ID: 945983585

View in Genome Browser
Species Human (GRCh38)
Location 2:216336833-216336855
Sequence TTTATTTGAAGCAGAATTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 1, 2: 1, 3: 43, 4: 397}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945983585_945983586 -2 Left 945983585 2:216336833-216336855 CCAACAATTCTGCTTCAAATAAA 0: 1
1: 1
2: 1
3: 43
4: 397
Right 945983586 2:216336854-216336876 AATTATTTTTAAAACAGTCCAGG 0: 1
1: 1
2: 5
3: 72
4: 742
945983585_945983587 6 Left 945983585 2:216336833-216336855 CCAACAATTCTGCTTCAAATAAA 0: 1
1: 1
2: 1
3: 43
4: 397
Right 945983587 2:216336862-216336884 TTAAAACAGTCCAGGCACAGTGG 0: 1
1: 7
2: 107
3: 783
4: 3913

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945983585 Original CRISPR TTTATTTGAAGCAGAATTGT TGG (reversed) Intronic
904057997 1:27685145-27685167 TTTATTTACAGCAGCATTTTAGG + Intergenic
904631598 1:31847004-31847026 TTTGGTTGAAGTGGAATTGTTGG - Intergenic
905496846 1:38396542-38396564 TTTACTTGATACAGAATTTTAGG - Intergenic
906376694 1:45302371-45302393 TTTCTTGGAAGTAGAATTGTTGG - Intronic
909239926 1:73199477-73199499 TTTATTTGCAGCAGTATTACAGG - Intergenic
909592682 1:77369438-77369460 TTTATTTGAAGAAGAAAATTAGG - Intronic
909676108 1:78240897-78240919 TTTATTTAAAGCAGAGTGGGTGG + Intergenic
909766502 1:79362513-79362535 ATAATTTGTGGCAGAATTGTTGG - Intergenic
910474323 1:87590603-87590625 TTGAGTTGAAACAGACTTGTGGG + Intergenic
910572749 1:88723773-88723795 TCTATTTTAAGCAGTATTGGTGG + Intronic
910814631 1:91278524-91278546 TTTAAGTGAACCAGAAATGTTGG + Intronic
910820171 1:91337367-91337389 ACTATATGAAGCAGAATTATAGG + Intronic
911295956 1:96115143-96115165 TTTATTTGGCTAAGAATTGTTGG + Intergenic
911527299 1:99003526-99003548 TTTATTCTTAGGAGAATTGTTGG - Intronic
912181373 1:107222815-107222837 TTTTTTTGGAGCAGAAGTGGTGG + Intronic
913178768 1:116299028-116299050 TTGATCTGAAGCAGAGTTTTGGG - Intergenic
913536009 1:119773278-119773300 TTTATTGAAAGGAGAATAGTGGG - Intergenic
916568806 1:166007599-166007621 TTTATTTGAAGCTGACTTCTTGG + Intergenic
918770360 1:188549711-188549733 TTTATTTGAAAAAGAGTTGTTGG + Intergenic
918891872 1:190283587-190283609 TTTACTTAAATCTGAATTGTAGG + Intronic
919238660 1:194881340-194881362 TTAATTTGAAGCAGTATCTTTGG - Intergenic
919296832 1:195712140-195712162 TTTATTCATAGCTGAATTGTTGG - Intergenic
919545188 1:198907712-198907734 TTTATTTGTAGCATAACTATAGG + Intergenic
921467191 1:215502858-215502880 TTTTTTCCAAGCAGAATTATTGG - Intergenic
921739445 1:218667166-218667188 GTTCTTAGAAGCAGAATTGTGGG - Intergenic
922031589 1:221805865-221805887 ATTATTAGAAGTAGAATTGCTGG - Intergenic
922372565 1:224926001-224926023 CTTGTTTGAAGCAGAATCGGGGG - Intronic
922513550 1:226189165-226189187 TTTATTAGAAGCTGTATTGTAGG + Intergenic
923076496 1:230613647-230613669 TATTTTTAAAGCAGAATTTTGGG + Intergenic
923167046 1:231375579-231375601 TTTATAAGCAGCAGAATTTTTGG + Intronic
924003916 1:239585871-239585893 TTTAGTTGAAGCAAAATGCTTGG - Intronic
1063284895 10:4676157-4676179 TTTGTTGGATGTAGAATTGTGGG - Intergenic
1063668386 10:8080176-8080198 TTTAAAAGAAGCAGAATGGTCGG + Intergenic
1065643204 10:27805894-27805916 TATATTTGAAGGAGAATAGTGGG + Intergenic
1065880976 10:30037446-30037468 TCAATTTGAACAAGAATTGTAGG + Intronic
1067896763 10:50190205-50190227 TTTGTTTGAAGCTGAATTCTTGG - Intronic
1067952208 10:50751828-50751850 TTTGTTTGAAGCTGAATTCTTGG + Intronic
1068153319 10:53162729-53162751 TTTATTGGAAGCAAAGATGTAGG - Intergenic
1068466013 10:57392740-57392762 TGTATTTGTAGCAGAGTTCTGGG + Intergenic
1068617412 10:59134811-59134833 GTTATTTGCATCAGAACTGTGGG - Intergenic
1068617996 10:59141848-59141870 TTTACTTGATGTAGAATTCTCGG - Intergenic
1070150530 10:73802272-73802294 TTTATTTGTCCCAGAACTGTGGG + Exonic
1070199013 10:74185530-74185552 TTTTTTTGAAGCAGAGTCGTCGG + Intronic
1070948806 10:80414345-80414367 TTTCTCTGAAACAGAATAGTAGG - Intronic
1072558303 10:96543146-96543168 TTTACTAGAAACAGAATTTTAGG - Intronic
