTTTCTTCTTCTTTGG - Intergenic
1045613419 8:103875870-103875892 AAGAATTTTTTCATGTTTGTTGG + Intronic
1045854965 8:106754368-106754390 GAGAATATCTTCATGACCTTAGG + Intergenic
1046043798 8:108939048-108939070 GGGAATATCTTCATGATCTTGGG + Intergenic
1046480845 8:114815862-114815884 GAGAATTTTTTCATGTTTTTTGG - Intergenic
1046488024 8:114910908-114910930 AAGAATGTCTTCAAGGTCTGAGG - Intergenic
1047031125 8:120882017-120882039 AAGATTGTTTTCTTCATTTTCGG + Intergenic
1047687941 8:127320091-127320113 AAGCATTTTTTCATGTTTTTTGG - Intergenic
1048616594 8:136081748-136081770 AAGAATGCTTGCATGGTCTTTGG - Intergenic
1050032550 9:1401627-1401649 AAGGCTGTTTTCATGGACTTCGG - Intergenic
1050100087 9:2109974-2109996 AAAAATGTTTTCATTGTTTTAGG + Intronic
1052266909 9:26584990-26585012 AATAATGTTGTGATGATCATGGG + Intergenic
1052300962 9:26952053-26952075 AAGAATGTTTTTCTCCTCTTTGG - Intronic
1052754558 9:32527103-32527125 AACAATATTTTCATGACCTTGGG - Intergenic
1052905450 9:33829696-33829718 AAGAATGTTTCCCTAAGCTTAGG - Intronic
1053225878 9:36356570-36356592 AAAAACATTTTCATGATTTTGGG - Intronic
1053507583 9:38656576-38656598 AAGAACATCTTCATGACCTTGGG + Intergenic
1053544556 9:39009495-39009517 AGGCCTGTTTTCATGGTCTTAGG + Intergenic
1053808990 9:41832977-41832999 AGGCCTGTTTTCATGGTCTTAGG + Intergenic
1054621602 9:67354451-67354473 AGGCCTGTTTTCATGGTCTTAGG - Intergenic
1054884411 9:70180178-70180200 AAGAATGAGTTCATGTCCTTTGG - Intronic
1054889882 9:70239818-70239840 AAGAATGAGTTCATGTCCTTTGG + Intergenic
1055000468 9:71443775-71443797 AAGACTTTATTCATGATCTGAGG - Intronic
1055391149 9:75822958-75822980 AAGAATGATCTCATCATATTAGG - Intergenic
1055774635 9:79754256-79754278 GAGAATGTTTTCATCCTCTTAGG + Intergenic
1056471384 9:86907409-86907431 AAGAATGTTTTTATAATTCTTGG - Intergenic
1056486561 9:87063990-87064012 TAAAATGTTTTCATGATTTATGG - Intergenic
1056513254 9:87326285-87326307 ATATGTGTTTTCATGATCTTGGG - Intergenic
1056534124 9:87512966-87512988 AAGAATTATTTCTTGTTCTTTGG + Intronic
1056922748 9:90806355-90806377 AAGAATGTTTGGAGGATATTTGG + Intronic
1058174594 9:101722593-101722615 AAGTATGTTCTCATGGTCTTGGG - Intronic
1058189185 9:101892131-101892153 ATGCATGTTTGCATGTTCTTTGG + Intergenic
1058383112 9:104400929-104400951 AAGAATGTTTTCATTGAATTTGG + Intergenic
1058494437 9:105540492-105540514 AAGAATATTTTCATGACCTTGGG - Intronic
1058775949 9:108283947-108283969 AAGCGTGTTTTCATATTCTTTGG - Intergenic
1059065377 9:111078240-111078262 AAGTTTCTTTTCAAGATCTTTGG + Intergenic
1059285011 9:113165057-113165079 AAGACTGATTGCATAATCTTTGG + Intronic
1059410889 9:114131603-114131625 GAGACAGATTTCATGATCTTTGG + Intergenic
1060308226 9:122435368-122435390 AGGAAAGTTCCCATGATCTTGGG - Intergenic
1060968738 9:127726019-127726041 ATGAATATCTTTATGATCTTGGG - Intronic
1061269702 9:129531523-129531545 ACGATTGATTTCTTGATCTTGGG - Intergenic
1185769648 X:2755835-2755857 CAGAATGTTTTTGGGATCTTGGG - Intronic
1186075669 X:5875692-5875714 GAGCATGTTTTCATGCTTTTTGG - Intronic
