ID: 945983243

View in Genome Browser
Species Human (GRCh38)
Location 2:216333071-216333093
Sequence AGAATGTTTTCATGATCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 651
Summary {0: 1, 1: 1, 2: 2, 3: 67, 4: 580}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945983241_945983243 5 Left 945983241 2:216333043-216333065 CCATAACTCTTCTAGAAGAAAAC 0: 1
1: 1
2: 51
3: 387
4: 2843
Right 945983243 2:216333071-216333093 AGAATGTTTTCATGATCTTTGGG 0: 1
1: 1
2: 2
3: 67
4: 580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945983243 Original CRISPR AGAATGTTTTCATGATCTTT GGG Intronic
900961114 1:5920929-5920951 AGAATATTTTTATGGCCTTTGGG - Intronic
901382591 1:8884480-8884502 AGAATTTTCTCATTATCTTGTGG - Intergenic
904428148 1:30444939-30444961 AGACTGCTTTCAGGATCTCTTGG - Intergenic
904636849 1:31888655-31888677 AGCATCTTTTCATGTGCTTTTGG + Intergenic
906089889 1:43169997-43170019 ACAATTTTTTCATGAACTTGGGG - Intronic
906467849 1:46100227-46100249 AGAATGTTTTTATGATACTAGGG - Intronic
907905280 1:58778953-58778975 AAAATGTTATCATGCTCATTAGG + Intergenic
908172506 1:61520253-61520275 AGAATCTTTTCATGTGCTGTTGG + Intergenic
908707110 1:66969739-66969761 AGAAAGTTTTTATGTTGTTTTGG - Intronic
908905991 1:69009976-69009998 AGAATATTTTCATGACCTCGGGG - Intergenic
909126283 1:71674527-71674549 TGAATATTTTCATAATCCTTTGG + Intronic
909315329 1:74210817-74210839 AGCATTTTTTCATGTTTTTTTGG + Intronic
909892445 1:81024535-81024557 AGAATGATTTCATATTCTTTGGG - Intergenic
910127000 1:83853758-83853780 AGAAAGTTTTGAAGATCTTTTGG + Intergenic
910128683 1:83875992-83876014 GGAATATTTTCATGACCTTGAGG - Intronic
912051339 1:105532244-105532266 AGAATGATATAATGAACTTTGGG - Intergenic
913024112 1:114818397-114818419 AGCATCTTTTCATGTGCTTTTGG + Intergenic
913094224 1:115501381-115501403 AAAATGTTGTCATGATCTGATGG + Intergenic
915492256 1:156257516-156257538 AGAGTGTCTTCAAGAGCTTTAGG + Intronic
915860676 1:159440978-159441000 AGAATTTTTTACTGACCTTTTGG + Intergenic
915877901 1:159631692-159631714 GGAATGTCTTCATGACCTTGCGG - Intergenic
916382200 1:164224503-164224525 AGAATGATATAATGAACTTTGGG + Intergenic
916996937 1:170311131-170311153 AGAATGTGTTCATGCTCTCCTGG - Intergenic
917257689 1:173133208-173133230 CACATGTTTTCATGATCTTCTGG + Intergenic
918597484 1:186308375-186308397 GGACTGTTTTCAAGAGCTTTTGG - Exonic
918648175 1:186926066-186926088 AGAAGGTTTTGATGATATCTTGG + Intronic
919982218 1:202649241-202649263 AGCATGTGTACATGAGCTTTAGG + Intronic
920445924 1:206016520-206016542 AAAATGTTTTCATGACCTTAAGG - Intronic
920544634 1:206805732-206805754 AGAATCTGTTCATTATCTTTAGG - Intronic
920995863 1:210990452-210990474 TGAATCTTTTCTTGACCTTTGGG - Intronic
922207253 1:223459244-223459266 AGAATATTTTCATAATCTTGGGG - Intergenic
923263982 1:232294917-232294939 AGCATTTTTTCATGTTTTTTTGG + Intergenic
923362381 1:233224382-233224404 AAAATGTTTTCTTAGTCTTTGGG - Intronic
923797201 1:237169219-237169241 AGAATGATCTCTTGATATTTGGG - Intronic
923927612 1:238651920-238651942 AGATTATCTTCATGATCTTGGGG + Intergenic
924043241 1:240004209-240004231 AGAATGTGTTCATGACCTTAGGG - Intergenic
924395587 1:243616401-243616423 AGAATGTTTTCCCCAACTTTGGG + Intronic
1062998070 10:1886845-1886867 AAAATGTATTCATGCTCATTTGG + Intergenic
1064173594 10:13055086-13055108 AGTAAGTCTTCATGATGTTTGGG - Intronic
1064936543 10:20684832-20684854 ACAATGCTTTCCTTATCTTTTGG + Intergenic
1065079274 10:22111604-22111626 AGAATGTTTTCAGAAGCTGTTGG + Intergenic
1065158890 10:22898547-22898569 AGAATGATATAATGAACTTTGGG + Intergenic
1065192731 10:23228815-23228837 AGCATTTTTTCATGTTTTTTTGG - Intronic
1065268590 10:24002824-24002846 AGAATGATATAATGAACTTTGGG - Intronic
1065405961 10:25365026-25365048 AAAATGTTTTCAAGTACTTTAGG - Intronic
1067898508 10:50212728-50212750 AGAATGTTTTCCTGATTACTTGG + Intronic
1068474944 10:57513138-57513160 AGAATGGTTTCATTATGTGTTGG + Intergenic
1068532009 10:58199948-58199970 AGCTTATTTTCATGTTCTTTGGG - Intronic
1068534391 10:58224850-58224872 AATATGTTTTCATGATCCTGTGG + Intronic
1068566673 10:58583388-58583410 AGAATGTTATAATGGACTTTGGG - Intronic
1068597209 10:58915782-58915804 AACATGTTTTCATGTTGTTTTGG + Intergenic
1069480003 10:68773232-68773254 AGAAAGTTTTTCTGATTTTTAGG + Intronic
1069646944 10:70007114-70007136 GGCATATTTTCATGATCTGTAGG - Intergenic
1070552204 10:77498759-77498781 AGAATGTTTTCAAGGTCTGGTGG - Intronic
1071219883 10:83453329-83453351 AGAGTGTTATCATGGTGTTTGGG + Intergenic
1071720683 10:88141756-88141778 AGTAGGTCTTCATGATCTTGGGG - Intergenic
1072207703 10:93219413-93219435 AGCATTTTTTCATGATTGTTTGG - Intergenic
1073518264 10:104098959-104098981 AAAGTGTTTTCAGGATGTTTAGG + Intergenic
1073916675 10:108412877-108412899 AGAAAGTTTCCCTGATCTTGTGG - Intergenic
1074579648 10:114706886-114706908 AGGTTGTTTTCATGTTCTTTAGG - Intergenic
1074622600 10:115141119-115141141 ATTATGTTTTGATCATCTTTGGG + Intronic
1075369202 10:121920627-121920649 TGGATTTTTTCATAATCTTTTGG - Intronic
1076251831 10:128990947-128990969 ACATTGTTTTCTTGATCTTGGGG + Intergenic
1076465334 10:130677288-130677310 AGAATGCCTTCTTGATCTTGGGG + Intergenic
1076800216 10:132818376-132818398 AGAATATTTTCATGATCATGAGG + Intronic
1078126450 11:8569526-8569548 AGAATGTTTTTATGACTTTCAGG + Intronic
1078179382 11:8998039-8998061 AGAATGATTTCAGGCCCTTTTGG - Intronic
1078275087 11:9836189-9836211 AGAATGTCTCCATGACCTTGAGG - Intronic
1078968874 11:16382166-16382188 TGAATGTTTTGATGATGGTTGGG - Intronic
1079172593 11:18110424-18110446 AAGATGGTTTCATGTTCTTTGGG + Intergenic
1079435682 11:20446530-20446552 AGAATATTTTCATGTTCCTGTGG - Intronic
1079625213 11:22608962-22608984 AACATTTTTTCATGGTCTTTTGG - Intergenic
1079931082 11:26561815-26561837 AAAATGAATTCAAGATCTTTAGG - Intronic
1080284710 11:30596693-30596715 AGGATCTTTTGAGGATCTTTAGG + Intergenic