1073940325 10:108690625-108690647 TTTTTTAAATGCAGAATTGTGGG + Intergenic
1077458507 11:2695656-2695678 TTTATTTGAGGAAGAAGTGTTGG + Intronic
1077832701 11:5892154-5892176 CTTATTTGAAGTAGAATTTTTGG - Intronic
1079996731 11:27303517-27303539 TTTCTTAGAAACAGAAGTGTGGG - Intergenic
1082264930 11:50108073-50108095 TTTATGTTAACCAGAATTCTAGG - Intergenic
1083256757 11:61501119-61501141 TTACTTTGAAGGAGAAATGTGGG + Intergenic
1086088063 11:82976546-82976568 TTGATTTAAAGCAGAATTTTTGG - Exonic
1086100590 11:83095204-83095226 TTTACTTGAGGCAAAATGGTGGG + Intergenic
1087415796 11:97853914-97853936 TTTCTTTAAAGGAGAATAGTTGG + Intergenic
1087476791 11:98646179-98646201 GTATTTTGAAGCAGAAATGTTGG + Intergenic
1088082036 11:105929795-105929817 TCTATTAGAAGCAGAAATGGTGG + Intronic
1088137287 11:106572556-106572578 TTCATTTGATATAGAATTGTAGG + Intergenic
1088423338 11:109672962-109672984 TATATTTGAAGCAAGATTTTAGG - Intergenic
1090673203 11:128965223-128965245 CTTATTTGAAGCTGAGTTGTGGG - Exonic
1093065928 12:14657821-14657843 TATAGATGAAGCAGAATTCTTGG + Intronic
1093214176 12:16343835-16343857 GTATTTAGAAGCAGAATTGTTGG + Intergenic
1093300735 12:17451612-17451634 TTTATTTTAAGCAAAATATTTGG + Intergenic
1094196238 12:27752827-27752849 ATTATTTGCAGCAGAGTTGTGGG + Intronic
1094235310 12:28158288-28158310 TTTATTTAAATCAGCATGGTTGG - Intronic
1094579449 12:31720933-31720955 TCAAATTGTAGCAGAATTGTAGG + Intronic
1095475077 12:42578644-42578666 TTTATTTGGAGCATTTTTGTGGG - Intronic
1095828670 12:46558867-46558889 TTTATTGGAAGTATAATGGTAGG + Intergenic
1095988867 12:48019949-48019971 TTTCCTAGAAGCAGAATTGCTGG + Exonic
1097239106 12:57562514-57562536 TTTAATTAAAGAAGAACTGTGGG - Intronic
1097699327 12:62803841-62803863 TTTGTTTGCAATAGAATTGTAGG - Intronic
1098380443 12:69863817-69863839 TTCATTTAGAGCAGATTTGTTGG + Intronic
1099359259 12:81678796-81678818 TCTATTTTAAGCTGAATTGCAGG - Intronic
1099617798 12:84960523-84960545 TTTACTTGACGTAGAATTATTGG + Intergenic
1099794014 12:87373349-87373371 TATATTTCAAGAAGAAATGTTGG + Intergenic
1100559783 12:95736631-95736653 TTTATTTGAAACAATACTGTAGG + Intronic
1101208754 12:102514728-102514750 TTTATTTGTAGCACAATGGAAGG + Intergenic
1102649919 12:114433337-114433359 TTTATTTTGAGTAGAATTGCTGG - Intergenic
1102844104 12:116160120-116160142 TTGAATTGTAGCAGAATTATAGG - Intronic
1103234924 12:119363821-119363843 TTTATTGGAGACAGAATTGTAGG + Intronic
1104708254 12:130965175-130965197 TTTTTTTGTAGCATTATTGTTGG + Intronic
1105393290 13:20003093-20003115 TTTCTTTGGAGCAGGCTTGTGGG - Exonic
1106566468 13:30888873-30888895 TTTAGTTGAAGCAGAGGTGGAGG + Intergenic
1106604480 13:31214964-31214986 TTTATTATAAGCAAAACTGTTGG + Intronic
1107156878 13:37178024-37178046 TTTATTTTAATCAGGAATGTAGG - Intergenic
1107325918 13:39242260-39242282 GTTCTTTGTAGCAGAATTGGAGG - Intergenic
1108068973 13:46607933-46607955 TTTGTATGAAGCAGAACTGAGGG + Intronic
1108120968 13:47186483-47186505 TCTCTATGAAGCAGAATTATGGG + Intergenic
1108834143 13:54519695-54519717 TTTCTTTGAGGCAGAAGTCTGGG - Intergenic
1109084939 13:57958499-57958521 TTTATTACATGCAGAATTGGGGG - Intergenic
1109633447 13:65083408-65083430 TATCTGTGAAGCAGAATTGCTGG - Intergenic
1109651158 13:65328610-65328632 TTTATTAGAAGCATAATTTGGGG + Intergenic
1109894549 13:68667519-68667541 TTTATTAGAGACAGAGTTGTTGG + Intergenic
1110918325 13:81051385-81051407 TTTATTTTATACAGTATTGTAGG - Intergenic
1111008749 13:82284221-82284243 TTTATTATAAACAGAAATGTCGG - Intergenic
1111516029 13:89332727-89332749 TCTATTTTAATCAGAATTCTTGG - Intergenic
1112686825 13:101838489-101838511 TATATTTGAAAGAGAATTGCTGG + Intronic
1113211772 13:107991326-107991348 TTTCTTTAAAGAAAAATTGTTGG + Intergenic
1114033457 14:18596953-18596975 TTTATTTTAAGATGAAATGTAGG - Intergenic
1114078249 14:19176153-19176175 TTTATTTTAAGATGAAATGTAGG - Intergenic
1114125243 14:19718398-19718420 TTTATTTTAAGATGAAATGTAGG + Intergenic
1116402405 14:44524169-44524191 TTTCTTGAAAGTAGAATTGTTGG - Intergenic
1117421742 14:55553414-55553436 ATTATTAGAAGTTGAATTGTTGG - Intergenic
