ID: 945985678

View in Genome Browser
Species Human (GRCh38)
Location 2:216351761-216351783
Sequence CTCATCTCAAAGATGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 331}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945985673_945985678 26 Left 945985673 2:216351712-216351734 CCTGACAGTAACACAAACACCTC 0: 1
1: 0
2: 0
3: 14
4: 207
Right 945985678 2:216351761-216351783 CTCATCTCAAAGATGAAGGAAGG 0: 1
1: 0
2: 2
3: 21
4: 331
945985675_945985678 -3 Left 945985675 2:216351741-216351763 CCTCTCTAGACCTTGACTGACTC 0: 1
1: 0
2: 0
3: 6
4: 148
Right 945985678 2:216351761-216351783 CTCATCTCAAAGATGAAGGAAGG 0: 1
1: 0
2: 2
3: 21
4: 331
945985674_945985678 7 Left 945985674 2:216351731-216351753 CCTCACTTAACCTCTCTAGACCT 0: 1
1: 0
2: 5
3: 19
4: 169
Right 945985678 2:216351761-216351783 CTCATCTCAAAGATGAAGGAAGG 0: 1
1: 0
2: 2
3: 21
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945985678 Original CRISPR CTCATCTCAAAGATGAAGGA AGG Intronic
900271208 1:1789903-1789925 CTAATCTCATGGAGGAAGGAGGG + Intronic
901811931 1:11772269-11772291 CTCATCTCAAAAAAAAGGGAAGG - Intronic
902191943 1:14769912-14769934 CTCAGCTCAGAGATCAGGGATGG + Intronic
904371457 1:30050093-30050115 ATCATCTCACAGATGAACCACGG + Intergenic
906347424 1:45027064-45027086 CTCATATCATAAATGAAAGAGGG - Intronic
907618727 1:55953341-55953363 CTTCTCTCAGAGATGAAGTAAGG + Intergenic
907664173 1:56419551-56419573 TTCGTCTCAAAAAGGAAGGAAGG - Intergenic
907774040 1:57495418-57495440 TTCATTTCAAAGATGAATTACGG + Intronic
908439348 1:64137962-64137984 CTCATTTCACAGATGAAGAAGGG - Intronic
908654608 1:66374769-66374791 CCCAGCTCAATGATGCAGGAAGG + Intergenic
908678500 1:66632797-66632819 CTCCTCTCAAAAATGAACCAAGG + Intronic
909057420 1:70838090-70838112 CTCAACTCCTAGATGAAGGGGGG - Intergenic
910108487 1:83656841-83656863 CCCATGTCCCAGATGAAGGATGG + Intergenic
910550744 1:88471352-88471374 CCCATTTTAAAGATGGAGGAAGG - Intergenic
913012917 1:114702201-114702223 ATTATTTCAAAGGTGAAGGACGG - Intergenic
913168180 1:116208735-116208757 CTCATATGGAAGAAGAAGGAAGG + Intergenic
913568881 1:120100788-120100810 TTCATCTCAAAGAGGAAGTTGGG - Intergenic
914289690 1:146261779-146261801 TTCATCTCAAAGAGGAAGTTGGG - Intergenic
914550734 1:148712562-148712584 TTCATCTCAAAGAGGAAGTTGGG - Intergenic
915461151 1:156071273-156071295 CTGATCCCAAAGAAGAAGGATGG + Intergenic
915992676 1:160532400-160532422 CTCACCTCCCAGATGAAGGGCGG - Intergenic
916346956 1:163803647-163803669 GTTTTCTGAAAGATGAAGGATGG + Intergenic
922221351 1:223610787-223610809 CTCAGCTCAAAGTTACAGGATGG + Intronic
922562943 1:226582190-226582212 GTCATCCCAATGGTGAAGGATGG - Intronic
922909350 1:229202723-229202745 CTCATGTCAACCATGTAGGATGG + Intergenic
923724029 1:236490981-236491003 CTCATCTAAAAGAGAAAGGAAGG - Intergenic
923833006 1:237578821-237578843 CTTATCCCAAAGATGCAGGCAGG - Intronic
923885655 1:238152352-238152374 CTAATCTCAGAAATGCAGGAAGG + Intergenic
924735736 1:246754058-246754080 CACATCTCTAAGATGAGAGATGG - Intronic
924931680 1:248737863-248737885 CTCTTCTCCAAGAGTAAGGAAGG - Intronic
1063237929 10:4137865-4137887 CTCATCTCAAGTGTGAAAGACGG + Intergenic