1080592827 11:33738237-33738259 AGAATGGTTTCTTGACCATTCGG + Intergenic
1080846137 11:36028708-36028730 AAAATATTTTCATAATCATTGGG - Intronic
1081169950 11:39855242-39855264 AAAATGTTTTCCTAATATTTTGG + Intergenic
1081719294 11:45275553-45275575 AGAATGTTACAATGATATTTGGG - Intronic
1081762037 11:45583376-45583398 AGAATGGTTTCATGATGTCTGGG - Intergenic
1081950980 11:47042259-47042281 AGAAAGATTTCATTATTTTTAGG + Intronic
1083930832 11:65843650-65843672 AGAATATCTTCATGACCTTGGGG + Intronic
1085105570 11:73839695-73839717 AGGATGTCTCCATGATCTTAAGG + Intronic
1085559772 11:77460597-77460619 AGAATGTTTGAATGATGCTTAGG + Intronic
1086588732 11:88485989-88486011 TGAATGTTTACCTGATATTTTGG + Intergenic
1087311065 11:96544265-96544287 ATAATATTTTCATTATTTTTAGG + Intergenic
1088301774 11:108365669-108365691 AAAATGTTTTGATGGTCTTAAGG + Exonic
1088370682 11:109085153-109085175 AGCATTTTTTCATGGTCTGTTGG + Intergenic
1088592809 11:111417845-111417867 GGACTGTTTTCATGTTCTTGGGG + Intronic
1088729681 11:112670163-112670185 AGAATATTTTTATGACCTTGTGG - Intergenic
1089204786 11:116751118-116751140 AGAAGATTTTCAAGATGTTTTGG - Intronic
1089819909 11:121215527-121215549 AGAATGATTTAATGGACTTTGGG + Intergenic
1090222313 11:125038613-125038635 AAAAGGTCTTCATGATATTTTGG + Intronic
1091070256 11:132556366-132556388 TGAATGTTTTGAAGATCTTTGGG - Intronic
1092072571 12:5644097-5644119 AAAATATTTTCATGACCTTGGGG - Intronic
1092085000 12:5749610-5749632 AGTATGTTTTAATATTCTTTTGG - Intronic
1092108593 12:5943476-5943498 AGAATGATATCATGGACTTTGGG + Intronic
1092250980 12:6896553-6896575 AGAATATTTTCATAACCTTAGGG + Intronic
1092300560 12:7245283-7245305 AGAATATCTTCATGTCCTTTGGG + Intergenic
1092397341 12:8139379-8139401 ATAATGATTTCATTTTCTTTTGG + Intronic
1092510532 12:9151169-9151191 AGAATGTTAACATTATCATTAGG + Intronic
1093499144 12:19791082-19791104 AGAATATCTTCATGACCTTGGGG + Intergenic
1094747052 12:33357150-33357172 AGCATGCTTTCTTGATCTCTTGG - Intergenic
1095139363 12:38642677-38642699 AGAATGTTTTCAGGTTCTGAAGG + Intergenic
1095380560 12:41585770-41585792 AGAGTGATTTAATGGTCTTTGGG - Intergenic
1095404494 12:41853048-41853070 ATAATATTTTTATGATATTTTGG + Intergenic
1096767572 12:53905890-53905912 AGAATGTCTTTATGATCTCAGGG - Intergenic
1096970025 12:55658161-55658183 CATATGTTTTCATGATCTCTAGG - Intergenic
1097437333 12:59566863-59566885 AAAATATTTTCATGATCTCAGGG + Intergenic
1097509748 12:60523471-60523493 AGCATCTTTTCATGTTCTTTTGG + Intergenic
1097649993 12:62285770-62285792 AGAATGATTTCATTTCCTTTGGG + Intronic
1097975179 12:65678219-65678241 AGAATGTTTTAAATTTCTTTTGG - Intergenic
1098341142 12:69452602-69452624 AGAATGTATTTATGACCTTAAGG - Intergenic
1099121844 12:78700175-78700197 AGAATGTATTTATAATATTTGGG - Intergenic
1099125247 12:78747097-78747119 ATAATGTTTTCATCAAATTTAGG - Intergenic
1099127584 12:78783304-78783326 AAAATGTTTGCATCATGTTTTGG + Intergenic
1099412105 12:82343867-82343889 AGAATGATCTCATGATATTTAGG + Intronic
1099778251 12:87162029-87162051 AGAATGATGTAATGAACTTTAGG - Intergenic
1099970926 12:89499826-89499848 AGAATATCTTCATGACCTTGGGG + Intronic
1100876254 12:98965552-98965574 ATAGTGTTTTCATTGTCTTTTGG - Intronic
1101140431 12:101790137-101790159 AGATTTTTTTCATAATCTCTGGG - Intronic
1101407639 12:104442655-104442677 AACGTGTTTTCATGACCTTTTGG + Intergenic
1102435336 12:112918474-112918496 AGAATGATTTCTTTACCTTTGGG + Intronic
1102940209 12:116934335-116934357 ACACTGTTTTCAAGATGTTTCGG - Intronic
1103761594 12:123254170-123254192 AGCCTGTTTCCAGGATCTTTTGG + Intronic
1105498949 13:20954611-20954633 AGAATTTCTTCATCATCTTAGGG + Intergenic
1106465679 13:30012550-30012572 ACAAAGTTCTCATGAGCTTTAGG - Intergenic
1106694143 13:32152687-32152709 AGAAGATTTTCATGACCTTCAGG + Intronic
1106944112 13:34806661-34806683 AGATAGTTTCCAAGATCTTTGGG + Intergenic
1107572649 13:41679476-41679498 ACAATGTTTTTTTGAACTTTGGG - Intronic
1107659250 13:42622469-42622491 AGAATGATATAATGAACTTTGGG + Intergenic
1109818844 13:67624446-67624468 AAAATCTTTTCATGATGATTAGG - Intergenic
1110104416 13:71653345-71653367 AGATTGTTTTGTTGTTCTTTTGG - Intronic
1110143537 13:72160738-72160760 AGAAAGCTTTCATGATTTGTTGG - Intergenic
1110213350 13:72998948-72998970 ATATTGTCTTCATGCTCTTTAGG - Exonic
1110267258 13:73552454-73552476 AGAATGTTGTCCTGAACTTGGGG + Intergenic
1110536793 13:76659820-76659842 AGAATGTTTGCATAATTCTTTGG + Intergenic
1110723624 13:78794213-78794235 AGAATTTTTTCATATGCTTTTGG + Intergenic
1111098654 13:83549255-83549277 AGCATTCTTTCATGATTTTTTGG - Intergenic
1111145866 13:84179081-84179103 AGAATGATATAATGAACTTTGGG + Intergenic
1111242401 13:85492594-85492616 AGAATGTTTTCTTTTTCTTGTGG - Intergenic
1111444341 13:88326248-88326270 AGAATGTTTACATGATTTACTGG + Intergenic
1111451025 13:88416335-88416357 AAAATAGCTTCATGATCTTTGGG - Intergenic
1111593624 13:90382488-90382510 AGAAGGTCTTCATGATCTTAAGG - Intergenic
1111798246 13:92950893-92950915 TGTATGTTTTGATGAACTTTGGG + Intergenic
1111839874 13:93436170-93436192 AGTAGGTTTCCATGATCATTGGG - Intronic
1112068923 13:95826214-95826236 AGAATATTTTTATCATCTTGAGG - Intronic
1112102057 13:96200022-96200044 AGAATGTCTTCAAGAACTATAGG + Intronic
1112536718 13:100265482-100265504 AGATAGTTTTCATTCTCTTTAGG + Intronic
1112546756 13:100378591-100378613 AGAAAGCTTTCATGATATATGGG - Intronic
1112982992 13:105409881-105409903 AGAATACTGTCATGATCTATAGG + Intergenic
1113222113 13:108116973-108116995 ACAATGTTGTCATGACCATTAGG + Intergenic
1113402768 13:110009770-110009792 GATATGTTTTCTTGATCTTTAGG - Intergenic
1113427738 13:110223412-110223434 AGAATGTTATCATCTTTTTTGGG - Intronic
1114009579 14:18352954-18352976 AGCATTTTTTCATGTTTTTTTGG - Intergenic
1114011439 14:18373406-18373428 AGCATTTTTTCATGGTCTGTTGG - Intergenic
1114358281 14:21939630-21939652 AGAATCTCTTCTTGATTTTTTGG + Intergenic