1117523031 14:56570015-56570037 CATATGTGAATCAGAATTGTGGG - Intronic
1118072032 14:62255956-62255978 TTTTTTTGAGACAGAATTGTTGG + Intergenic
1119462870 14:74824586-74824608 TTTATATTAATCAGAAATGTTGG + Intronic
1120223222 14:81759151-81759173 GCTTTTTGAAGCAGAATTTTAGG - Intergenic
1120333023 14:83117750-83117772 TTTAAATGAATCAGATTTGTGGG + Intergenic
1121480660 14:94268973-94268995 TTTAGTTGAGGGAGAACTGTAGG + Intronic
1121486377 14:94319432-94319454 TATACTCGAAGCAAAATTGTTGG - Intronic
1124156714 15:27232623-27232645 ATGATTAAAAGCAGAATTGTAGG - Intronic
1124801432 15:32836805-32836827 TGTATTTGAAGCAGAAAACTGGG - Intronic
1125239273 15:37554745-37554767 TGTGTTTGATGCAGAATTTTAGG - Intergenic
1125893715 15:43284983-43285005 TTCATTTCAGGCAGAATTATTGG + Intronic
1125914112 15:43469799-43469821 TTTTTTTAAAGCAGCATTATTGG - Intronic
1126495340 15:49283944-49283966 TATATGTGAAGCAGAATTATAGG + Intronic
1127662946 15:61117212-61117234 TTTGTTTTAATCAGATTTGTTGG - Intronic
1128197508 15:65773213-65773235 TTTATTGGAAGCATATTGGTTGG - Intronic
1129495833 15:75978974-75978996 TTTTTTTCCTGCAGAATTGTTGG + Intronic
1129534438 15:76300580-76300602 TTGGTAGGAAGCAGAATTGTAGG - Intronic
1129637077 15:77331553-77331575 ATTATTTTAAGTACAATTGTTGG + Intronic
1129776864 15:78242522-78242544 TTTATTGGAAGTGGAATTCTAGG - Intronic
1130559766 15:84948755-84948777 TTGATTTCAAGCAGAATCGGGGG - Intergenic
1130796682 15:87217177-87217199 TTCATTTTAATGAGAATTGTTGG - Intergenic
1131975178 15:97937664-97937686 TTTATTTTAACCACAACTGTTGG + Intergenic
1133868055 16:9662040-9662062 TGTCTTTGCATCAGAATTGTTGG + Intergenic
1137038135 16:35584749-35584771 TTTTTTTGCAGCAGCATTGATGG + Intergenic
1137741867 16:50784780-50784802 ATTACTTGTAGCAGAAGTGTTGG - Intronic
1138073995 16:54022472-54022494 TTTATTTGAAACAGCAGTGAGGG + Intronic
1138127464 16:54450769-54450791 ATTCTTAGAAGCAGAATTGCTGG + Intergenic
1138848637 16:60598761-60598783 TTAATCTGAAGCTGAATTTTAGG - Intergenic
1139031157 16:62882522-62882544 ATTATTTGAAGCACAACTATGGG + Intergenic
1139398918 16:66664285-66664307 TTCATTTAGAGCAGATTTGTTGG - Intronic
1139434109 16:66926298-66926320 TTTATTTTTAGCAGAGTTGCTGG - Intergenic
1140315561 16:73893240-73893262 TTTATTTGAAACAGAACTCTTGG + Intergenic
1141024132 16:80528107-80528129 AATATTTGAGGCAGAATCGTGGG - Intergenic
1141801410 16:86311824-86311846 ATCATTTAAAACAGAATTGTAGG - Intergenic
1141901534 16:86994216-86994238 TTAAGATGAAGCCGAATTGTGGG - Intergenic
1143358055 17:6345466-6345488 TTTATTTGTGGCAGAGTTGGGGG - Intergenic
1143415789 17:6748915-6748937 TTCATTGGAAGTAGAATTCTGGG - Intergenic
1144286669 17:13782126-13782148 ATGATTAGAAGCAGAATTTTTGG - Intergenic
1144346491 17:14354378-14354400 TTTATTTGAAACATAATGGGAGG - Intergenic
1144901407 17:18595835-18595857 TGTTTTTGAGGCAGAATTCTTGG - Intergenic
1145131094 17:20350261-20350283 TGTTTTTGAGGCAGAATTCTTGG + Intergenic
1145403253 17:22563065-22563087 TTTAATGGATGCAAAATTGTTGG - Intergenic
1145872361 17:28285405-28285427 TTTGATTGAAGCAGAGTTCTAGG - Intergenic
1146992810 17:37290628-37290650 TTAACTTGAGGCAGTATTGTAGG - Intronic
1148008399 17:44453863-44453885 TTTGATTGAAGCAGAGTTCTAGG - Intronic
1148667298 17:49384194-49384216 ATTTTTTGGAGCACAATTGTGGG - Intronic
1149131944 17:53313348-53313370 TATATCTGAGGCAGAATTGGGGG - Intergenic
1150198226 17:63324101-63324123 CTTTTTTGAAGAAGAATTTTAGG - Intronic
1151071828 17:71222828-71222850 TTAATTTAAAACAAAATTGTGGG + Intergenic
1151101355 17:71559198-71559220 TATATTTGCAGTAGAATGGTGGG - Intergenic
1151454830 17:74219907-74219929 TTTCTGTAAAGCAGAATTGCTGG + Intronic
1153716217 18:7851577-7851599 TTCATTAGAAGTAGAATTCTGGG - Intronic
1153853734 18:9123872-9123894 TTTACAAGAAGTAGAATTGTAGG + Intronic
1155322695 18:24634033-24634055 TTTATAGGAAGCAGGATTGGAGG + Intergenic
1155447813 18:25930218-25930240 TTTCTTAAAAGCAGAATTGTGGG - Intergenic
1155873644 18:31058051-31058073 TTCATTTGAATCTGAATTATAGG - Intergenic