1064174356 10:13061392-13061414 CTCATCTCAAAGGTGATGGCTGG + Intronic
1064727555 10:18296928-18296950 CTCATTTTACAGATGAATGACGG - Intronic
1065060403 10:21895232-21895254 ATCATCTCTAAGATGACTGAGGG - Intronic
1065289585 10:24216215-24216237 CTCATTTCAAAGAAGAAAGAGGG + Intronic
1065716626 10:28575586-28575608 CGCATATCAAAGATGAACAATGG - Intronic
1066544916 10:36489408-36489430 CTTATTTAAAAGAGGAAGGAAGG - Intergenic
1066993730 10:42542629-42542651 CTTATCTCATTCATGAAGGAAGG - Intergenic
1069154351 10:65007450-65007472 CTAATATCAAAAATGAAAGAGGG - Intergenic
1069647514 10:70013622-70013644 CTAATATCAGAAATGAAGGATGG + Intergenic
1069674593 10:70238744-70238766 CTCACCTCCCAGATGAAGGGCGG + Intergenic
1070539128 10:77403553-77403575 CTCCTCTCCAAGATGATGGAGGG + Intronic
1070616866 10:77975965-77975987 CTCAATTCAAAGATAAAGGGGGG + Exonic
1070637065 10:78137562-78137584 CTCATCCCAAAGATGGCGGCTGG + Intergenic
1070896533 10:79987223-79987245 CAAATGTCAAAGATGAAGAAAGG + Intergenic
1071262866 10:83936763-83936785 CTCATTACACAGATGAGGGAAGG + Intergenic
1071759554 10:88585214-88585236 ATCATCTCAACGGTGAAGCAAGG + Intergenic
1073417713 10:103398002-103398024 ATGATCACAAAGATGTAGGAAGG - Intronic
1073786403 10:106895079-106895101 CTCATCTGACAGATGAAGTAGGG - Intronic
1075605430 10:123802027-123802049 AGCATCTCACAGATGGAGGAAGG + Intronic
1075919547 10:126198959-126198981 CTGATATCAAAGAGTAAGGAAGG + Intronic
1076189057 10:128470140-128470162 CTCCTCTGTAAGGTGAAGGATGG - Intergenic
1076329198 10:129652534-129652556 CTGATCACAAAGTTGAAGGTGGG + Intronic
1077544662 11:3164277-3164299 CTCAGCCCAAGGATGAGGGAGGG + Intronic
1078594704 11:12675360-12675382 TTCTTCTCAAAGATGAAAAAGGG + Intronic
1079470399 11:20772676-20772698 GGCAACTCAAGGATGAAGGAAGG + Intronic
1080075781 11:28147169-28147191 CCCATCTCAGAGATGCTGGAAGG - Intronic
1082126932 11:48444070-48444092 TTCATATCAATGATGAAGCAAGG - Intergenic
1082560511 11:54615048-54615070 TTCATATCAATGATGAAGCAAGG - Intergenic
1083088562 11:60176146-60176168 CACCTCTCAAAGATGAGTGAGGG + Intronic
1083103764 11:60337173-60337195 CACCTCTCAAAGATGAGTGAGGG - Intronic
1084340506 11:68496345-68496367 CCCGTCTCAAAAAGGAAGGAGGG - Intronic
1084942181 11:72618701-72618723 CTCATCTGAAAAATGGAGGTGGG - Intronic
1085449397 11:76622888-76622910 GTTATCTCAAAGATGAAGGGAGG - Intergenic
1085543002 11:77289723-77289745 TCCATCTCAAAAAAGAAGGAAGG + Intronic
1087701075 11:101436987-101437009 CTCTTCTCTAAGATGCAAGATGG + Intergenic
1088343937 11:108801349-108801371 CTTATCTCAAGCATTAAGGAGGG - Intronic
1088792936 11:113242106-113242128 CTTACCTCTAAGGTGAAGGATGG + Intronic
1092837383 12:12503537-12503559 CGCAGCTCAAAGGTGGAGGAAGG - Intronic
1094087049 12:26605346-26605368 CTGATCACAAAGGTGAAGGCTGG + Intronic
1094504570 12:31050785-31050807 CTCATGACACAGATGAAGAAAGG - Intergenic
1095474279 12:42569799-42569821 CTCATCTTAAACATGAAGACTGG - Intronic
1096844904 12:54401097-54401119 CCTATCTCAGAGATGAAGCAGGG + Intronic
1097545262 12:60991775-60991797 CTCATTTTAAAGCTGAAGAAGGG + Intergenic
1097791939 12:63824517-63824539 CCCATCTCAAAAAAGAAGGAAGG + Intergenic
