ID: 945983244

View in Genome Browser
Species Human (GRCh38)
Location 2:216333076-216333098
Sequence GTTTTCATGATCTTTGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945983241_945983244 10 Left 945983241 2:216333043-216333065 CCATAACTCTTCTAGAAGAAAAC 0: 1
1: 1
2: 51
3: 387
4: 2843
Right 945983244 2:216333076-216333098 GTTTTCATGATCTTTGGGACAGG 0: 1
1: 0
2: 1
3: 13
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945983244 Original CRISPR GTTTTCATGATCTTTGGGAC AGG Intronic
900768949 1:4525440-4525462 GGTTCCATGCTCTTTGAGACAGG + Intergenic
900934550 1:5756858-5756880 GTTGTCATGATCTGTGCCACAGG - Intergenic
902579000 1:17396663-17396685 AATTGCCTGATCTTTGGGACAGG - Intronic
906089886 1:43169992-43170014 TTTTTCATGAACTTGGGGAGGGG - Intronic
906708791 1:47914192-47914214 GTATTTGTAATCTTTGGGACTGG - Intronic
911491043 1:98566443-98566465 GTTTTCATAAGCTTTGTTACAGG - Intergenic
914991061 1:152500016-152500038 TTTCTCATGCTCTTTGGGGCAGG + Intergenic
916305026 1:163320987-163321009 GTTTTATTGAGGTTTGGGACAGG - Intronic
917071560 1:171157010-171157032 TTTTTCATGATTTCTGTGACTGG - Intronic
918294878 1:183147070-183147092 GTTTTCATAATCTATGTGCCTGG - Intergenic
919239200 1:194889633-194889655 GTTTTCATGCACTTGTGGACTGG - Intergenic
919980042 1:202637344-202637366 GTTTTCAGGTTTTTTGAGACAGG - Intronic
921043301 1:211454588-211454610 GTTTTTATGTTCTTTGCGATGGG - Intergenic
921816895 1:219574489-219574511 GTTTTCATGATCCTTGGTGCAGG - Intergenic
924662143 1:246030728-246030750 GTATTTATGATCTATGTGACAGG - Intronic
1066278236 10:33889450-33889472 GTTCTCATGGTCTTAGGGAGAGG + Intergenic
1066806483 10:39260503-39260525 GTTTTCAACTTCTTTGGGATGGG - Intergenic
1068280187 10:54858015-54858037 GTTTTCAAGATCTATTGCACAGG - Intronic
1069232541 10:66029398-66029420 GTGTACCTGATCTTTGAGACTGG - Intronic
1070259935 10:74845203-74845225 CCTTTCTTTATCTTTGGGACAGG - Intronic
1072109583 10:92305922-92305944 GTTTTTATTATTTTTGAGACAGG - Intronic
1073710579 10:106033371-106033393 GTTTTCCTGAGCTTTGGAAGTGG - Intergenic
1074579647 10:114706881-114706903 GTTTTCATGTTCTTTAGGACTGG - Intergenic
1074600452 10:114908409-114908431 GTTTTTATTATCTTTCTGACTGG + Intergenic
1075296131 10:121276925-121276947 GGTTTCATGATCTTTGAAGCTGG - Intergenic
1076708468 10:132316611-132316633 ATTTTCCTGATCTTTTAGACAGG - Intronic
1077600596 11:3571967-3571989 GTCTTCATGTCCTTTGGAACTGG + Intergenic
1078018504 11:7635780-7635802 GCTATCATTATCTGTGGGACAGG + Intronic
1079875815 11:25855897-25855919 GTTTTTATGTTTTTTGAGACAGG - Intergenic
1081234604 11:40632256-40632278 TTTTGTATCATCTTTGGGACTGG + Intronic
1081256894 11:40907878-40907900 GTTTGCAAGATCTTTTTGACAGG - Intronic
1081599957 11:44486008-44486030 GTTTTCCCCATATTTGGGACAGG - Intergenic
1084014457 11:66370454-66370476 GTTTGCATTGTCTTTGGGACCGG - Intronic
1085999572 11:81965171-81965193 GTTTTCAACAGCTTTGGAACAGG + Intergenic
1087320617 11:96653339-96653361 GTTTTCTTGTTTTTTGGGACAGG - Intergenic
1087908033 11:103722242-103722264 GTTTTTATAATGTTTGGGAAAGG - Intergenic
1088592810 11:111417850-111417872 GTTTTCATGTTCTTGGGGCATGG + Intronic