1157049044 18:44138640-44138662 TTTATTGGATACAGAATTCTAGG - Intergenic
1157146693 18:45170426-45170448 TTTATTTTGAGGAGAAATGTAGG + Intergenic
1158384814 18:56977216-56977238 TTAATTTGAAAGAGAATTGTTGG + Intronic
1158631544 18:59119520-59119542 TTTATTTGAAACAGAATGTGGGG - Intergenic
1159040429 18:63319358-63319380 TTTCTGTGAAGCAGAAGTCTGGG - Exonic
1159793241 18:72810658-72810680 TGTGTCTTAAGCAGAATTGTAGG - Intronic
1161044118 19:2125700-2125722 TGTATTTTAAACAGAAATGTAGG + Intronic
1163335368 19:16667906-16667928 TTCATTTAAATCAGAATTGTGGG + Intronic
1163379749 19:16957408-16957430 TCTCTTTGAAGCAGGAGTGTAGG - Intronic
1164909765 19:31997689-31997711 TTTTTTTGATACAGAATTCTTGG - Intergenic
1165221718 19:34321933-34321955 ATAATGTGAAGGAGAATTGTGGG + Intronic
1167121164 19:47517777-47517799 TTTATTTAAAGAAGATTTTTAGG - Intergenic
925314551 2:2911286-2911308 TTTCTATGAAGCAGAATGGTAGG + Intergenic
925666160 2:6258637-6258659 TTGTGTTGAAGCAGAATTCTTGG + Intergenic
926420775 2:12695037-12695059 TTCATTTGAAAGAGAAGTGTTGG - Intergenic
926462170 2:13144317-13144339 TTTATATGAGGCAAAATTTTTGG + Intergenic
927037678 2:19196622-19196644 CTTCTTTGTGGCAGAATTGTGGG - Intergenic
927667045 2:25040183-25040205 TTTGTGTTGAGCAGAATTGTGGG + Intergenic
928358893 2:30647203-30647225 GTTCTTAGAAGCAGGATTGTGGG - Intergenic
928498367 2:31859559-31859581 TTTAGTTCAACCAAAATTGTAGG - Intergenic
929354060 2:40997912-40997934 TTTACTTGAAGCTGTAATGTGGG - Intergenic
930857636 2:56036098-56036120 TTTATGTAAAGCAGAATTTAAGG + Intergenic
931333689 2:61317056-61317078 TTTATTTGAAGTAAAATATTTGG + Intronic
933797782 2:85934528-85934550 TTTAATTGAAACAGAATTGCCGG - Intergenic
934303160 2:91795405-91795427 TTTATTTTAGATAGAATTGTAGG + Intergenic
934330099 2:92057351-92057373 TTTATTTTAGATAGAATTGTAGG - Intergenic
934715636 2:96541776-96541798 TTTATTTGTAACAGAAGTGGGGG - Intronic
935346146 2:102110356-102110378 ATTCCTGGAAGCAGAATTGTGGG + Intronic
935917548 2:107971685-107971707 TTTAATAGAAGCAGAAGTTTAGG - Intergenic
936446814 2:112602503-112602525 TGTATTTGCAGTAGCATTGTCGG - Intergenic
936450311 2:112628846-112628868 TTTATTTTTAGCAGAGATGTGGG + Intergenic
938142876 2:128811228-128811250 TTGATTTCAAGCAAAATTGTAGG - Intergenic
939616894 2:144371829-144371851 GTTATTTGAAGAAGAATCATGGG - Intergenic
940818056 2:158318643-158318665 TTTTTTGGAAGTAGAATAGTAGG + Intronic
940997931 2:160170583-160170605 TCTATTTGAATCAGATCTGTTGG + Intronic
941153190 2:161940611-161940633 TTTATTTGAAGCAGAGTAAAGGG + Intronic
941936937 2:170989537-170989559 TTTTTTTGAACCAGAGTTTTTGG - Intergenic
942258412 2:174130682-174130704 TTTATTAAAATCAGATTTGTTGG - Intronic
942501276 2:176593305-176593327 TTGATCTGAAAGAGAATTGTGGG + Intergenic
942854859 2:180532830-180532852 TTTTTCTGAAACAGAAGTGTGGG - Intergenic
942929729 2:181475145-181475167 TTTATTTTATTCAGACTTGTGGG + Exonic
943381404 2:187153746-187153768 TTTTTATGAAGAAGAAATGTAGG - Intergenic
943924894 2:193762568-193762590 TATATTAGAAATAGAATTGTTGG + Intergenic
943997588 2:194790263-194790285 TTTATTTGAATCAAAATTTATGG - Intergenic
944734816 2:202552378-202552400 TATTTTTGAAGCAGAATTAGTGG + Intronic
945214035 2:207414346-207414368 TTTATTTGAGACAGAAATCTCGG - Intergenic
945337512 2:208610195-208610217 TTTCTTTGAAGGGGAATTATAGG + Intronic
945983585 2:216336833-216336855 TTTATTTGAAGCAGAATTGTTGG - Intronic
946721459 2:222613176-222613198 TTTATTTGAATCAGAATTTAAGG - Intronic
947516579 2:230810643-230810665 TTTGTATGCAGCAGAAATGTGGG - Intronic
948308653 2:236968844-236968866 TTCTTTGCAAGCAGAATTGTAGG - Intergenic
1168743113 20:211809-211831 TTTAGATGAAGCAGTGTTGTAGG + Intergenic
1169086395 20:2826793-2826815 TTCTTTTGCACCAGAATTGTTGG + Intergenic
1169831118 20:9826587-9826609 TATATTTGCGGCAGAATTCTCGG - Intronic
1170133422 20:13047239-13047261 TATATGAGAAGCAGAATTTTTGG - Intronic
1170917649 20:20643012-20643034 TTTATTTGTGGCAGATTTATAGG - Intronic
1171107905 20:22453317-22453339 TTAATTTCAAGTAGAATTGAGGG + Intergenic