1114578351 14:23733622-23733644 AGAATATGTTCATGATCTCCTGG + Intergenic
1114589885 14:23853097-23853119 AGAATGATTTTATAATTTTTAGG - Intergenic
1114904617 14:27111131-27111153 AGAATGTTTTAATGTTGTTTTGG + Intergenic
1114927698 14:27424483-27424505 ATAATATTTTCTTCATCTTTGGG + Intergenic
1115211884 14:30975369-30975391 AGAATGATATAATGAACTTTGGG + Intronic
1115599896 14:34945507-34945529 ACAATGTTTTCAAGATCATTGGG + Intergenic
1115614516 14:35081357-35081379 AAAATGTTTTCTTCATTTTTAGG + Exonic
1115707217 14:36011610-36011632 AGAATGATTCGATGAACTTTGGG - Intergenic
1115893425 14:38058200-38058222 AGCATTTTTTCATGTTTTTTTGG - Intergenic
1116086670 14:40248425-40248447 AGCATTTTTACATGATGTTTAGG - Intergenic
1116889290 14:50251363-50251385 AGAATGTTTTCTAGATTTTGTGG - Intronic
1117394055 14:55291402-55291424 AGCATGTTTTCATTTTATTTAGG + Intronic
1118304422 14:64643458-64643480 AGAATATCTTCATGACCTTGAGG + Intergenic
1118565530 14:67136783-67136805 AGAATGTTTTCATGTAATATTGG + Intronic
1119375933 14:74192862-74192884 AGAATGTATTCCTGGTCTGTGGG - Intronic
1120049051 14:79843921-79843943 AGAATGATATAATGGTCTTTGGG - Intronic
1120267603 14:82271255-82271277 TGAATTTTATCATGATGTTTTGG + Intergenic
1121171581 14:91858978-91859000 AGGATGTTTTCATCTTCGTTTGG - Intronic
1121218813 14:92269646-92269668 AGAAGGATATCATGAACTTTGGG - Intergenic
1121853241 14:97243040-97243062 AGAATATCTTCATGAACTTTGGG + Intergenic
1121918959 14:97862529-97862551 AAAATATTTTCAGGATCTCTGGG + Intergenic
1122498111 14:102173645-102173667 AGAATGATATAATGAACTTTGGG - Intronic
1122658110 14:103275443-103275465 AGAAGATTTTCATGAACTCTGGG - Intergenic
1123802420 15:23835024-23835046 AAAATGTTTTCATGATGATACGG - Intergenic
1124059835 15:26280493-26280515 AGCATGTCTTCATGATCTTGGGG - Intergenic
1124145559 15:27122262-27122284 AAAATGTTTTAAAGATCTGTTGG + Intronic
1124660385 15:31545331-31545353 AGAATATTTTCAGGACCTTGGGG + Intronic
1125007214 15:34831006-34831028 AGAATATTTTCATGTCCTTGAGG - Intergenic
1126057410 15:44743688-44743710 AGAATTTTTTCATGTGATTTTGG - Intronic
1126459149 15:48896663-48896685 AGAATGTTTTGGGGAGCTTTGGG - Intronic
1127098134 15:55534377-55534399 AGTTTTTTTTCATTATCTTTTGG + Intergenic
1127460006 15:59190089-59190111 AGCAAGTTTTCAGGATCTGTCGG - Intronic
1127821695 15:62663303-62663325 AGAAGGTTTTCATGAATTTCTGG - Intronic
1129132958 15:73517100-73517122 AGAATGTCTTTATGATTTCTTGG + Intronic
1129179968 15:73867781-73867803 AGATTGATTTCATGCTGTTTTGG + Intergenic
1129223258 15:74147668-74147690 AGAATATTTTCATCATCTTAGGG - Intergenic
1129479237 15:75810053-75810075 AGAATGTTTTCAAGCTCTCCAGG - Intergenic
1129479633 15:75812914-75812936 AGAATATTTACATGATCTTGGGG + Intergenic
1129915899 15:79271192-79271214 GGAATTTTCTCATAATCTTTAGG + Intergenic
1130344750 15:83032698-83032720 AGAATGATATAATGAACTTTGGG + Intronic
1130785364 15:87090064-87090086 AGCATGGTTTCAGGATCTGTAGG - Intergenic
1131818340 15:96245988-96246010 CCAATGTTTTCAAGATCTCTGGG - Intergenic
1131842362 15:96450908-96450930 AGAATTATTTCATGAGCTGTTGG + Intergenic
1133852466 16:9518233-9518255 AGAATGCTCTCCTGATCTTGGGG - Intergenic
1136681566 16:31968380-31968402 AGGATTTTTTCATGTTTTTTTGG - Intergenic
1136781875 16:32909878-32909900 AGGATTTTTTCATGTTTTTTTGG - Intergenic
1136887919 16:33943970-33943992 AGGATTTTTTCATGTTTTTTTGG + Intergenic
1138341368 16:56291369-56291391 AGCATCTTTTCATGTGCTTTTGG + Intronic
1138463913 16:57172928-57172950 AGATTGTTTTCATATTATTTTGG + Intronic
1138755848 16:59484114-59484136 TAAATGTTTTAATGATATTTCGG - Intergenic
1139023971 16:62790543-62790565 AGCATTTTTTCATAATTTTTTGG + Intergenic
1139842797 16:69895033-69895055 GGGATGTTTTCTGGATCTTTCGG + Intronic
1140185658 16:72768405-72768427 GGAATATTTTCATGACCTTGGGG + Intergenic
1140613543 16:76632352-76632374 AGAATATTTTTGTGTTCTTTTGG + Intronic
1140643783 16:77007897-77007919 AAAATATTTTCATGACCTTGGGG - Intergenic
1140712891 16:77694815-77694837 AGAATGTATTTATGACATTTTGG - Intergenic
1203084530 16_KI270728v1_random:1173868-1173890 AGGATTTTTTCATGTTTTTTTGG - Intergenic
1143589356 17:7872273-7872295 TGAATATTTTCCTGATCTTGGGG - Intronic
1143915397 17:10288548-10288570 AGAATGATTTAATGAACTTTGGG - Intergenic
1144069248 17:11652849-11652871 CCCATGTTTTCATGATGTTTTGG - Exonic
1144119028 17:12131648-12131670 AGAATGTTTTCATTACGTTTGGG + Intronic
1144184014 17:12779074-12779096 AAAATTTCTTCATGATCTTGTGG - Intergenic
1144860983 17:18301853-18301875 AGAATGTTTCCTAGATCATTAGG + Intronic
1145819328 17:27819417-27819439 AGAATATCTTCATGACCTTTGGG + Intronic
1146732544 17:35206647-35206669 AGCATTTTTTCATTATCTGTTGG - Intergenic
1149545244 17:57498661-57498683 AGCATGTTTTGAGGATCGTTGGG + Intronic
1150032182 17:61750725-61750747 AGCATCTTTTCATGTCCTTTGGG - Intronic
1150927819 17:69552560-69552582 GGAATGTTTCCATGCTCTTGAGG + Intergenic
1151125495 17:71839906-71839928 AGAATTTTTTCATGACCTGTGGG - Intergenic
1151177339 17:72299653-72299675 AGAATGTTTTTTTGTTTTTTTGG + Intergenic
1153463597 18:5364315-5364337 AGAATCTTGTCATTCTCTTTTGG + Intergenic
1153960404 18:10135371-10135393 CCCAAGTTTTCATGATCTTTTGG - Intergenic
1155148930 18:23107006-23107028 AGAAGCATTTCCTGATCTTTTGG + Intergenic
1155486076 18:26344448-26344470 AGGATATTTTCATGATATATAGG - Intronic
1156066752 18:33151062-33151084 AGAATGATATAATGAACTTTGGG + Intronic
1156583230 18:38403621-38403643 AGAATGTTTTTTTTTTCTTTTGG + Intergenic
1156852094 18:41740441-41740463 TGAAAGTCTTCTTGATCTTTGGG - Intergenic
1156876054 18:42013351-42013373 AAAATGTTTACTTGATATTTAGG + Intronic
1157760716 18:50262916-50262938 AGAGTGTGTTCCTGACCTTTTGG + Intronic
1158358589 18:56647548-56647570 AGAATGTAATAATGATATTTCGG - Intronic
1158422594 18:57309116-57309138 AGAATGTTCTCTTCATGTTTGGG + Intergenic
