ID: 945985317

View in Genome Browser
Species Human (GRCh38)
Location 2:216348962-216348984
Sequence GACTGAAGGACTGTGATATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945985317_945985319 -7 Left 945985317 2:216348962-216348984 CCATATATCACAGTCCTTCAGTC 0: 1
1: 0
2: 1
3: 9
4: 148
Right 945985319 2:216348978-216349000 TTCAGTCTTTCTTGTCTTTCAGG 0: 1
1: 0
2: 5
3: 76
4: 607

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945985317 Original CRISPR GACTGAAGGACTGTGATATA TGG (reversed) Intronic
904311517 1:29632606-29632628 GACTGAGGGACTGGGAGCTAGGG - Intergenic
904740606 1:32672505-32672527 GACTGAATGTCTGGGATTTAAGG + Exonic
909160068 1:72135474-72135496 GACTGAAGGACAGTGATCTCTGG + Intronic
909496477 1:76284827-76284849 GACTGAAGGACAATGGCATATGG - Intronic
911439558 1:97908397-97908419 GACAGAAGCACTGAGTTATAGGG - Intronic
913018867 1:114766614-114766636 GACTAAAGAACTGTCATAGAAGG - Intergenic
913047675 1:115088474-115088496 GCCTGCAGGACTGTGAGACAAGG - Intronic
913246851 1:116877632-116877654 CACAGAAGGACTGTGAGATTTGG + Intergenic
914793075 1:150896676-150896698 GAATGAATGACTTTGAGATATGG - Intergenic
916653418 1:166851207-166851229 GCCTGTAGGACTGTGACATAGGG + Exonic
917203007 1:172537065-172537087 GACTGAGGGAGTATGGTATAGGG - Intronic
917252439 1:173077000-173077022 CATTGAGGGACTGTGATATCAGG + Intergenic
917433657 1:174997898-174997920 GGCTAAAAGACTGTGATCTAAGG + Intergenic
917822896 1:178783364-178783386 GACTGTAGGACAGTGACAAAAGG + Intronic
918746487 1:188207950-188207972 GGCTGTAGGTCTGTCATATACGG - Intergenic
919110813 1:193216953-193216975 GGCTGTAGGACTGTCATAGACGG - Intronic
922373529 1:224937082-224937104 GGCTGTAGGTCTGTCATATATGG - Intronic
924037653 1:239953500-239953522 GACTGGAGGACTGAGATGTGGGG - Intergenic
1064521240 10:16204057-16204079 AACTGTAGGTCTGTCATATATGG + Intergenic
1066448732 10:35509044-35509066 GAATGAAGTACTGAGATACACGG - Intronic
1068012840 10:51476158-51476180 TTCTCAATGACTGTGATATATGG - Intronic
1070261185 10:74857516-74857538 AAGTTAAGGACTGTGAGATAAGG - Intronic
1070791253 10:79190755-79190777 TACTGTGAGACTGTGATATAAGG + Intronic
1073186178 10:101616299-101616321 GACTGAAGGAAGGAGATAGAAGG - Intronic
1073206024 10:101769903-101769925 GAGGAAAGGACTGTGACATAGGG - Intergenic
1076885562 10:133260935-133260957 GGCTGAAGGACTGGGAAACAGGG - Intergenic
1079632575 11:22695658-22695680 CACTGAATAGCTGTGATATATGG - Intronic
1080125735 11:28731464-28731486 GAATGAATGAATGTGATTTAAGG + Intergenic
1086594694 11:88556801-88556823 GACAGAAGTAGTGTGGTATAGGG - Intronic
1089670231 11:120051714-120051736 GAGTGAAGGACAGTGACAGACGG - Intergenic
1093602230 12:21041924-21041946 GGCTGTAGGTCTGTCATATATGG + Intronic
1102362507 12:112300558-112300580 GACTGAAGGACGTTGGTATCTGG - Intronic
1105336027 13:19470154-19470176 GACTGTGGGTCTGTCATATATGG + Intronic
1106714564 13:32374195-32374217 GCCTCAAGGCCTGTGATAGAAGG + Intronic