1186320832 X:8423128-8423150 AAGAATATGTTTATGAGCTTGGG - Intergenic
1186371085 X:8947978-8948000 GTGTATTTTTTCATGATCTTAGG + Intergenic
1186887320 X:13926827-13926849 AAGAACATTTTCATGACTTTGGG + Intronic
1187356658 X:18580046-18580068 AAGAATATTTTCATAAGCATTGG + Intronic
1187371648 X:18713724-18713746 CAGAATGTTGTCATTATCTCTGG - Intronic
1187402686 X:18975630-18975652 AAGAATGACTTCAAGATTTTAGG - Intronic
1187432201 X:19235329-19235351 AAGAATGATATCATGGACTTTGG - Intergenic
1187994071 X:24906493-24906515 AAGAATGATATAATGAACTTTGG + Intronic
1188048583 X:25456694-25456716 AAGATTTTTTTCTTGATCATGGG + Intergenic
1188235604 X:27727402-27727424 AAGAATATCTTTATGAGCTTTGG - Intronic
1188349636 X:29112355-29112377 GAGAATATTTGTATGATCTTAGG - Intronic
1188819699 X:34759701-34759723 AAGAATGTTTTTGTGATGATAGG - Intergenic
1188916182 X:35913855-35913877 AAGAATGATATAATGAACTTTGG - Intergenic
1189584641 X:42445961-42445983 AAGAATGATATAATGAACTTTGG + Intergenic
1189722596 X:43935656-43935678 AACAATGTTTCAATGAACTTGGG - Intergenic
1190155065 X:47983881-47983903 GAAAATGTTTTCATAAGCTTTGG + Intronic
1190439171 X:50460163-50460185 CAGAAAGTTTTCATGAACTCTGG - Intronic
1191095042 X:56665060-56665082 AAAAATGGTTTCATGAGCCTAGG + Intergenic
1191947641 X:66553369-66553391 AAGAATTTTTTCATGTTTTTTGG - Intergenic
1192003389 X:67181619-67181641 AAGTGTGTTCACATGATCTTGGG - Intergenic
1192319238 X:70076262-70076284 AAGAATGTTTTGATAATCAGAGG + Intergenic
1193596965 X:83458760-83458782 AAGAATGATATAATGAACTTTGG + Intergenic
1193622327 X:83771206-83771228 AAGAAAGTTTACAGGATCTATGG - Intergenic
1194325087 X:92504936-92504958 AAGTATCTGTTCATGTTCTTTGG + Intronic
1194471059 X:94297431-94297453 AAGCATTTTTTCATGTTCATTGG + Intergenic
1194965079 X:100279061-100279083 AAGACTCATTTCTTGATCTTTGG - Intergenic
1195061670 X:101201545-101201567 AAGAGTATCTTCTTGATCTTAGG - Intergenic
1195074196 X:101310978-101311000 AAGAAAGTCTTCAGGATCTAGGG - Intergenic
1195345136 X:103942188-103942210 AGGAATATCTTCATGATATTGGG - Intronic
1195498834 X:105570141-105570163 AAGAATGTTATAATGAACTTTGG - Intronic
1195801541 X:108717404-108717426 AAGAACGTTTTCAACATTTTTGG - Intergenic
1195974024 X:110505610-110505632 AAGAAATTCTTCATTATCTTGGG + Intergenic
1196056311 X:111359448-111359470 ATGAATTTTTTTATCATCTTTGG + Intronic
1196528620 X:116757363-116757385 AAGAATGTTTTCTTAGTTTTTGG + Intergenic
1197048735 X:122032166-122032188 AAGAATGTTACAATGAACTTTGG - Intergenic
1197086323 X:122480244-122480266 AAGGATGTTTTCATGTCCTTGGG - Intergenic
1197186059 X:123588558-123588580 AAGATTGTTTTCATAATTTCAGG + Intergenic
1198035821 X:132800501-132800523 AACAATGTTTCCATGGGCTTAGG - Intronic
1198262834 X:134981433-134981455 AAGAGTGTTTTAATGACATTTGG + Intergenic
1199424748 X:147688127-147688149 AAGAATGATATTATGAACTTTGG + Intergenic
1201168777 Y:11236701-11236723 AAAAATGTTATCCTAATCTTTGG + Intergenic
1201300866 Y:12503794-12503816 CAGAATGTTTTTGGGATCTTGGG + Intergenic
1201669666 Y:16504509-16504531 GAGAATTTGTTCATGATCTCAGG - Intergenic