1158622605 18:59046001-59046023 GGAGTGTTGTCATAATCTTTGGG + Intergenic
1159082334 18:63749490-63749512 AGAATTTTTTCATAAGCTTTTGG + Intergenic
1159119139 18:64149199-64149221 AAAATGTTTCCATAATCTCTTGG + Intergenic
1159152444 18:64537182-64537204 AGAATGATTTCATTTTCCTTTGG + Intergenic
1160993673 19:1872065-1872087 GGAAGCTTTTCATCATCTTTGGG - Intergenic
1161937742 19:7382575-7382597 TGAATGTTTGCAAGAGCTTTGGG - Intronic
1162003378 19:7762340-7762362 AGAATGTATTCATTCTGTTTGGG + Intergenic
1162289952 19:9771475-9771497 AGAATGATATAATGAACTTTGGG - Intronic
1165380771 19:35478068-35478090 CTAATTTTTTCATGATTTTTTGG + Intergenic
1168520744 19:57048679-57048701 AGAATGATATCATGGACTTTGGG + Intergenic
925509897 2:4613621-4613643 AGAATATTTTCATGACATTAGGG + Intergenic
926587481 2:14703885-14703907 AGAATTTTTTTATGATATCTAGG - Intergenic
928159698 2:28911123-28911145 AGAATGTTTTTATAATCCTGGGG - Intronic
928637064 2:33257736-33257758 AGAATGCTGTCCTGATGTTTGGG + Intronic
929017638 2:37514709-37514731 AGCATTTTTTCATGGTTTTTTGG + Intergenic
929773988 2:44916547-44916569 TGTATTTTTTCATGCTCTTTGGG + Intergenic
930210053 2:48626910-48626932 AGATTGTTTTTATGATTTTTTGG + Intronic
930350773 2:50251515-50251537 AGAATGATTTATTGTTCTTTGGG + Intronic
930636942 2:53816685-53816707 AGAATATTTTCATGATTTTGGGG - Intronic
930858288 2:56042469-56042491 AGAAGGTTCTCAGGCTCTTTAGG + Intergenic
930992230 2:57670461-57670483 AAAATATCTTCATGACCTTTGGG - Intergenic
931144215 2:59499363-59499385 AGAATGTTTTCATGATGAGTTGG + Intergenic
933179068 2:79209824-79209846 AGGATGTTTACAGGATTTTTAGG - Intronic
933267629 2:80199363-80199385 AGAGGGTTTTAAGGATCTTTAGG + Intronic
933604216 2:84364472-84364494 AGAATGTTATAATGAACTTTGGG + Intergenic
934107661 2:88710442-88710464 AGAAAGTTTCCAGGATCTTTTGG + Intronic
934489455 2:94750388-94750410 AGAATGATTTAATGGACTTTGGG + Intergenic
935115279 2:100130193-100130215 TGAATGTATTCATGAACTTCTGG - Intronic
935832643 2:107016750-107016772 AGAATTTTTCCAGGATGTTTCGG - Intergenic
936139493 2:109927103-109927125 ATATTGTTTTCATAATTTTTTGG + Intergenic
936205203 2:110444383-110444405 ATATTGTTTTCATAATTTTTTGG - Intronic
936289199 2:111206629-111206651 AGAATGTCTTCATGATGTTCAGG - Intergenic
936757010 2:115726488-115726510 AGAATGTTATCAAGGTCATTAGG + Intronic
936776235 2:115976763-115976785 AGAATGATTTTGTGTTCTTTAGG + Intergenic
936822273 2:116537479-116537501 AGCATATTTTCATGACTTTTTGG - Intergenic
937536294 2:122892317-122892339 GGGATTTTTTCAAGATCTTTAGG - Intergenic
937550271 2:123080010-123080032 AGTATTTTTTCATGTTTTTTTGG + Intergenic
937654253 2:124357066-124357088 AGCATTTTTTCATGTGCTTTTGG + Intronic
938154597 2:128922942-128922964 AGAAAGTATTCATGCTCTTCTGG + Intergenic
939231699 2:139434683-139434705 AGAATGTATTCCTCATCTTGTGG - Intergenic
941582430 2:167316175-167316197 AGAATGTTTTCTTTTTCCTTGGG + Intergenic
941621155 2:167781298-167781320 AGAATGTTTTTAAAATATTTTGG + Intergenic
942243736 2:173988232-173988254 AGAAGGTTTTCATGCAATTTGGG - Intergenic
942865315 2:180666553-180666575 AGAATTTTTTCATATTCTTGTGG - Intergenic
942970900 2:181956655-181956677 AGCATTTTTTCATGTTTTTTTGG + Intronic
943058767 2:183016206-183016228 ATCATGTATTCATGTTCTTTGGG + Intronic
943085257 2:183303234-183303256 AGAATATATTCATGACCTTGAGG + Intergenic
943170918 2:184398077-184398099 AACATCTTTTCATGTTCTTTTGG + Intergenic
943298061 2:186162889-186162911 AGAATGATTTCTCTATCTTTGGG - Intergenic
943572547 2:189590825-189590847 AGCATTTTTTCATGTACTTTTGG + Intergenic
944220502 2:197299649-197299671 AGAATGATATAATGAGCTTTGGG + Intronic
944604107 2:201334172-201334194 AGCATTTTTTCATGGTCTTTTGG + Intronic
944619432 2:201498823-201498845 AGAATGGTTTTTTGATGTTTGGG - Intronic
944979592 2:205101052-205101074 AATATGTTTTCCTGTTCTTTGGG - Intronic
945129133 2:206548075-206548097 ATTATGTTTTCTTGATGTTTGGG + Intronic
945337571 2:208610865-208610887 AGAATGATATAATGAACTTTGGG - Intronic
945914422 2:215687919-215687941 AGGATGTATTGGTGATCTTTTGG - Intergenic
945983243 2:216333071-216333093 AGAATGTTTTCATGATCTTTGGG + Intronic
1168875365 20:1168260-1168282 AGAAAGTTCTCATGACCTTCAGG + Exonic
1170008393 20:11693832-11693854 AGAAACTTATCATGATCTTTGGG + Intergenic
1170157275 20:13280134-13280156 ATAATTTTTTTAGGATCTTTGGG + Intronic
1170350438 20:15434989-15435011 AGAATGATATCATGGACTTTGGG + Intronic
1170499981 20:16965185-16965207 AGGATGCTTTCATTACCTTTTGG - Intergenic
1170998956 20:21395294-21395316 AAAATGTTTTGATGATTATTTGG - Intergenic
1171004579 20:21451910-21451932 AGAACATTTACATGATCTTTGGG + Intergenic
1171724044 20:28599121-28599143 AGAATATTTTCCTGATTTTGGGG + Intergenic
1172466599 20:35160142-35160164 AGAATATCTTCATGACCTTGGGG + Intergenic
1172830185 20:37827299-37827321 AATATGTTTTCATGATCTCTTGG + Intronic
1173295679 20:41754043-41754065 AGAATGATGTGATGAACTTTGGG - Intergenic
1173416386 20:42859901-42859923 TGGATATTTTCATGATGTTTAGG + Intronic
1173718620 20:45233432-45233454 AGAAGTGTTACATGATCTTTGGG - Intergenic
1174816669 20:53693042-53693064 AGAATGATATCATGGACTTTGGG + Intergenic
1177221436 21:18198294-18198316 AAAATATTTACATGATCTTTGGG - Intronic
1177621663 21:23602886-23602908 AGAAATTTTTTATGTTCTTTAGG - Intergenic
1178132192 21:29586233-29586255 TGAATGTTTTGATGTTCTCTAGG - Intronic
1178918811 21:36724722-36724744 TGAATGCATTCATCATCTTTAGG - Intronic
1179023666 21:37661000-37661022 AAAACACTTTCATGATCTTTTGG + Intronic
1179388328 21:40963381-40963403 AGAATGATATCATGGACTTTGGG + Intergenic
1180434080 22:15283763-15283785 AGCATTTTTTCATGTTTTTTTGG - Intergenic
1180435933 22:15304210-15304232 AGCATTTTTTCATGGTCTGTTGG - Intergenic
1180518176 22:16168378-16168400 AGCATTTTTTCATGGTCTGTTGG - Intergenic
1181643079 22:24215011-24215033 ACAAAGTTATCATGCTCTTTGGG + Intergenic
1181843269 22:25683935-25683957 AGAATATCTTCATGATCTTAGGG - Intronic