1107395252 13:40008856-40008878 GGCTGAGGGTCTGTCATATATGG + Intergenic
1110520538 13:76470876-76470898 GGATAAATGACTGTGATATAAGG - Intergenic
1111568253 13:90045033-90045055 AGCTGAGGGACTGTCATATATGG + Intergenic
1113237928 13:108302314-108302336 GATTGAGGGACTGTAATATAAGG - Intronic
1114875715 14:26715566-26715588 GACTTTAGGACTGTCATATAGGG + Intergenic
1114916551 14:27274394-27274416 GCCTGAGGGACTTTGATAAATGG - Intergenic
1115359874 14:32488727-32488749 GAGTGAAGGACCGTGCTATCTGG - Intronic
1118381655 14:65222579-65222601 CACTGAAGGACTGGGAGAGAAGG + Intergenic
1120813973 14:88834068-88834090 GTCTGAAAGACTGTGATGGATGG + Intronic
1123111703 14:105872349-105872371 TACTGTGGGACTGTCATATATGG + Intergenic
1129155470 15:73714617-73714639 GATTTAAGGACGGTGAGATAAGG - Intergenic
1129635223 15:77309361-77309383 GACAGAAGGAATGACATATAAGG + Intronic
1138322732 16:56130950-56130972 GAAGGAAGGAGTGGGATATAAGG + Intergenic
1142003660 16:87678955-87678977 GACTGCAGGACCGTGAGAAAAGG + Intronic
1143037616 17:4008682-4008704 GAGTGAATGACTCTGATAAATGG + Intronic
1144148830 17:12423744-12423766 GACTGAGGGAATGTGAATTATGG + Intergenic
1149026285 17:52030899-52030921 GACTGAAGGCCTTAGATCTAAGG - Intronic
1149427149 17:56566142-56566164 CCCTGAAGGACTGTGATGAAGGG + Intergenic
1149899620 17:60462406-60462428 CACTCCAGGACTGGGATATAAGG - Intronic
1150212681 17:63450061-63450083 GACTGAAGGCCTGTGAGAACAGG - Intergenic
1153546050 18:6206018-6206040 GACTGAAGGTCTGGGAAATGAGG + Intronic
1154994762 18:21629530-21629552 GACAGAAGGAAAGTGATGTATGG + Exonic
1157008680 18:43619946-43619968 GAGGGAAGGACTGTGATATCTGG - Intergenic
1166398267 19:42458363-42458385 GACTGAAGAAGAGTGAAATAAGG + Intergenic
1166413981 19:42578550-42578572 GACTGAAGAAGTGTGAAATACGG + Intergenic
1168439858 19:56354816-56354838 GGCTGAATGACTGTGTTTTAGGG + Intronic
925460784 2:4060879-4060901 GTCTGAAGGACAGTGACAAAGGG + Intergenic
927155882 2:20221169-20221191 GACTGATGATCTGTGATATGTGG - Intronic
927204763 2:20600169-20600191 GAATGAACAACTGTGATCTACGG + Intronic
928226464 2:29452948-29452970 GATTGAAGAACTGTCATACATGG + Intronic
932171849 2:69564789-69564811 GATTGAAGGACTATGACCTAGGG - Intronic
932332630 2:70906394-70906416 GACTGAAGGAGTGTGCTATAAGG + Intronic
934069595 2:88371840-88371862 GCCTGAAGGGCTGTGATAACTGG - Intergenic
935127779 2:100239498-100239520 GACTGAGGGGCTGTGGTACAGGG + Intergenic
937750279 2:125468644-125468666 AACTGAAGGCTTGTGCTATAGGG + Intergenic
939463647 2:142529556-142529578 GAGTGAAGGGCAGTGTTATACGG - Intergenic
939494990 2:142917289-142917311 CACTGAAGGACTGGGAACTATGG + Intronic
939793561 2:146612184-146612206 AGCTGAAGGATTGTTATATATGG + Intergenic
940004890 2:149001443-149001465 GAGGGAAGGACAGGGATATAAGG + Intronic
940207888 2:151224274-151224296 GAAGGAAGGAGTGAGATATAAGG - Intergenic
940370496 2:152895807-152895829 CAGTGAAGGACTGTGCCATAAGG + Intergenic
941141272 2:161785704-161785726 AACTGTAGGATTGTCATATATGG - Intronic