1098364099 12:69684263-69684285 CTGATTAGAAAGATGAAGGAGGG - Intronic
1102600361 12:114025110-114025132 CTCATCTCAAAGGTGTGGAAAGG - Intergenic
1102705954 12:114880626-114880648 CCCATCTTACAGATGAAGAAAGG + Intergenic
1102887124 12:116530603-116530625 CTCATCTAAAAGATGGAGCTAGG + Intergenic
1105903953 13:24785115-24785137 CTAAACTCAAAGCAGAAGGAAGG - Intronic
1106433027 13:29699736-29699758 CTCAGCCCAGAGATGCAGGATGG + Intergenic
1108626965 13:52239267-52239289 CTAATCTCAATGATGAAGATAGG + Intergenic
1108659101 13:52567194-52567216 CTAATCTCAATGATGAAGATAGG - Intergenic
1108682716 13:52793155-52793177 TTCATCTCAAAAAAAAAGGAGGG + Intergenic
1113120913 13:106923136-106923158 GTCATCTCAAAAATGAAGGAGGG + Intergenic
1113889561 13:113728787-113728809 CTCATCCCTATGAAGAAGGAGGG + Intronic
1114780620 14:25534260-25534282 ACCATATCAAAGTTGAAGGAGGG + Intergenic
1114836777 14:26211909-26211931 CTAATCTCAAAGGAAAAGGAAGG + Intergenic
1117207445 14:53458719-53458741 GTCATCTCAGAGATCAAGGGAGG + Intergenic
1119921191 14:78447822-78447844 CCCATTTCACAGATGAAGAAAGG - Intronic
1119967846 14:78936868-78936890 CTCTCATCAAAGATGTAGGATGG + Intronic
1120523761 14:85554016-85554038 CTCATCAAAAATATGAAGCAAGG + Intronic
1121563982 14:94894980-94895002 CTCAACTCATAGATGAGGAAGGG - Intergenic
1121582061 14:95038963-95038985 CTCATCCCAAAGAGGAAGCCTGG + Intergenic
1123022091 14:105404140-105404162 GTCATCTCAAAGCTTGAGGAAGG + Intronic
1124831119 15:33150477-33150499 CTCATTTCAAGGATGATGCATGG - Intronic
1128418510 15:67469274-67469296 CTCATTTCTAAAATAAAGGAGGG + Intronic
1128617540 15:69121826-69121848 TTCATCAAAAAGATGATGGATGG - Intergenic
1130548926 15:84877040-84877062 CTCAGCTCAAATGTGAAGGCCGG - Intergenic
1133601173 16:7341818-7341840 CCCACCTCAAAAAGGAAGGAAGG - Intronic
1133670448 16:8013748-8013770 CTCTTCTCCAAAATGTAGGAGGG + Intergenic
1133900806 16:9972529-9972551 CTCATCACAAAGAAAAAGGTAGG + Intronic
1135109856 16:19682176-19682198 ATAATCCCAAAGATGAAGCAGGG - Intronic
1136419016 16:30120979-30121001 TTCATTTCAAAGATGAGGGGTGG - Intronic
1137816098 16:51398924-51398946 CTCATCTGTAAAATGAGGGATGG - Intergenic
1139092774 16:63668904-63668926 CTGATCTCAAAGATAGAGCAAGG - Intergenic
1141811664 16:86380158-86380180 CCCATCAGAAAGAGGAAGGAGGG + Intergenic
1145910133 17:28537506-28537528 CTCACCTTAAAGGTCAAGGAAGG + Exonic
1147681109 17:42246533-42246555 GTCACATCAAAGATGAAAGAGGG - Intronic
1149011328 17:51859680-51859702 CTCATATAAAAAATGAAGAATGG + Intronic
1150243132 17:63651896-63651918 GGCATCTCAAAGATGAACGATGG + Intronic
1150333015 17:64309540-64309562 CTCATTTCATTGATGAAGAAAGG + Intergenic
1150804930 17:68311236-68311258 CCCATCACACAGATGAAGGGAGG - Intronic
1152881918 17:82822465-82822487 AGCATCTCAAAGAGGAACGAAGG + Intronic
1154135364 18:11773100-11773122 CTCATCTCAGAGGTCAGGGAAGG - Intronic
1155872917 18:31049442-31049464 CTCATCTCAAGGCTGGATGAGGG + Intergenic
1155982959 18:32199707-32199729 CTCGTCTCAAAAAAGAAAGAAGG - Intronic
1158325643 18:56311535-56311557 CCCATTTCACAGATGAAGAAAGG + Intergenic
1159480949 18:68990324-68990346 CCCATCTCCAAGATGAATAATGG - Intronic