1171155435 20:22868421-22868443 TTTACTGGATGCAGAATTCTAGG - Intergenic
1171451348 20:25238135-25238157 TTTCTTTGGAGTAGAATTGCTGG + Intergenic
1175622554 20:60461424-60461446 TTTTTTTTAATAAGAATTGTAGG - Intergenic
1176940749 21:14921551-14921573 TTTATAGGAAATAGAATTGTGGG + Intergenic
1177185126 21:17785152-17785174 AGTATTTGAATCAGATTTGTTGG - Intergenic
1178497170 21:33096980-33097002 ATTATTTGAAGAAAGATTGTAGG - Intergenic
1180457572 22:15524012-15524034 TTTATTTTAAGATGAAATGTAGG - Intergenic
1184051326 22:42007525-42007547 TTTAATGGGAACAGAATTGTTGG - Intronic
949373344 3:3359590-3359612 TCTTTTTGAAGCAGAATTGAAGG + Intergenic
949777704 3:7651006-7651028 TTGATTTGAAGGAAAATTGTGGG + Intronic
950266614 3:11577898-11577920 GTAATTTGAAGGAGAATTCTGGG - Intronic
952377012 3:32776221-32776243 TTTTTTTGAAGTACAATTATAGG - Intergenic
955196774 3:56811701-56811723 TTTGGTTTAATCAGAATTGTGGG - Intronic
955985573 3:64570729-64570751 TTTTTTTGAAGTAGAAATGATGG + Intronic
956916849 3:73880874-73880896 TCTAGATGAAGCAGGATTGTGGG + Intergenic
956931774 3:74051669-74051691 ATTCTTTGAAGTGGAATTGTTGG - Intergenic
957251352 3:77774765-77774787 TTTACTTGAAGAAGAATTGGAGG - Intergenic
957566920 3:81895995-81896017 TGTATTTGAAGAAGTGTTGTGGG + Intergenic
958264594 3:91423208-91423230 TTTAATGGAAGCAGAATAATGGG + Intergenic
959154023 3:102644226-102644248 TGTATTTGAAGAAGTATGGTAGG - Intergenic
959329820 3:104989751-104989773 TTTCTTTAAAGCAGAATAATTGG - Intergenic
959531069 3:107434007-107434029 TTGATGAGAGGCAGAATTGTGGG - Intergenic
959765135 3:110017592-110017614 TTTAATTAAAGCATAATTATAGG - Intergenic
960124362 3:113982193-113982215 ATTATTTTCAGCTGAATTGTGGG + Intronic
960484898 3:118239673-118239695 GCTGTTTGAAGCATAATTGTAGG - Intergenic
960749783 3:120935626-120935648 TTTATTGGATACAGAATTCTAGG + Intronic
960781892 3:121329282-121329304 TGTATTTTAAGAAGAATTGCAGG - Intronic
962605837 3:137032428-137032450 TATATTTGAACACGAATTGTTGG + Intergenic
963211555 3:142698157-142698179 TTGGTCTGAATCAGAATTGTGGG - Intronic
963510869 3:146247237-146247259 ATTATTGGAAGCAGAACTGATGG + Intronic
964234135 3:154505656-154505678 CTTCTTTGAAGCTGAATTTTTGG + Intergenic
964606630 3:158567040-158567062 TTAATTTGAAGAAAGATTGTGGG + Intergenic
965098664 3:164269604-164269626 TTTATTTAAAGCATAGGTGTTGG - Intergenic
965172142 3:165279585-165279607 TTTATTTTAAACAGAGTTATGGG - Intergenic
965756963 3:172037599-172037621 TATATTCAAAGCAGAATTCTAGG + Intergenic
966580210 3:181552924-181552946 ACTTTTAGAAGCAGAATTGTTGG - Intergenic
967442841 3:189528707-189528729 TTTATTTGAGAAAAAATTGTAGG + Intergenic
967569088 3:191006982-191007004 TTGATTTGAAGCAAAATTGAAGG + Intergenic
970178759 4:13365687-13365709 TATTTTTGAAACAGAAATGTAGG - Intronic
970189330 4:13496906-13496928 ATTATTTGAAGCTTGATTGTGGG + Intergenic
970222924 4:13828761-13828783 TTTATATGAGGCAGTATTTTGGG + Intergenic
970305649 4:14729215-14729237 TTTATTGTAAGCAGAAGTTTGGG + Intergenic
970383183 4:15529019-15529041 TGTATCTGAATCAGAATTGCTGG - Intronic
970757267 4:19441993-19442015 TTATTTTGAATCAAAATTGTTGG + Intergenic
970824755 4:20256108-20256130 TTTAATACAAACAGAATTGTTGG + Intronic
971733183 4:30412452-30412474 TTTATTTAAGGCAAGATTGTTGG - Intergenic
971830104 4:31681118-31681140 CTTATTTAAAGCAGAAATCTTGG - Intergenic
972410977 4:38794336-38794358 CTTCTTTGAAGCATAATAGTGGG - Intronic
972930608 4:44067380-44067402 TATATTTGAAACAGAATAGTAGG + Intergenic
974297408 4:60019500-60019522 CTTACTCTAAGCAGAATTGTAGG - Intergenic
976652895 4:87455088-87455110 TTTATTTGTAGCATAAAAGTGGG + Intronic
976892769 4:90070514-90070536 CCTATTTGAAGAAAAATTGTGGG + Intergenic
977372630 4:96158994-96159016 TTTATTAAAAATAGAATTGTAGG - Intergenic
977655001 4:99510777-99510799 TGTTCTTTAAGCAGAATTGTGGG + Intergenic
978545050 4:109862204-109862226 TTTATATGCATCAGAATAGTTGG - Intronic
978971848 4:114817360-114817382 ATAATTTGAATGAGAATTGTTGG - Intergenic
979042012 4:115810526-115810548 TTGATTTGTATCAGAATTGTGGG - Intergenic