1091192124 11:133704858-133704880 GTTTTCTTCATCTATGGAACAGG - Intergenic
1093179161 12:15948617-15948639 GTTTTTATCTTCTTTGCGACTGG + Intronic
1095557681 12:43526656-43526678 GTTATCAAAATCTTTGGGACAGG + Intronic
1097640238 12:62172310-62172332 GATTATATGATCCTTGGGACAGG - Intronic
1097679380 12:62634228-62634250 GTGTTCTTGTTCTTTGAGACAGG + Intergenic
1098028312 12:66229358-66229380 GTATTCATGTACTTTTGGACAGG - Intronic
1098576594 12:72049661-72049683 CTTTTCATGATACTTGGGAGGGG + Intronic
1099729340 12:86478391-86478413 GTATTCAGGATCTGTGGAACAGG + Intronic
1102767846 12:115449162-115449184 GTTTTCATCATCATTAGGACTGG - Intergenic
1103377177 12:120466338-120466360 TTTTTCCTGTTTTTTGGGACAGG - Intronic
1103857521 12:123983573-123983595 GAGTTCATCATCTTTGGGACAGG - Intronic
1106957368 13:34954964-34954986 GTTTTCTGGATATTTGAGACTGG + Intronic
1107310475 13:39072604-39072626 GCTTGCATGATCTTTGCTACAGG + Intergenic
1108734136 13:53264730-53264752 GTTTTCCAGAACTTTGGAACTGG - Intergenic
1108764722 13:53612828-53612850 GTTTTCATGGTCTATAGCACAGG + Intergenic
1110462519 13:75760681-75760703 GTTTCTGTGATCTTTGTGACTGG - Exonic
1112419481 13:99234723-99234745 GTTTTCAGGATCTATGAGAGAGG + Intronic
1117199803 14:53377729-53377751 CTGTTCCTGATCTTTGGGAAAGG - Intergenic
1126113774 15:45190454-45190476 GCTTTCATGATCTCTGGAAAGGG + Intronic
1130401935 15:83564981-83565003 GTTTTCAACATTTTTGGGAGAGG - Intronic
1130737856 15:86569386-86569408 GTTTTCTTTTTCTTTGAGACAGG - Intronic
1133024921 16:2984744-2984766 GTTTTGATTATTTTTGAGACAGG + Intergenic
1133371528 16:5249096-5249118 GTCTTCATGTCCTTTGGAACTGG - Intergenic
1134666985 16:16025884-16025906 GCTTTCATGCTATCTGGGACAGG + Intronic
1135257973 16:20956536-20956558 GAGTTCATGATTTTTGGGTCAGG + Intronic
1146594269 17:34155877-34155899 GTTTCCTTGTGCTTTGGGACAGG - Intronic
1146733922 17:35220632-35220654 GTTTTAATGGTCTTTGACACTGG - Intergenic
1147452931 17:40517244-40517266 CTGTTGATGGTCTTTGGGACAGG + Intergenic
1149462525 17:56841972-56841994 TTTTTCTTGTTTTTTGGGACAGG + Intronic
1153739281 18:8106098-8106120 GTTTTCATGCTCTGCAGGACAGG + Intronic
1156133325 18:34005297-34005319 CTTTTCGTGTACTTTGGGACTGG + Intronic
1156342568 18:36223375-36223397 GGTTACATGATCTTTGGAAAGGG - Intronic
1159403855 18:67974581-67974603 GTTTTGATGATCTTTTGTATGGG + Intergenic
1160001645 18:75030099-75030121 GGTCACATGATCTTTGGGGCTGG + Intronic
1161936997 19:7378340-7378362 GTTGTCAGGAGCTCTGGGACAGG - Intronic
1165317147 19:35063356-35063378 TTTTTCATGATCTGTGGTACTGG + Intronic
1166227620 19:41406401-41406423 GTTTTATTGTTCTTTGAGACAGG + Intronic
1167555812 19:50194721-50194743 GAATTCATCATCTTTGGAACTGG - Intronic
925492614 2:4411629-4411651 GTTTTTCTGCTCTTTGGGATGGG - Intergenic
925693877 2:6553498-6553520 GTTTGCATGATTTTGGGGGCTGG - Intergenic
926939945 2:18124938-18124960 GTTAACATGTTCTTTGAGACTGG - Intronic
928521741 2:32095731-32095753 CTTTTCATTTTCTTTGAGACAGG - Intronic
930210054 2:48626915-48626937 GTTTTTATGATTTTTTGGATAGG + Intronic
930352607 2:50276796-50276818 GTTTTAATGATCTTTAAGAGGGG + Intronic
932823050 2:74917494-74917516 GTTTTCATGTTTTTAGAGACAGG - Intergenic