1160302451 18:77695839-77695861 TCCATCTTCAAGATGAAGGAAGG - Intergenic
1161042968 19:2119985-2120007 CTCATCTCCAGGATGCAGGCTGG + Intronic
1164016616 19:21260363-21260385 CTCACCTCCCAGATGAAGGGCGG + Intronic
1165093559 19:33398662-33398684 CTCATCCCCAGAATGAAGGAAGG + Intronic
1167270661 19:48503870-48503892 TCCCTCTCAAAGAGGAAGGAAGG - Intronic
1167278012 19:48550487-48550509 CTCACCTAACAGATGCAGGAAGG - Intergenic
1167639753 19:50674335-50674357 CTGGTCTCAAAGATGGAGAAGGG - Intronic
1167992262 19:53370511-53370533 CTCATCTCCAAGTTGCAGGGAGG - Intronic
1168000927 19:53445512-53445534 CTCATCTCCAAGTTGCAGGGAGG - Intronic
1168008344 19:53509219-53509241 CGCAGCTCACAGAGGAAGGAGGG - Intergenic
925834766 2:7933733-7933755 CTCCACTCAAACGTGAAGGAAGG + Intergenic
927259508 2:21072785-21072807 CTCCTCACAAGGAAGAAGGATGG + Intergenic
928592760 2:32834298-32834320 ATCATCTCAAAGATAATAGATGG + Intergenic
928943276 2:36749579-36749601 CACATCTTAAAGGTGAAGGTAGG + Intronic
929111269 2:38407153-38407175 CTTATCTCAAGGTTAAAGGAAGG + Intergenic
930491889 2:52084144-52084166 ATCATCTCAAAGTAGAAGTAAGG - Intergenic
931040546 2:58293761-58293783 TTCATCCCCAAGATAAAGGATGG + Intergenic
932378141 2:71256387-71256409 CATATCTCAAAGAGCAAGGATGG + Intergenic
932606621 2:73169805-73169827 ATCATCTCTAGGCTGAAGGATGG + Intergenic
932634366 2:73375208-73375230 GTCATCCCAAAGAGGATGGACGG - Intergenic
933295933 2:80491449-80491471 GTCATCTGAAAAATGAAGGTAGG + Intronic
933601213 2:84332723-84332745 TTCATTTAAAAGAAGAAGGAAGG + Intergenic
933925804 2:87090630-87090652 ATCATCTCTAGGCTGAAGGATGG - Intergenic
935431702 2:102983033-102983055 CTCATGTGACAGATTAAGGATGG + Intergenic
935657172 2:105433475-105433497 CTCATCTTAAAAATGAAGCCGGG - Intronic
936540113 2:113342825-113342847 CACATTACAAAGAGGAAGGACGG - Intergenic
936677638 2:114733667-114733689 GTCATCTAAAACATAAAGGAAGG - Intronic
937845153 2:126571541-126571563 CTCATTTTACAGATGAAGCACGG + Intergenic
937990063 2:127657233-127657255 CACATCTCACAGGTGAAGGATGG + Intronic
939008967 2:136822534-136822556 CCCATTTTACAGATGAAGGAAGG + Intronic
939692503 2:145282348-145282370 CTAATATCAAAAATGAAAGAGGG + Intergenic
939867082 2:147484585-147484607 CTCATCTATAAGATGCAGGTGGG + Intergenic
939884757 2:147669441-147669463 CTAATATGAAAGATGAAGGCTGG - Intergenic
940164988 2:150761198-150761220 CTCCTCTCACAAATAAAGGAAGG + Intergenic
942833633 2:180266038-180266060 CTGATTTCTAAGAAGAAGGAGGG + Intergenic
945985678 2:216351761-216351783 CTCATCTCAAAGATGAAGGAAGG + Intronic
946049935 2:216854163-216854185 CTTTTCTAAAAGTTGAAGGAAGG - Intergenic
946252465 2:218421901-218421923 CTCAGCTCATAGATGAAGAAGGG + Intronic
948013713 2:234671022-234671044 CTCAGCTCTGAGATGAAGGCAGG + Intergenic
948243250 2:236456268-236456290 CTCATCTTAAAAATGAGGTAGGG - Intronic
948686411 2:239672722-239672744 GTCTTCCCAAAGATGAATGAAGG + Intergenic
1172108341 20:32529887-32529909 CTCATCTCATAAATGAAGCTCGG - Intronic
1173554282 20:43954533-43954555 CTCTGCGGAAAGATGAAGGATGG + Intronic
1173564063 20:44026822-44026844 CTCACCCCACAGAAGAAGGAAGG - Intronic