979144409 4:117223660-117223682 TTTATTTAAAAAAGAAATGTAGG - Intergenic
979342819 4:119547803-119547825 TTTCTGAAAAGCAGAATTGTTGG - Intronic
979734113 4:124061363-124061385 TTTTTTTGAAGCAAAATCTTTGG + Intergenic
980689993 4:136282969-136282991 TTTATTGGACACAGAATTCTAGG - Intergenic
980824967 4:138062163-138062185 TTTATTTGAAACAGAATATGGGG - Intergenic
981319977 4:143380471-143380493 TTTATTTGAGGCAGAACTATGGG - Intronic
982269993 4:153576594-153576616 TTCATTTGAAGAAATATTGTAGG + Intronic
982386269 4:154807007-154807029 TTTATTAGAAGGAGTATTTTAGG - Intronic
982968067 4:161940644-161940666 TTTATCTGATACAGAATTATTGG - Intronic
983241807 4:165242058-165242080 TTTATTTATGGCAGAATTGGAGG + Intronic
983351087 4:166589274-166589296 TTTATTTGAAGGTCATTTGTTGG + Intergenic
984347266 4:178544897-178544919 TTTACAAGAAGCAGAATTTTAGG - Intergenic
984687445 4:182686677-182686699 TTTAATTGAAGTGGAATTGAAGG - Intronic
985349967 4:189049424-189049446 TTTATTTTAATAAGAATTTTTGG - Intergenic
985816009 5:2128575-2128597 GTTTTTAGAAGCAGAATTTTGGG + Intergenic
987111131 5:14688117-14688139 TTTTTCTGAAACAGAATTGTAGG + Intronic
987463256 5:18240959-18240981 TTTATTTGAAGAAAAATTGAAGG - Intergenic
987572553 5:19683637-19683659 TTTATTACAAGCAGAATGGGTGG + Intronic
988415054 5:30936112-30936134 TGTATATGAAGCAGCAATGTAGG - Intergenic
989023158 5:37034372-37034394 TATATTTGAAGTCGAATTGCTGG - Intronic
989542455 5:42633036-42633058 TTTATTGGCAGAAGATTTGTTGG + Intronic
991234088 5:64374314-64374336 TTTTATTGCAGCAGAATTATGGG - Intergenic
992072968 5:73165584-73165606 TCTATCTGAAGCAGAAATGGAGG - Intergenic
993205370 5:84871919-84871941 TTTCTTTGCAGCAGAATTTAAGG - Intergenic
993798181 5:92296859-92296881 AATATTTGAAGAAGAATTATGGG - Intergenic
994671675 5:102769204-102769226 TTTTTTTCCAGCAGAGTTGTTGG + Intronic
995348493 5:111148330-111148352 TTGATTTGAAACAATATTGTGGG + Intergenic
995744664 5:115391273-115391295 TTTATCTATAGCAGAATTGAGGG + Intergenic
996169455 5:120270899-120270921 TTTATTTCAGGCATAATTTTGGG + Intergenic
997368462 5:133340672-133340694 TTTCTTTGAAGCTTAATTGATGG + Intronic
998813448 5:145988918-145988940 TCTTTTTGGAGCAGATTTGTTGG - Intronic
998891785 5:146753957-146753979 CTTAAATCAAGCAGAATTGTAGG + Intronic
999022846 5:148188787-148188809 TTTATTTGAAGATGAAATGATGG + Intergenic
999065481 5:148681066-148681088 CTTATTTGAAGCACAGTTTTTGG - Intergenic
999558413 5:152771539-152771561 TTTATTTTCAGAAGAATTGGTGG + Intergenic
1000016143 5:157278687-157278709 TTTTTTGGTAGGAGAATTGTTGG + Intronic
1001498828 5:172212403-172212425 TTTATATGAACCAGAATGCTAGG + Intronic
1002663409 5:180805944-180805966 TTTATTCCAAAAAGAATTGTAGG - Intronic
1003274215 6:4634872-4634894 ATTCTTAGAAGCAAAATTGTTGG - Intergenic
1003368220 6:5497754-5497776 TTTATTTTAAATAGAATTTTAGG + Intronic
1004451742 6:15754066-15754088 TTCATTTGAAACACAATTATAGG + Intergenic
1004651108 6:17609575-17609597 TTCTGTTGAAGCAAAATTGTGGG + Exonic
1005217398 6:23547189-23547211 TTTTTTTTAAGAAGAATTGGTGG + Intergenic
1008134133 6:47753506-47753528 TTTATTTCAAATAGAATTTTAGG + Intergenic
1009488245 6:64253345-64253367 TTTATGTGAAGTAGAATAATAGG + Intronic
1009581587 6:65541756-65541778 TCTATTTAAAGCAGTATTGTTGG - Intronic
1010265436 6:73860633-73860655 TTTCTTTGTTGCTGAATTGTAGG + Intergenic
1010360203 6:74984720-74984742 TTTATTTGCAAAAGAATTGGAGG + Intergenic
1010912422 6:81575598-81575620 TTTTTATGAAGCAGAATTCCAGG + Intronic
1011061953 6:83280001-83280023 ATTACATGATGCAGAATTGTAGG - Intronic
1011258951 6:85452034-85452056 TGGATTTGAAGAAGAATCGTGGG + Intronic
1011266513 6:85525492-85525514 TTTATTTAAAGTTTAATTGTTGG - Intronic
1011515925 6:88153011-88153033 ATTTTTTAAAGCAGAATTCTAGG - Intronic
1013342797 6:109231444-109231466 CTTGGTTGAAGCAGATTTGTTGG + Intergenic
1013460842 6:110373487-110373509 TTGTTTTGGAGAAGAATTGTGGG - Intergenic
1013660157 6:112287500-112287522 TTTATGTAAAGCTGAATTCTTGG + Intergenic
1015422599 6:133027829-133027851 TTTATTTTAAGTGGAAATGTTGG + Intergenic