942927634 2:181453099-181453121 GACTGTAGGTTTGTCATATATGG - Intergenic
942927718 2:181454215-181454237 GACTGTAGGTTTGTCATATATGG + Intergenic
943094272 2:183409918-183409940 CCCTGAAAGACTGTGAGATAGGG - Intergenic
945738582 2:213632596-213632618 GGCTGTAAGACTGTCATATATGG + Intronic
945985317 2:216348962-216348984 GACTGAAGGACTGTGATATATGG - Intronic
948110470 2:235451113-235451135 GACTCAAGAACTGTGACACACGG - Intergenic
1173127284 20:40350328-40350350 AGCTGAAGGTCTGTCATATATGG - Intergenic
1173435683 20:43030389-43030411 GATTGAATGACTTTGATATTGGG + Intronic
1175301550 20:57946798-57946820 GAGTGAAGGACTGTGAGGTGGGG - Intergenic
1176737533 21:10564865-10564887 GACTGTGGGTCTGTCATATATGG - Intronic
1177595854 21:23241336-23241358 GACTGCAGGACTGTGGGCTAGGG + Intergenic
951298286 3:20966775-20966797 GGCTGTAGGTCTGTCATATATGG + Intergenic
952404719 3:32995158-32995180 GACTGAATGAGTGAAATATAAGG + Intergenic
953187795 3:40654541-40654563 GACAGAAGGACTCTGCTTTATGG + Intergenic
953816173 3:46159234-46159256 GGCTGTAGGTCTGTCATATATGG + Intergenic
955898000 3:63721342-63721364 GACTGTGGGTCTGTCATATATGG - Intergenic
956877118 3:73474840-73474862 GGCTGAAGGACTGTGTTATGAGG - Intronic
957602129 3:82350951-82350973 GACTTAAGGAATGAGATAGATGG + Intergenic
960354556 3:116635383-116635405 GACTGAAAAACTGTGTTTTAAGG - Intronic
960658329 3:120030524-120030546 GACTGAAGGATTGTGAGCAAGGG - Intronic
964153672 3:153559754-153559776 GACTGTAGGTTTGTCATATATGG - Intergenic
964287402 3:155133463-155133485 GACTATAGAACTTTGATATAAGG - Intronic
968928693 4:3564055-3564077 GACTGCAAGACTGTGACACACGG + Intergenic
968928784 4:3564835-3564857 GACGGAAAGACTGTGACACACGG + Intergenic
969224233 4:5784228-5784250 GAGTGAAGGACTTTGAGGTAGGG + Intronic
974201377 4:58645893-58645915 GACTCCAGGACTGTAATATTTGG - Intergenic
975444054 4:74442485-74442507 AACTGAAGGACTCTTATAAATGG - Intergenic
977310535 4:95381529-95381551 GTCTCACGGACAGTGATATATGG - Intronic
977522080 4:98097492-98097514 GACTGAGGGTCTGTCATATATGG - Intronic
977748151 4:100576424-100576446 GACAGAAATACTGTGATAAAAGG + Intronic
979172330 4:117616998-117617020 TAGTGTAGGACTGTCATATATGG - Intergenic
979922330 4:126514689-126514711 TACAAAATGACTGTGATATATGG - Intergenic
979999513 4:127471524-127471546 GACTGATGGAAAGTGAAATAAGG - Intergenic
980881711 4:138717116-138717138 GACAGAAGGATTGTGAAAAACGG + Intergenic
981046939 4:140273254-140273276 GACTGAAGGGCTGTGTAATCAGG + Intronic
982416207 4:155135431-155135453 GTCTGAAGCATTGTTATATATGG + Intergenic
986265740 5:6188954-6188976 GATTGGAGGACCGTGATATCAGG + Intergenic
986943286 5:12983526-12983548 GATTGAAGGAATGTTATAAAAGG - Intergenic
990577056 5:57133477-57133499 GCCTGAAGGACAGTCATACAAGG - Intergenic
997768194 5:136526186-136526208 TACTGCAGGACTGTGGTAGAGGG - Intergenic
998668656 5:144328678-144328700 CACTGGAGGCCTGTGATAGAGGG - Intronic
999009273 5:148017190-148017212 GACTGAAGGAAAGAGATACAAGG - Intergenic