1182901049 22:33898439-33898461 AGAATCTTGTAATGATCTTGTGG - Intronic
1185140586 22:49098891-49098913 AGAATGCTTTTATGATGTTAGGG + Intergenic
949267221 3:2172369-2172391 AGAATGATTTAATGGACTTTGGG + Intronic
949453309 3:4211530-4211552 AGAATATCTTCATGACCTTGAGG + Intronic
949502697 3:4696935-4696957 AGAATATTTTCATGATCTCAAGG - Intronic
949924317 3:9028863-9028885 AGAATGCCTTCATGAGCTTGGGG + Intronic
951193751 3:19802064-19802086 ACAATATTTTCATTATCATTTGG - Intergenic
952126621 3:30308346-30308368 GGAATGTTTTAGTCATCTTTAGG + Intergenic
952451440 3:33437472-33437494 GGAATGGTTTCCTCATCTTTTGG - Intronic
952886342 3:38013683-38013705 AGAATGGCTTTATGATCTTAAGG + Intronic
953371041 3:42388821-42388843 AAAATGTTTTTATTATCTATTGG - Intergenic
953995904 3:47519600-47519622 AGAATATCTTTATGATATTTGGG - Intergenic
954055195 3:48017413-48017435 GGAATGTTTTCCTGATGTTCAGG - Intronic
954086164 3:48245612-48245634 AGAATGTTTTTCTGATCCTTGGG - Intronic
956226727 3:66968287-66968309 ATAATATTTTCATTATCTTAGGG + Intergenic
956296446 3:67719876-67719898 ATAATGTTTTTATGAACATTTGG + Intergenic
957706783 3:83797890-83797912 AGGATATTTTCATGAACTGTTGG - Intergenic
957718413 3:83964049-83964071 AGATTGCTTTCTTGATTTTTTGG + Intergenic
958066841 3:88554775-88554797 AGAATGATATAATGAACTTTGGG + Intergenic
958787823 3:98617467-98617489 AGGATGTCTTCATGATATTGGGG + Intergenic
958792959 3:98673180-98673202 AGAATATTATCACGATCTTGGGG - Intergenic
959045196 3:101465890-101465912 AAATTGTTTTCATAATTTTTTGG - Intronic
959048563 3:101502041-101502063 AGAATATATTCACGACCTTTGGG + Intronic
959255272 3:104002824-104002846 ACAATGTTTTATTCATCTTTTGG - Intergenic
959836063 3:110919481-110919503 AGAAGGTTTTCTTAGTCTTTAGG + Intergenic
960505331 3:118486876-118486898 AGAATGTATTCTTTATCTTGAGG - Intergenic
960916953 3:122704725-122704747 TGAATATTTTCATGATCACTCGG - Exonic
962232197 3:133675354-133675376 AGAATGCAATCATGATCATTCGG + Intergenic
962497665 3:135958462-135958484 AGTATGTTTTCTTCATCATTTGG + Intergenic
962569556 3:136699031-136699053 AGAATGATATAATGAACTTTGGG + Intronic
963223469 3:142836541-142836563 AAAATTTTTTCTTAATCTTTAGG + Intronic
963332581 3:143931676-143931698 AGCATATTTTCATGTTTTTTTGG + Intergenic
963495084 3:146048072-146048094 AGAATGTCTTCATAAACTTTGGG + Intergenic
963782044 3:149496150-149496172 AGAATGTTTTGTTGACCATTTGG + Intronic
963839079 3:150086661-150086683 AGCATTTTTTCATTGTCTTTTGG - Intergenic
964120324 3:153176665-153176687 AGCATTTTTTCCTTATCTTTAGG + Intergenic
964432264 3:156619803-156619825 AGAGTGTTTTGATAACCTTTTGG + Intergenic
964556202 3:157941704-157941726 AGAATGTCCTCATGACCTATAGG + Intergenic
964642340 3:158922731-158922753 AGAATATCTTCATGAACTTGGGG - Intergenic
965237462 3:166143822-166143844 AAATTGTTTTCTTGCTCTTTTGG + Intergenic
965381539 3:167995512-167995534 AGACTGTTCTAATGATCTTTAGG + Intergenic
965405448 3:168262630-168262652 AGAATTTTTTTCTTATCTTTTGG - Intergenic
965612775 3:170562458-170562480 AAAATGATTTCATGGACTTTGGG + Intronic
966140878 3:176753888-176753910 AGAATCTTTTAAAGAACTTTTGG - Intergenic
966332199 3:178826684-178826706 AAAATGGTTTCATTTTCTTTTGG - Intronic
967520027 3:190418455-190418477 AGAATATTATCATGATTTTTTGG - Intergenic
967556146 3:190861516-190861538 AAAATGTTTTAATTATCTCTGGG - Intronic
967603080 3:191412838-191412860 AGGCAGTTTTCCTGATCTTTGGG - Intergenic
967631801 3:191752242-191752264 AGAATAGTTTCAGGAACTTTAGG - Intergenic
968014402 3:195316130-195316152 AGTATGTTTTCATGATATAATGG - Intronic
968173733 3:196530523-196530545 AAAATATTTTCATGACCTTGGGG - Intergenic
968499780 4:943729-943751 AACATGTTTTCATGACTTTTGGG - Intronic
969567783 4:7989985-7990007 AGGACGTTTTAATGACCTTTAGG + Intronic
970817311 4:20172548-20172570 AGAATCTTCTGATGAGCTTTTGG - Intergenic
971360964 4:25938035-25938057 ACAATGTTTTTGTGATGTTTTGG + Intergenic
971407740 4:26338116-26338138 AGAATGTTTCCATAATGTTAGGG - Intronic
972523729 4:39886896-39886918 AGATTGCTTTCTTGATTTTTCGG + Intronic
972612211 4:40666480-40666502 AGAATGATATAATGAACTTTGGG - Intergenic
973922061 4:55697074-55697096 AGATCATTTTCATGATTTTTTGG - Intergenic
974850376 4:67397279-67397301 AGAATGTTTTCATATACATTTGG + Intergenic
975340573 4:73235170-73235192 GGAATGTATTCATGTGCTTTGGG + Intronic
975641743 4:76507502-76507524 AGCATCTTTTCATGCACTTTTGG + Intronic
975773332 4:77754938-77754960 AGAATATATTCATGATCTTGTGG + Intronic
976099240 4:81542835-81542857 AGAATGAATTCATGTCCTTTGGG - Intronic
976361914 4:84189659-84189681 TGAATATTTTCAGGCTCTTTTGG - Intergenic
976666230 4:87595622-87595644 AGAATGATATAATGAACTTTGGG - Intergenic
977072930 4:92415490-92415512 AGAATGATATAATGGTCTTTGGG - Intronic
977635147 4:99288991-99289013 AGAATGATATCATGAACTTTGGG - Intronic
977727862 4:100318552-100318574 AGAATGTTTTTATTATGCTTTGG + Intergenic
978785020 4:112600016-112600038 AGAATATCTTCATGATCTTGAGG + Intronic
979539574 4:121865982-121866004 AGTATTTTTTCATGTTTTTTTGG + Intronic
979613939 4:122720107-122720129 TCAATGTTTTCATTATCTTTAGG - Intergenic
979768840 4:124497014-124497036 AGAATGTTTTCTAAATATTTTGG - Intergenic
979925519 4:126558229-126558251 ATAATGCTTTCACAATCTTTTGG + Intergenic
979930699 4:126626632-126626654 AGAATGTGTTGATTTTCTTTTGG + Intergenic
980020821 4:127707808-127707830 TGAATGTTTTGATAATCATTTGG - Intronic
980890174 4:138806524-138806546 AGAGTGATTTCATTATTTTTTGG - Intergenic
981226771 4:142305553-142305575 AGAATGGTTTCATTAACTTGAGG + Intronic
981271372 4:142849991-142850013 AGTATGATTTTATGATCTCTCGG + Intergenic
981457771 4:144975318-144975340 AGAATATCTTCATGATGTTCAGG + Intronic
982212464 4:153050006-153050028 AGAATATTTTCATGACCATAGGG - Intergenic
982702904 4:158675824-158675846 AGTATGTTTTCATTATCTTAGGG + Intronic
983433435 4:167680851-167680873 AGGATGTCTTCATGATCTCATGG - Intergenic