1016854798 6:148656571-148656593 TTTATTTTAAACAAAATTATGGG + Intergenic
1016871885 6:148825903-148825925 ATTATGAGAAGCAGAGTTGTAGG + Intronic
1017050333 6:150386465-150386487 TTTTTTTTAAGCAGACTTATTGG - Intronic
1017319667 6:153075240-153075262 TTTATCAGAAGCAAAATTGCTGG - Intronic
1017590310 6:155972263-155972285 TTTATTTTAAGCATGATTATGGG + Intergenic
1020582606 7:10023325-10023347 TTTCTGTGAACCAGAATTCTGGG - Intergenic
1021142217 7:17040646-17040668 TTTGTTTGAAGTAAAATTATAGG - Intergenic
1022026304 7:26451232-26451254 TTTACTTGTAACAGAATGGTAGG - Intergenic
1022868801 7:34453164-34453186 TTTTTTGGAAGGAGAATTCTAGG + Intergenic
1023203548 7:37723869-37723891 TTTCTTTGAAGCAAAATTTCTGG + Intronic
1023240622 7:38142704-38142726 TTTCTTTGAAGCAATTTTGTTGG - Intergenic
1023505497 7:40896106-40896128 TTTGTTTGAATCAGATTTTTTGG - Intergenic
1025109793 7:56204548-56204570 CATATTTGAAACAGAACTGTGGG - Intergenic
1026032829 7:66809305-66809327 TTTATTTGAGCCTAAATTGTAGG + Exonic
1027004089 7:74677247-74677269 TTTATTTTAAGCACTATTTTAGG + Intronic
1027736464 7:81938622-81938644 TTTTTTTGAATCAGAATTCTGGG - Intergenic
1028124669 7:87098596-87098618 ATTATTAGAAGTGGAATTGTTGG - Intergenic
1028130268 7:87163341-87163363 TCTTTTTTAAGCAGAATTTTTGG - Intronic
1029811423 7:103053055-103053077 TTTATTAGAAAAGGAATTGTCGG - Intronic
1031272470 7:119669523-119669545 CTTACTTGATACAGAATTGTAGG + Intergenic
1031297190 7:120015363-120015385 ATTGTTTGAAGCTGAATTGCTGG - Intergenic
1031839277 7:126717614-126717636 ATTATTTGAAGTAGAAATGCAGG - Intronic
1032646819 7:133834099-133834121 CTTATTTGAAGCAGAATTGTGGG + Intronic
1033508535 7:142030654-142030676 TTTACTTGAGGAAGAGTTGTTGG - Exonic
1034610426 7:152362478-152362500 TTTCTTTGAAGCAGCCATGTTGG - Intronic
1035423780 7:158753215-158753237 TTTATTTGAAGCACAATGAATGG + Intronic
1036033509 8:4995413-4995435 TTTATCTGAAGCTGAAGTTTGGG - Intergenic
1036306874 8:7609486-7609508 TGTGTTTGAAGAAGAATTCTAGG - Intergenic
1036357724 8:8057474-8057496 TGTGTTTGAAGAAGAATTCTAGG - Intergenic
1036893225 8:12609472-12609494 TGTGTTTGAAGAAGAATTCTAGG + Intergenic
1036992439 8:13613559-13613581 TTTCTTTGAAGGAAAATTATAGG + Intergenic
1037076714 8:14729769-14729791 TATATTTTAACCAGAATGGTAGG - Intronic
1037131861 8:15415970-15415992 TTTATTTGAAGCACACATGTTGG - Intergenic
1038418574 8:27416749-27416771 TTCATTTGCAGGAGAGTTGTAGG - Intronic
1040671951 8:49702732-49702754 ATTATTTTAAGAAAAATTGTGGG + Intergenic
1043332577 8:79135883-79135905 TTTATTTTAAGCAGAAATTAAGG - Intergenic
1043407659 8:79954765-79954787 TTTATTTCAACAAGATTTGTAGG - Intronic
1043653486 8:82630887-82630909 TTTATATTAAGCAAAAATGTTGG + Intergenic
1043890551 8:85648315-85648337 ATTAGTTGAATTAGAATTGTTGG + Intergenic
1043893939 8:85722192-85722214 ATTAGTTGAATTAGAATTGTTGG - Intergenic
1043894296 8:85725277-85725299 ATTAGTTGAATTAGAATTGTTGG - Intergenic
1043894652 8:85728362-85728384 ATTAGTTGAATTAGAATTGTTGG - Intergenic
1043895008 8:85731447-85731469 ATTAGTTGAATTAGAATTGTTGG - Intergenic
1043897668 8:85750364-85750386 ATTAGTTGAATTAGAATTGTTGG + Intergenic
1043898024 8:85753449-85753471 ATTAGTTGAATTAGAATTGTTGG + Intergenic
1043898383 8:85756534-85756556 ATTAGTTGAATTAGAATTGTTGG + Intergenic
1043899995 8:85768729-85768751 ATTAGTTGAATTAGAATTGTTGG + Intergenic
1043901600 8:85780922-85780944 ATTAGTTGAATTAGAATTGTTGG + Intergenic
1043901959 8:85784007-85784029 ATTAGTTGAATTAGAATTGTTGG + Intergenic
1043903567 8:85796197-85796219 ATTAGTTGAATTAGAATTGTTGG + Intergenic
1043905178 8:85808390-85808412 ATTAGTTGAATTAGAATTGTTGG + Intergenic
1043906790 8:85820581-85820603 ATTAGTTGAATTAGAATTGTTGG + Intergenic
1043994155 8:86791926-86791948 TTTATTTTGAGCCGAATTTTAGG + Intergenic
1044217788 8:89633143-89633165 TTTATTTTTAGCAGAATATTGGG - Intergenic
1044550135 8:93502903-93502925 TTTATTTTAAAAATAATTGTAGG - Intergenic
1044595857 8:93957635-93957657 TTTGTTAGAAGCTGTATTGTAGG + Intergenic
1044785799 8:95791247-95791269 ATTATTAGAAGTAGGATTGTGGG - Intergenic