1000571360 5:162917905-162917927 GACTGAAGGATGGGGAAATATGG - Intergenic
1004855772 6:19748196-19748218 AACTGAAGGTCTGTTATCTATGG - Intergenic
1008259967 6:49353589-49353611 GGCTGTAAGACTGTCATATATGG - Intergenic
1008282015 6:49607734-49607756 GAATGAAAGAATGTGATAAAAGG + Intronic
1009748422 6:67851074-67851096 AACTGAGGGTCTGTCATATATGG - Intergenic
1012690437 6:102304483-102304505 ACCTGAGGGTCTGTGATATAAGG - Intergenic
1012873940 6:104703671-104703693 GACTGAAGAGGTGAGATATATGG + Intergenic
1015646715 6:135399367-135399389 GACTGAAGGATTCAGATATATGG - Intronic
1016576203 6:145572154-145572176 CCCTGAAGGACAGTGATAAAGGG - Intronic
1016715677 6:147225373-147225395 AACTGGAGAACTGTGATATCCGG - Intronic
1017229026 6:152052365-152052387 GAATGTAGAACAGTGATATAAGG + Intronic
1018353059 6:162982931-162982953 GACTTAAGAAATGAGATATATGG - Intronic
1028642117 7:93054114-93054136 GACAGAAGTACTCAGATATAAGG - Intergenic
1030232305 7:107221297-107221319 CAATCAAGGACTGTCATATAGGG - Intronic
1033500263 7:141941442-141941464 GGCTGTAGGTCTGTCATATATGG - Intronic
1034857967 7:154571718-154571740 GACTGAATGACTGTGTGATTGGG - Intronic
1042032804 8:64495046-64495068 AACTGAGGGTCTGTTATATATGG - Intergenic
1043005565 8:74814280-74814302 GACTCAAGGCCTGAGATTTAAGG + Intronic
1047294473 8:123558954-123558976 GAGAGAAGGGCTATGATATAGGG + Intergenic
1051292114 9:15555038-15555060 AACTGAAGGACTCAGATGTAAGG + Intronic
1055560119 9:77514234-77514256 GACTATGGGACTGTGATATCGGG - Intronic
1057979776 9:99649585-99649607 CACTGCAGGACTGTGACATCAGG + Intergenic
1058254218 9:102740953-102740975 TACTGTAGGACTGTGATCTTTGG - Intergenic
1058779947 9:108323369-108323391 GACTGAAGACCTATCATATATGG + Intergenic
1059622893 9:116028042-116028064 GTGAGAAGGACTGTGATAAAGGG + Intergenic
1059901665 9:118934418-118934440 TAATGAAGGACTGTCATGTATGG + Intergenic
1060089310 9:120729041-120729063 GATTGAATGACTTTGATGTAAGG - Intergenic
1060283111 9:122227157-122227179 GACTGAAGGACAGGGATGGAAGG + Intronic
1187173972 X:16878915-16878937 GACTAAATTACTGTGATATTTGG - Intergenic
1190090524 X:47433255-47433277 GATTGAAGCAATGTGATTTAGGG + Intergenic
1190343651 X:49317749-49317771 GACTGATAGACTGTCAGATAGGG + Intronic
1190344749 X:49327277-49327299 GACTGATAGACTGTCAGATAGGG + Intronic
1190345842 X:49336834-49336856 GACTGATAGACTGTCAGATAGGG + Intronic
1190375517 X:49784981-49785003 GATTGAAGCAATGTGATTTAGGG + Intergenic
1191679994 X:63831158-63831180 GCCTAAAGGACTGTGATAGGAGG - Intergenic
1192223990 X:69215988-69216010 GACTAAGGGACAGTGATAGAGGG + Intergenic
1192824806 X:74683866-74683888 GACTTAAATACTGTGATGTAAGG - Intergenic
1193857402 X:86621430-86621452 GTATGAGGGACTGAGATATAGGG - Intronic
1195525499 X:105884611-105884633 GACTTAATGACTGAAATATAGGG - Intronic
1196027539 X:111056513-111056535 GTCTTAAGGAATGTGATAAAAGG - Intronic
1202595792 Y:26538161-26538183 GACTGTGGGTCTGTCATATATGG - Intergenic