983855951 4:172645272-172645294 ACAATATCTTCATGATCTTTTGG - Intronic
985128640 4:186720185-186720207 GTAATGTTTGCATTATCTTTCGG - Intronic
985159074 4:187025175-187025197 AGGATGTATTTATGATGTTTTGG - Intergenic
985871564 5:2561459-2561481 AAAATGTTTTCATGTTTCTTAGG + Intergenic
985901112 5:2794223-2794245 AGATTGTTTTCATTGTCTTCTGG + Intergenic
986652845 5:9981517-9981539 AGAATCTTTTCATGTGCTTTTGG - Intergenic
986779621 5:11052723-11052745 AGGTTGTGTTGATGATCTTTAGG + Intronic
986962581 5:13233397-13233419 AAAATATCTTCATGATCTTGAGG - Intergenic
987574844 5:19711823-19711845 ACAATGATTTCATTTTCTTTGGG - Intronic
987786732 5:22509950-22509972 AGAATCTCTTCAAGATATTTTGG - Intronic
988418239 5:30973475-30973497 AGAATGTTTCAATGACATTTGGG - Intergenic
989363792 5:40633596-40633618 AGAATGATATAATGAACTTTGGG + Intergenic
989623475 5:43407871-43407893 AGCATTTTTTCATGGTCTGTTGG - Intronic
990107357 5:52280784-52280806 AGCATTTTTTCATGTTCTTTTGG - Intergenic
990474347 5:56147142-56147164 AGAATCTTTACATGATCCTAAGG + Intronic
991020138 5:61971821-61971843 AGAAGGTTTTCTGGATGTTTGGG - Intergenic
992581094 5:78177106-78177128 AAAATATTTTCAATATCTTTGGG + Intronic
992825399 5:80544967-80544989 AGAATGTTTTCAGGACTTTGGGG + Intergenic
993143161 5:84059529-84059551 AAATTGTTTTCATGATTTCTGGG + Intronic
993264774 5:85710868-85710890 TGAATTTTTTAATGATTTTTGGG + Intergenic
993268341 5:85759536-85759558 AGAATATTTTTATGTTCTTTTGG + Intergenic
993468576 5:88278522-88278544 AAAATATTTTTATGATCTTATGG + Intergenic
993562245 5:89424560-89424582 AGAATGATATAATGAGCTTTGGG + Intergenic
993578351 5:89629483-89629505 AGAATTTTTTCATATGCTTTTGG + Intergenic
993763385 5:91824793-91824815 AGAATTTAAGCATGATCTTTTGG + Intergenic
993953666 5:94205688-94205710 AGAATGTTGTCTTTATATTTCGG + Intronic
993989890 5:94642955-94642977 AGACTTCTTTCATTATCTTTTGG + Intronic
994221966 5:97206676-97206698 AGCATTTTTTCATGTTTTTTGGG + Intergenic
994783545 5:104124893-104124915 AGAATGTCTTTATGATCTTTTGG + Intergenic
995292255 5:110470188-110470210 AGAAGGTTTTCTAGATGTTTGGG - Intronic
995848173 5:116516754-116516776 AGCATATTTTCAGGATGTTTGGG - Intronic
996048798 5:118908971-118908993 AGACTGTTTTTACCATCTTTGGG - Intronic
996356578 5:122601943-122601965 AGACTGTTTTCATGATAGTTAGG - Intergenic
996531088 5:124527796-124527818 AAAATAGTTTCATGATCCTTTGG + Intergenic
996602565 5:125282086-125282108 AGAATGTTTTCATTTCTTTTTGG + Intergenic
997052122 5:130395071-130395093 AGAATGTTTTTAAGTTATTTTGG - Intergenic
997279989 5:132636026-132636048 AGAATCATTTCGTGATCTTCTGG - Intronic
997551453 5:134757091-134757113 AGAACTTTTCCATCATCTTTAGG + Intergenic
998315194 5:141176557-141176579 AAAATGCTTTCATGGTCTTAGGG + Intergenic
998387813 5:141768103-141768125 AGAACGTTTTCCTGCTTTTTAGG + Intergenic
998533378 5:142906297-142906319 AGGATATTTACATGATCTTAAGG - Intronic
998600963 5:143584412-143584434 AGAATGATATAATGAACTTTGGG - Intergenic
998799145 5:145851205-145851227 AGAATGTTTTCAAGAACATCAGG + Intergenic
998811419 5:145970295-145970317 AGAATGATATAATGGTCTTTGGG - Intronic
998953026 5:147411187-147411209 AAAATGATTTCATTATCTTTGGG + Intronic
999613762 5:153399917-153399939 ATATTGTTTTAATGATCTCTGGG - Intergenic
1000681120 5:164186248-164186270 AATATGTTTTCATGACCTTAGGG + Intergenic
1001110843 5:168894933-168894955 AGGAAGTTCTGATGATCTTTGGG + Intronic
1001241341 5:170073081-170073103 AGAATATCTTCATGATCTTGGGG - Intronic
1001582814 5:172810788-172810810 AGAATATTTTTATGATCTCAGGG + Intergenic
1002588855 5:180273571-180273593 AGAATGTCTTCATGATCTTTGGG - Intronic
1002973367 6:2048199-2048221 AGAATATTTTCATAACCTTAAGG - Intronic
1003172149 6:3728292-3728314 AGAATGATATCATGGACTTTGGG - Intronic
1003291398 6:4781724-4781746 AGAATATTTTCATGGTATGTAGG + Intronic
1003379984 6:5615799-5615821 AGCTTGTTTTCATGCTCTTAAGG + Intronic
1003870330 6:10397891-10397913 AAAATGTTGTCATCATCTTTTGG + Exonic
1004611602 6:17246428-17246450 AGCATTTTTTCATGATTCTTTGG - Intergenic
1004801054 6:19148558-19148580 AGAATATTTTCATGAAACTTGGG - Intergenic
1004972907 6:20931801-20931823 AAAATATTTTCAGGTTCTTTCGG - Intronic
1005075917 6:21907383-21907405 AGACTGTTAAAATGATCTTTGGG - Intergenic
1005677525 6:28170601-28170623 AGATTATCTTCATGATCTTAAGG - Intergenic
1005822061 6:29606619-29606641 AGAATGTTTTCCTGAACCCTTGG + Intronic
1006431161 6:33997026-33997048 AGAATATTTTCATGAACTTGGGG + Intergenic
1006819062 6:36876249-36876271 AGAAAGTGATCATGATCTTGGGG - Intronic
1007146165 6:39634886-39634908 TGAATGTGGTTATGATCTTTTGG - Exonic
1007199638 6:40096078-40096100 GTAATGTTGTCATGGTCTTTAGG - Intergenic
1007873994 6:45074319-45074341 AGAAAGTCTTCTTGACCTTTGGG + Intronic
1007908275 6:45486479-45486501 ATTATGTTTTCATGATACTTAGG + Intronic
1008297033 6:49791216-49791238 AAAATGTTTCCATGAGTTTTTGG + Intergenic
1008338483 6:50335854-50335876 AGAATGGTATAATGAACTTTGGG + Intergenic
1008672199 6:53780882-53780904 AGAATTTTTACAAAATCTTTAGG + Intergenic
1009302912 6:62049947-62049969 AGAATGCTTTGTAGATCTTTGGG - Intronic
1009319492 6:62269466-62269488 AGCATGCTTTCATGTGCTTTTGG - Intronic
1009983023 6:70748095-70748117 GGACTGGTTTCAAGATCTTTTGG - Intronic
1010015067 6:71095432-71095454 AGAATGATTTAATGGACTTTGGG - Intergenic
1010139311 6:72595540-72595562 AGAATGTTTCATTGATATTTGGG - Intergenic
1010420392 6:75667634-75667656 AGAAAGTTACTATGATCTTTTGG + Intronic
1010443064 6:75920266-75920288 GAAATGTTTTCATGTACTTTTGG + Intergenic
1010736207 6:79446347-79446369 AGAAGGTTGTCAATATCTTTGGG + Intergenic
1010776486 6:79892365-79892387 AGAAAGTCTTTGTGATCTTTTGG + Intergenic
1010815221 6:80350765-80350787 AGAATGTTTTCTTGATCATTTGG + Intergenic
1010915316 6:81609934-81609956 AGAATGCATTCATAAACTTTGGG + Intronic
1010943087 6:81942449-81942471 AGTATGTTTTTATAAACTTTTGG + Intergenic
1011133807 6:84078059-84078081 AGAATATCTTCATGATGTTAGGG + Intronic