937940419 2:127280972-127280994 CTTTTCATTTTCTTTTGGACAGG - Intronic
942129270 2:172862293-172862315 GTTCTGATATTCTTTGGGACCGG + Intronic
943224974 2:185161033-185161055 GTTTTTATGTCCTTTGTGACTGG - Intergenic
945983244 2:216333076-216333098 GTTTTCATGATCTTTGGGACAGG + Intronic
946319064 2:218938519-218938541 GTTTTCATTTTTTTTGAGACAGG + Intergenic
948234997 2:236380778-236380800 GTTTTCATGAACGTAGGGACTGG + Intronic
948702541 2:239769356-239769378 GTTTTCATGAACTTGGGGCTTGG + Intronic
1174363279 20:50041426-50041448 GTTTTCATTTTCTTTAGCACTGG + Intergenic
1174759023 20:53188121-53188143 GTTTTCATGAATTTTGAGAAGGG - Intronic
1175488225 20:59360763-59360785 GTTTTCCTAATCTGTGGCACAGG + Intergenic
1175802563 20:61809441-61809463 GTTTTCAGGATACTTGGAACTGG - Intronic
1177053152 21:16264425-16264447 GTATTCATATTCTTTGTGACTGG - Intergenic
1177675631 21:24295010-24295032 GTATTCAAGATCTTGGGGGCTGG + Intergenic
1182021351 22:27084131-27084153 GTTTTCTTTCTCTTTGAGACAGG - Intergenic
1182829654 22:33294639-33294661 GTCTGCATCTTCTTTGGGACTGG + Intronic
1182963064 22:34494581-34494603 GTTATCATGATCATTGTAACAGG + Intergenic
1184827163 22:46960188-46960210 TTTTTCACGGTCTTTGGTACTGG + Intronic
1185304436 22:50105825-50105847 GTTGTCATGAGCTTTGTCACAGG + Intronic
949342639 3:3045852-3045874 GTTTTCAACTTCTTTGGGATGGG - Intronic
951222157 3:20079867-20079889 GTTTTCAGGAGCTGTGGGTCGGG + Intronic
951847119 3:27096648-27096670 GCTTACATGATCTATGGCACTGG - Intergenic
955146309 3:56323557-56323579 GTTTTCATGATTCTTAGGGCTGG - Intronic
956667713 3:71657714-71657736 GTTTTCAAGATCTTTATGCCTGG - Intergenic
958553020 3:95641028-95641050 ACTTTGAAGATCTTTGGGACAGG + Intergenic
959441049 3:106376066-106376088 GTTTACAGCATCTTTGGGTCAGG + Intergenic
960596174 3:119410116-119410138 CTGATCATGATATTTGGGACTGG - Intronic
961068575 3:123898691-123898713 GTTTTCTTTTTCTTTGAGACAGG + Intronic
961584228 3:127909142-127909164 ATTTTCAAGATCTTTAGGAAAGG + Intergenic
961708224 3:128806520-128806542 GTTTTCAGGATCTCGGGGACTGG - Exonic
961984720 3:131120895-131120917 GTTTTCATCTTCTTTGAGATGGG + Intronic
969738908 4:9010015-9010037 GTCTTCATGTCCTTTGGAACTGG - Intergenic
970023994 4:11601581-11601603 ATTTTCTTGATCTTTGGAAATGG - Intergenic
970859747 4:20688148-20688170 CTTTTCATGATCCATGGGTCAGG - Intergenic
972480108 4:39488716-39488738 CTTTTCCTGAGCTTTGTGACTGG - Intergenic
974685663 4:65224695-65224717 TTTTTAATGATCTGTGGGGCTGG - Intergenic
975142454 4:70932463-70932485 GTTTTATTGATCTTTGTGCCAGG + Intronic
976772314 4:88666117-88666139 GCTTTCATGACATTTGGGAAGGG + Intronic
979323478 4:119351466-119351488 GTTTTAGTGAACTGTGGGACTGG + Intergenic
980820574 4:138010800-138010822 GTTGTCATGATCTTTGTTCCTGG + Intergenic
982232547 4:153222524-153222546 GTTTTCATGCTCTTTGTGCGGGG + Intronic
983241309 4:165236144-165236166 GTTTTAGTGAACTGTGGGACTGG + Intronic
985128638 4:186720180-186720202 GTTTGCATTATCTTTCGGAAGGG - Intronic
987918167 5:24243074-24243096 GCTCTCATGATTTTGGGGACTGG + Intergenic
988986076 5:36620412-36620434 GCTCTCATGGTCTGTGGGACTGG - Intronic
989554581 5:42778431-42778453 GTTTTCATGATCCTTATCACTGG - Intronic