1045217547 8:100163238-100163260 ATTTTTTGAAGCAGAATCGCTGG - Intronic
1045450916 8:102324076-102324098 TTTGTTTGTAGCAGAATGGATGG - Intronic
1045966806 8:108034279-108034301 TTTATTTGAATCAGAATCTTAGG - Intronic
1046557685 8:115795824-115795846 TTTATTTGGAGCAGTATTTTAGG + Intronic
1046795884 8:118371307-118371329 GTTAATTGAAGTAGAATTGAGGG + Intronic
1046942609 8:119945585-119945607 TATTTTTAATGCAGAATTGTGGG - Intronic
1047567515 8:126062100-126062122 TTTATTTGAAACAGGATTTGGGG - Intergenic
1047900847 8:129420953-129420975 TTTATTTGTAGGTAAATTGTTGG + Intergenic
1048349539 8:133605005-133605027 TATATTTGGAGCGGAATTGCTGG - Intergenic
1048583172 8:135747562-135747584 TTTATTTGAAGAATTATTTTAGG + Intergenic
1048812996 8:138305110-138305132 TTCATTTGAAGAATAAATGTCGG + Intronic
1051078441 9:13268342-13268364 TTTATTTGAATAAGAATTGAAGG - Intronic
1051628690 9:19123092-19123114 TTAATTTGAAACAAAATTTTAGG + Intronic
1052082095 9:24219374-24219396 TAAATGTGAAGAAGAATTGTAGG + Intergenic
1052223800 9:26059830-26059852 TTGATTTGAACCAGAAAGGTAGG + Intergenic
1052491107 9:29169247-29169269 TTTTTTTGAAACAGAGTTTTGGG - Intergenic
1052565304 9:30142354-30142376 TTTATTTGAAAAACATTTGTTGG + Intergenic
1053298965 9:36935405-36935427 ATGATTTGCAGCAGAATTGAAGG + Intronic
1053584104 9:39438054-39438076 TTTATTTAAAACAGAGTTGGAGG + Intergenic
1053610996 9:39712898-39712920 TTCATTTGAAACAGACTTCTAGG - Intergenic
1053869038 9:42470920-42470942 TTCATTTGAAACAGACTTCTAGG - Intergenic
1054087258 9:60758260-60758282 TTCATTTGAAACAGACTTCTAGG + Intergenic
1054105684 9:60996798-60996820 TTTATTTAAAACAGAGTTGGAGG + Intergenic
1054242525 9:62629497-62629519 TTCATTTGAAACAGACTTCTAGG + Intergenic
1054556649 9:66664015-66664037 TTCATTTGAAACAGACTTCTAGG + Intergenic
1055397133 9:75888215-75888237 TTTTTTTAATTCAGAATTGTGGG - Intergenic
1056531035 9:87488050-87488072 TTTATTTGATGCCAAATTCTTGG + Intergenic
1056745472 9:89297539-89297561 TTCTATTGAAGCAAAATTGTGGG + Intergenic
1057583943 9:96313014-96313036 TTTATTTGAAGCAGAATGTGGGG - Intergenic
1057705070 9:97390182-97390204 CTAATTTGAAGCAGAACTGCTGG + Intergenic
1058009434 9:99960169-99960191 TGTTTTGGATGCAGAATTGTTGG + Intronic
1058130744 9:101250186-101250208 GTTCTTTGAGGCAGAATGGTGGG - Intronic
1058249676 9:102675905-102675927 TTAATTTGAATCATAAATGTAGG - Intergenic
1060686660 9:125620488-125620510 TAAATTTCAAGCAGAATTGCTGG - Intronic
1186685403 X:11920103-11920125 TTTATTAGAAACACAATGGTGGG - Intergenic
1188184839 X:27100961-27100983 CTCATTTGAAGCATAATTGTTGG + Intergenic
1188728381 X:33613825-33613847 TTAATTTAAAGCTGAAATGTAGG + Intergenic
1188836875 X:34968541-34968563 TTTTTTTCAATCAGTATTGTTGG - Intergenic
1189415979 X:40813605-40813627 TTTTTTTGAAACAAAATTCTGGG - Intergenic
1190950401 X:55138022-55138044 TTTATTTGAAGTAGAATTGCTGG - Intronic
1190999327 X:55643622-55643644 TTTATTTGATTCATATTTGTGGG - Intergenic
1191756629 X:64599732-64599754 TCTATTTGAAGTACAATAGTAGG - Intergenic
1192583218 X:72301668-72301690 TTTATTTACAACAGAATTGGTGG + Exonic
1192860671 X:75067037-75067059 TTTCCTAGAAGCAGAATTATTGG + Intronic
1192866714 X:75141695-75141717 TTTCTTAGAAGTAGAATTGTTGG + Intronic
1193180830 X:78454524-78454546 TTTATTTGAAACAGATGTTTCGG - Intergenic
1193451021 X:81666571-81666593 TATCTTTGTAGCAGAATTTTTGG + Intergenic
1193728250 X:85069372-85069394 TTAATTTCAAGTAAAATTGTGGG - Intronic
1194673627 X:96766794-96766816 TTGATTAGAAGCAGAAATGGAGG + Intronic
1194878819 X:99224514-99224536 TTTATGTTCAGCAGAAATGTTGG - Intergenic
1195633717 X:107089003-107089025 TATATTTCAAGCAGAACTATAGG + Intronic
1197309514 X:124887103-124887125 TTTATTAGAAGTAGAAATGATGG - Intronic
1198084628 X:133270508-133270530 TTCATTTTAAGCAGATTTGATGG + Intergenic
1199737853 X:150701514-150701536 TTTATGTGGAGCAGAATGCTTGG + Intronic
1199782689 X:151077148-151077170 ATTACTAGAAGCAGAATTGCTGG - Intergenic
1200877915 Y:8179097-8179119 TTCTGTTGAAGCAAAATTGTGGG - Intergenic
1202033838 Y:20610161-20610183 TTCTGTTGAAGCAAAATTGTAGG + Intergenic