1011200067 6:84826364-84826386 AGAATATTTTCATATTGTTTAGG - Intergenic
1011409344 6:87050862-87050884 AGAATGTTTACCTGAATTTTGGG - Intergenic
1011483836 6:87821421-87821443 AGAATGTGTTCAGGAATTTTTGG - Intergenic
1011652763 6:89522197-89522219 AGAATGTCTACATGATATGTTGG + Intronic
1012665766 6:101967000-101967022 ACAAAATTTTCAAGATCTTTAGG - Intronic
1012890913 6:104896293-104896315 AGTATGTTTTCATTCTTTTTTGG + Intergenic
1013176033 6:107677735-107677757 AGAATGTGTTTATGGTTTTTTGG + Intergenic
1013190225 6:107796716-107796738 ACAATATCTTCATGATCTTGGGG - Intronic
1013766518 6:113580220-113580242 AGAATGTTTTCTTAATCTGATGG + Intergenic
1014250583 6:119111929-119111951 AAATTGTTTTCATGGTCTTCTGG + Intronic
1014445493 6:121522553-121522575 CAAATGTTTTCAGCATCTTTTGG - Intergenic
1014774077 6:125488503-125488525 AAAATTTTTCAATGATCTTTAGG - Intergenic
1014792267 6:125686776-125686798 AGAATGATATCATGGACTTTGGG - Intergenic
1015559125 6:134496091-134496113 AGTATGTTTTAAGGATCTCTCGG - Intergenic
1015584653 6:134763080-134763102 AGAATGTTTTCATTTCTTTTAGG - Intergenic
1015696210 6:135982746-135982768 AAAATGGCTTCATGATCTCTGGG - Intronic
1016173178 6:141045021-141045043 AGACTGATTTCATTACCTTTGGG + Intergenic
1016236102 6:141868906-141868928 AGCATTTTTTCATGGTTTTTTGG - Intergenic
1017960216 6:159215175-159215197 TCAATGTTTCCATGGTCTTTGGG + Intronic
1018587998 6:165384366-165384388 GGATTGTTTTCATGGTGTTTGGG - Intronic
1019582576 7:1773189-1773211 AGCATGTTTTCATTACCTGTTGG + Intergenic
1020395049 7:7705658-7705680 TGAATGTTTTTAGGATTTTTAGG + Intronic
1020778147 7:12482624-12482646 ATAATGTATTCATGATTGTTTGG - Intergenic
1021108179 7:16663575-16663597 ATAATTTTTTCATGTTCTTAAGG + Intronic
1021147329 7:17105414-17105436 TGAATGTTGTCATTGTCTTTTGG + Intergenic
1021183779 7:17539004-17539026 AGAATGATACCATGAACTTTGGG + Intergenic
1021208849 7:17818604-17818626 AAAATATTTTCATGAATTTTTGG - Intronic
1021244861 7:18249082-18249104 AGGATTTTTTTATGAGCTTTGGG - Intronic
1022033173 7:26510637-26510659 AGCATCTTTTCATGTGCTTTTGG - Intergenic
1022192309 7:28027993-28028015 ATAATGTCTTCATGATCATCTGG - Intronic
1022402950 7:30058356-30058378 AGAATATCTTCATGACCTTTGGG - Intronic
1023458791 7:40370522-40370544 AGATTCTTTTCATGATGCTTAGG + Intronic
1024017464 7:45330112-45330134 AGAATATCTTCATGACCTTCAGG - Intergenic
1024583088 7:50816440-50816462 AGCATTTTTTCATTATCTGTTGG - Intergenic
1026143799 7:67728220-67728242 AGAATGATATAATGAACTTTGGG - Intergenic
1026220104 7:68388747-68388769 ACAATGTTTTCATGAACAATAGG - Intergenic
1027713241 7:81635040-81635062 AGCACATTTTCATGAGCTTTTGG - Intergenic
1028131332 7:87177675-87177697 AGAATGTCTTCATGCCCTTGAGG - Intronic
1028179105 7:87696829-87696851 GAAATCTTTTCATTATCTTTTGG + Intronic
1028324988 7:89512503-89512525 AAATTGTTTTCATGGTCATTGGG - Intergenic
1028581706 7:92415853-92415875 AGAATGCTATCATGGACTTTGGG - Intergenic
1028817115 7:95158517-95158539 AGAATCTTTTTATAAACTTTGGG + Intronic
1029687604 7:102159511-102159533 AAAATGTTTTCCTGTTCTGTGGG - Intronic
1029884926 7:103858584-103858606 ATATTGTTTTAATGATGTTTAGG - Intronic
1030385342 7:108861533-108861555 AGAATTTTTAAATGATATTTTGG - Intergenic
1031680843 7:124672956-124672978 AAACTGTCTTCATCATCTTTAGG - Intergenic
1031788154 7:126061067-126061089 TGTATGTTTTCATGATTTTTAGG - Intergenic
1032978553 7:137253976-137253998 AGAATATTTTCTTCATTTTTAGG - Intronic
1033551294 7:142450767-142450789 ACAAGATTTTCATGACCTTTTGG - Intergenic
1033555765 7:142487615-142487637 ACAAGATTTTCATGACCTTTTGG - Intergenic
1033855422 7:145555580-145555602 AGAATATGTTCATGATCTTGAGG - Intergenic
1034610732 7:152365977-152365999 AGCATCTTTTCATGTTTTTTTGG - Intronic
1035190528 7:157163692-157163714 AGCTTGTTTGGATGATCTTTAGG + Intronic
1035334580 7:158119253-158119275 AGCATCTTTTCATGTGCTTTTGG - Intronic
1036119048 8:5995035-5995057 AGAATATCTTCATGAACTTGGGG + Intergenic
1037006258 8:13784615-13784637 AGAATGATTTCATTATCCTTGGG + Intergenic
1038232587 8:25716793-25716815 AGAATGGTTTCATGCTCTACAGG + Intergenic
1038300826 8:26345983-26346005 AGAATGTTTAAATAATCTGTGGG - Intronic
1038384654 8:27131322-27131344 TGAATATTTTCATAATCTTGGGG + Intergenic
1038655042 8:29442913-29442935 AGAATATCTTCATGACCTTGGGG + Intergenic
1038684595 8:29704751-29704773 AGAATGTTGTAATGGACTTTGGG - Intergenic
1040463859 8:47676384-47676406 AGATTGTGTTCTTGTTCTTTTGG + Intronic
1040624196 8:49126931-49126953 AGAAATTTTTCTTGATTTTTTGG + Intergenic
1041357850 8:57021031-57021053 AACATCTTTTCATGAGCTTTTGG - Intergenic
1042089137 8:65139717-65139739 AGAATGATATAATGGTCTTTGGG + Intergenic
1043104667 8:76092407-76092429 AGAATATTTTCATTATACTTAGG - Intergenic
1043127935 8:76423980-76424002 AGAATGTTTGTGTGTTCTTTTGG - Intergenic
1043202183 8:77384103-77384125 AGAATCATTTAATGAACTTTGGG + Intergenic
1043248599 8:78038271-78038293 AGAATGTTTTTATATTCCTTTGG + Intergenic
1043304509 8:78777896-78777918 AGAATGTGAACTTGATCTTTAGG - Intronic
1043503408 8:80878201-80878223 AAAATGTTTTAGTTATCTTTAGG - Intergenic
1043879684 8:85528249-85528271 AGGATATTTTCATGAGTTTTAGG - Intergenic
1043914781 8:85909191-85909213 TGAATGATTTCATAGTCTTTTGG + Intergenic
1044179535 8:89172454-89172476 TCAATGTATTCATCATCTTTAGG + Intergenic
1045014288 8:97986056-97986078 AGAATGTGTTCAGGTTTTTTTGG + Intronic
1045677105 8:104619382-104619404 AGAATGTTTGAAGGATGTTTTGG - Intronic
1045854966 8:106754369-106754391 AGAATATCTTCATGACCTTAGGG + Intergenic
1046428777 8:114093771-114093793 AAAATGTTTTCAATATCTATAGG + Intergenic
1046459544 8:114515441-114515463 ACAGTGTTTTGGTGATCTTTAGG - Intergenic
1047528387 8:125653617-125653639 ACAATTTGTTCATCATCTTTTGG - Intergenic
1048823563 8:138401356-138401378 AGAAAGTTTTAATGATTTTAAGG - Intronic
1049174484 8:141183145-141183167 AGAATATTTTCATGACTTTATGG + Intronic