990999765 5:61771020-61771042 TTCTTCATGCTCTTTAGGACTGG + Intergenic
992660195 5:78952276-78952298 TTTTTCATGATATTTGAGAATGG - Intronic
997654588 5:135545613-135545635 GTTTTCAGGGTCTTGGGGACTGG + Intergenic
998895434 5:146794090-146794112 GTTTTATTGGTCTTTGGGAATGG - Intronic
998951675 5:147398814-147398836 GTTTTCATGATTGCTGAGACAGG - Intronic
1000023593 5:157339698-157339720 GTTTGCATGACTTTTTGGACTGG - Intronic
1002588853 5:180273566-180273588 GTCTTCATGATCTTTGGGGTAGG - Intronic
1003257206 6:4484804-4484826 TTTTTCATGAACTTTGGGGAAGG + Intergenic
1003722560 6:8720313-8720335 GTTGTAATGAGCTCTGGGACAGG + Intergenic
1005221058 6:23589364-23589386 TTTTTGATGATTATTGGGACAGG - Intergenic
1005271893 6:24174766-24174788 GTTTTCATTTTCTTCTGGACTGG + Exonic
1007792944 6:44323552-44323574 TTTTTAATGATCTTTTGGCCAGG - Intronic
1009938579 6:70262088-70262110 GTTTTGAGAATCTTTGGGAATGG + Intronic
1010062482 6:71639647-71639669 ATTTTAATTATCTTTAGGACAGG + Intergenic
1012150061 6:95738148-95738170 GTTTTCATGGGCCTTGGGATAGG + Intergenic
1015171258 6:130256654-130256676 GTTTCCATGAGCATTGGGAGAGG - Intronic
1015437966 6:133212106-133212128 GTTTTCATCATATTTGTGAAGGG + Intergenic
1015620462 6:135126714-135126736 GTTTTCTCCTTCTTTGGGACAGG - Intergenic
1019839763 7:3429450-3429472 CTTTTCATAATGTTTGGGTCTGG - Intronic
1022402949 7:30058351-30058373 ATCTTCATGACCTTTGGGATAGG - Intronic
1022480865 7:30742207-30742229 TTGTTCATGATCTTTGGTATGGG + Intronic
1022513739 7:30962186-30962208 GTCTTATTGATCTTTGAGACTGG + Intronic
1022802558 7:33790143-33790165 GTTCTCATGGTCATTGAGACTGG + Intergenic
1027365818 7:77456812-77456834 GCTTTCATTAGATTTGGGACGGG - Intergenic
1027999588 7:85475691-85475713 CTTTACATGATCTTTGTGACCGG + Intergenic
1032031277 7:128485804-128485826 GTTTTATTGATTTTTGAGACAGG - Intronic
1034315845 7:150132191-150132213 GTTTTCAGGAGCTAGGGGACAGG + Intergenic
1034601402 7:152260364-152260386 GTTTTCATTATCTTGAGAACTGG - Intronic
1034791047 7:153968610-153968632 GTTTTCAGGAGCTAGGGGACAGG - Intronic
1038147135 8:24908091-24908113 TTTTTCATGCTCATTGAGACTGG + Intergenic
1040969919 8:53124821-53124843 ATTTTCATGAACTTGGAGACAGG - Intergenic
1041783272 8:61602524-61602546 TTTTTCTTGATCTTGGGGGCAGG - Intronic
1041928105 8:63258226-63258248 GTTTTTATCATTTTTGGGAAAGG + Intergenic
1042697572 8:71572472-71572494 TTTTTCATAATCTTTGAGGCTGG - Intronic
1046378871 8:113426673-113426695 ATTTTCATGATCTTAGGGAGAGG - Intronic
1047070802 8:121341228-121341250 GTTTCCAGGAGCTTTGGGAGAGG - Intergenic
1050861513 9:10438795-10438817 ATTTTCATCATCTGTGGGAAGGG + Intronic
1051289221 9:15528404-15528426 ATCTTCTTGGTCTTTGGGACAGG + Intergenic
1058616784 9:106837938-106837960 GTTTTAATGATCTTTGTGTATGG - Intergenic
1062188821 9:135235909-135235931 ATTTTCATATTCTTTGGGAGAGG + Intergenic
1191782731 X:64885980-64886002 GGTATCTTGGTCTTTGGGACAGG - Intergenic
1195165772 X:102218761-102218783 TTTTCCAAGATGTTTGGGACGGG - Intronic
1195193086 X:102468330-102468352 TTTTCCAAGATGTTTGGGACGGG + Intronic
1196287098 X:113895762-113895784 GTTTTTGTGATGTTTGGGATTGG + Intergenic
1200170042 X:154065954-154065976 CTTTTCATTTTCTTTGAGACAGG + Intronic