1049699988 8:144006214-144006236 AGCAGGTTTTCAAGATCTATGGG + Intronic
1051376085 9:16404454-16404476 AGAATGTTGATATGATTTTTAGG + Intergenic
1051841070 9:21398959-21398981 AGAATGTTTTCAGGTTCTCCTGG - Intergenic
1052074317 9:24121866-24121888 AGCATTTTTTCATATTCTTTTGG - Intergenic
1052300961 9:26952052-26952074 AGAATGTTTTTCTCCTCTTTGGG - Intronic
1052323300 9:27191323-27191345 CAACTGTTTTCATGAACTTTTGG - Intronic
1052579440 9:30335591-30335613 AGAATAATTTCTTGTTCTTTGGG - Intergenic
1052754557 9:32527102-32527124 ACAATATTTTCATGACCTTGGGG - Intergenic
1052960734 9:34294314-34294336 AGCATGTTTTCATTTACTTTGGG - Intronic
1053262787 9:36684773-36684795 AGAATGATATAATGAACTTTGGG - Intergenic
1053303206 9:36966236-36966258 AGAAGGGTGTAATGATCTTTCGG - Intronic
1055271259 9:74562004-74562026 ACAATGTTTTTATGATATTCTGG - Intronic
1055682978 9:78737345-78737367 AGAATGTCTTCATGATCTAAAGG - Intergenic
1055820544 9:80256866-80256888 AGAATATTTTCATAACCTTGAGG - Intergenic
1055854634 9:80670691-80670713 AGAATATTTACTTGATATTTTGG + Intergenic
1056534125 9:87512967-87512989 AGAATTATTTCTTGTTCTTTGGG + Intronic
1058017924 9:100056906-100056928 AAAATGTTTCCATTACCTTTGGG - Intronic
1058040947 9:100301265-100301287 AGAATGTATCTATGGTCTTTTGG - Intergenic
1058069603 9:100588303-100588325 AAAATGTTTTTATGACATTTTGG + Intergenic
1058332036 9:103774350-103774372 AGAATTTATTCATTTTCTTTAGG + Intergenic
1058494436 9:105540491-105540513 AGAATATTTTCATGACCTTGGGG - Intronic
1058506956 9:105676012-105676034 AGAATGTTTCCATGATTCTCAGG - Intergenic
1059065378 9:111078241-111078263 AGTTTCTTTTCAAGATCTTTGGG + Intergenic
1059242718 9:112821273-112821295 AGCATCTTTTCATGTGCTTTTGG + Intronic
1060845721 9:126836095-126836117 AGACTATTTACATGATCATTAGG + Exonic
1203453144 Un_GL000219v1:139757-139779 AGAATAGTGTCATGATGTTTAGG - Intergenic
1185844138 X:3421296-3421318 AGAATGATTTCTTTCTCTTTGGG - Intergenic
1186371086 X:8947979-8948001 TGTATTTTTTCATGATCTTAGGG + Intergenic
1187351410 X:18521137-18521159 AGCATCTTTTCATGCGCTTTTGG + Intronic
1187371647 X:18713723-18713745 AGAATGTTGTCATTATCTCTGGG - Intronic
1187432200 X:19235328-19235350 AGAATGATATCATGGACTTTGGG - Intergenic
1187445912 X:19360913-19360935 AGAATGTTTTTATTTTCATTAGG - Exonic
1187785422 X:22879947-22879969 AGAATGTTATTATGGTTTTTAGG + Intergenic
1187924863 X:24240434-24240456 AGCATCTTTTCATGTGCTTTTGG - Intergenic
1187994072 X:24906494-24906516 AGAATGATATAATGAACTTTGGG + Intronic
1188235603 X:27727401-27727423 AGAATATCTTTATGAGCTTTGGG - Intronic
1188349635 X:29112354-29112376 AGAATATTTGTATGATCTTAGGG - Intronic
1188614931 X:32146194-32146216 AAAATGTTTTCATTAACTTATGG - Intronic
1188619110 X:32197447-32197469 TTTATGTTTTCATGAGCTTTGGG + Intronic
1188936184 X:36177838-36177860 AGAATGATTTGCTTATCTTTGGG - Intergenic
1188962100 X:36504933-36504955 AGATGGTTTTCATGATCCTGAGG + Intergenic
1189129235 X:38481005-38481027 AGAATGTTTTCTTTTTGTTTTGG + Intronic
1189528830 X:41857031-41857053 AGAACCTCTTCATTATCTTTAGG - Intronic
1190439170 X:50460162-50460184 AGAAAGTTTTCATGAACTCTGGG - Intronic
1191070898 X:56398882-56398904 AGCATTTTTTCATGTTTTTTTGG + Intergenic
1192413107 X:70952558-70952580 AGGATGTTTTCATGAGCTTATGG - Intergenic
1193011253 X:76677224-76677246 AGCATTTTTTCATGTTTTTTTGG - Intergenic
1193596966 X:83458761-83458783 AGAATGATATAATGAACTTTGGG + Intergenic
1193622326 X:83771205-83771227 AGAAAGTTTACAGGATCTATGGG - Intergenic
1193778076 X:85668682-85668704 AAAATATTTTCATGAACTTGAGG - Intergenic
1193810114 X:86041131-86041153 CCAGTGTTTTCATGATGTTTTGG - Intronic
1194075284 X:89384445-89384467 AGAATGATATTATGAACTTTTGG - Intergenic
1194482966 X:94449689-94449711 AGAATGATATCATGGACTTTGGG + Intergenic
1195498833 X:105570140-105570162 AGAATGTTATAATGAACTTTGGG - Intronic
1196029224 X:111077023-111077045 AGACTGTTTTCTTGATTTTTTGG - Intronic
1196056312 X:111359449-111359471 TGAATTTTTTTATCATCTTTGGG + Intronic
1196150984 X:112374098-112374120 AGAATATCTTCATGAAATTTAGG - Intergenic
1196513558 X:116543752-116543774 ATAATGTTTTCAGAATTTTTGGG - Intergenic
1196528621 X:116757364-116757386 AGAATGTTTTCTTAGTTTTTGGG + Intergenic
1197048734 X:122032165-122032187 AGAATGTTACAATGAACTTTGGG - Intergenic
1197290509 X:124650896-124650918 AGAAAGTTTTGATAATCTTACGG + Intronic
1197390432 X:125856651-125856673 AGTATATTTTCTGGATCTTTTGG + Intergenic
1197488104 X:127079938-127079960 AGAATGTATTTATGAACTTCTGG + Intergenic
1197519439 X:127478971-127478993 AGTATGTTTTTATAATCTTATGG - Intergenic
1197856773 X:130921366-130921388 AGAATATTTTCATTATATTCAGG - Intergenic
1198262835 X:134981434-134981456 AGAGTGTTTTAATGACATTTGGG + Intergenic
1198950732 X:142068412-142068434 AAAATGTTTTCAGGATATTAAGG - Intergenic
1199424749 X:147688128-147688150 AGAATGATATTATGAACTTTGGG + Intergenic
1199620370 X:149695627-149695649 AGCATCCTTTCATGTTCTTTTGG - Intronic
1199658806 X:150025525-150025547 AGCATTTTTTCATGGTCTTTTGG + Intergenic
1200730882 Y:6738605-6738627 AGAATGATATTATGAACTTTTGG - Intergenic
1200837049 Y:7742235-7742257 ATAATGTTTTATTGTTCTTTTGG + Intergenic
1201598389 Y:15698435-15698457 AGAATGTATTCATGTTTTATGGG + Intergenic
1201669665 Y:16504508-16504530 AGAATTTGTTCATGATCTCAGGG - Intergenic
1202065800 Y:20938561-20938583 AGCATTTTTTCATGTTTTTTTGG + Intergenic
1202248810 Y:22847995-22848017 AGCATTTTTTCATGGTTTTTTGG + Intergenic
1202273393 Y:23091983-23092005 AGAATGTTTTCATGTGTTTGTGG - Intergenic
1202292633 Y:23328699-23328721 AGAATGTTTTCATGTGTTTGTGG + Intergenic
1202401799 Y:24481743-24481765 AGCATTTTTTCATGGTTTTTTGG + Intergenic
1202426390 Y:24725727-24725749 AGAATGTTTTCATGTGTTTGTGG - Intergenic
1202444399 Y:24944359-24944381 AGAATGTTTTCATGTGTTTGTGG + Intergenic
1202468983 Y:25188340-25188362 AGCATTTTTTCATGGTTTTTTGG - Intergenic