1175478735 20:59296363-59296385 CCTATCTCAAAGATGATGTATGG + Intergenic
1176006408 20:62866014-62866036 CTCATTTTAAAGAGAAAGGATGG + Intergenic
1176697705 21:10000699-10000721 CTCATTTCAAAAATGGAGGAAGG - Intergenic
1176797265 21:13379672-13379694 CTCACCTCCAAGATGATGGGCGG - Intergenic
1178787254 21:35665058-35665080 CTCATCTCAAACATTCAGCAGGG + Intronic
1179236155 21:39548211-39548233 CTCAGCTACAACATGAAGGATGG - Intergenic
1179441658 21:41399086-41399108 CTCATCTCATGGGTGAAGAAGGG - Intronic
1179636323 21:42712860-42712882 CTCATCCCATAGATGCAGAAAGG - Intronic
1181869256 22:25885236-25885258 CCCATCTCACAGATGAGGCAAGG + Intronic
1183759744 22:39805270-39805292 TTCACCTCACAGCTGAAGGATGG + Intronic
1183992312 22:41605884-41605906 CACAACTCAAATCTGAAGGATGG + Intronic
1184878617 22:47291130-47291152 CTCAAATGAAAGATGAAGGCTGG + Intergenic
949710360 3:6863640-6863662 TTAAGCTCAAAGATGAAGGAAGG - Intronic
953494909 3:43377621-43377643 CTCAGATCAAAGATGAGGGCTGG - Intronic
953759249 3:45673909-45673931 CTTATCTCAAAGGTGAAGTGGGG - Intronic
954295112 3:49670150-49670172 CTCATCCCAAAGATCAGGTATGG + Exonic
954789882 3:53124365-53124387 CTCCTCGCTAAGATGCAGGAAGG - Intronic
955405887 3:58625469-58625491 CTGATGTCAAAGGTGAAGCAGGG - Intronic
956710624 3:72035613-72035635 CTGATTGCACAGATGAAGGAAGG - Intergenic
956821095 3:72954918-72954940 CTCAAGTCAAAGGAGAAGGAAGG + Intronic
957300020 3:78380046-78380068 CTCATCTTGAGGGTGAAGGAAGG - Intergenic
958253613 3:91299025-91299047 CTCATCTGAAAGCTCAAGCAGGG - Intergenic
958825664 3:99027012-99027034 CTCATACCAAAAAGGAAGGAGGG + Intergenic
958844522 3:99249995-99250017 CACTTCTCAAAGATTCAGGAGGG + Intergenic
959053286 3:101544812-101544834 CTGATCTCAAAGCTTAAGGATGG + Intergenic
960295309 3:115935684-115935706 CTCATCTCAGAGTGGCAGGATGG + Intronic
961335427 3:126175037-126175059 CTAATATCAAAAATGAAAGAAGG + Intronic
962906412 3:139807349-139807371 CTCTTCCCAAAGAAGTAGGAAGG + Intergenic
963224886 3:142852224-142852246 CTCATATAAAAAATGAAGAACGG - Intronic
964526031 3:157616077-157616099 CCCATCCCAAAGAAGAAGAAAGG - Intronic
964815112 3:160709194-160709216 CTCAACTCATTGATGAATGAAGG + Intergenic
965631022 3:170732848-170732870 CTTATCTCCAAGATGGAGAAAGG - Intronic
966779027 3:183567661-183567683 TTCATCTCCAGGATGAAGGGGGG - Intergenic
966959270 3:184917432-184917454 TCCGTCTCAAAAATGAAGGAAGG - Intronic
967616029 3:191567756-191567778 TTCATTTTAAAGATGAAGAAAGG - Intergenic
967816304 3:193801420-193801442 CTTATTTCAAGGATGAAAGAAGG - Intergenic
968215269 3:196883999-196884021 CTCATGTGTAAAATGAAGGACGG + Intronic
968359276 3:198135935-198135957 TTCATGTGACAGATGAAGGAAGG - Intergenic
969119346 4:4896312-4896334 CTCGTTTTGAAGATGAAGGAAGG + Intergenic
970084054 4:12325412-12325434 TTCATCTCAGAGATGAACAAAGG + Intergenic
970703991 4:18777936-18777958 CCCATCTCAGGGATCAAGGAGGG + Intergenic
971308512 4:25504666-25504688 CTCATCTAAAAAATGAAGAGAGG - Intergenic
972186668 4:36536649-36536671 CCCATATCACAAATGAAGGAGGG - Intergenic
972419823 4:38876851-38876873 CGCACTTCAAAGATAAAGGAAGG - Intronic
972704064 4:41523933-41523955 CTCTTCTCAAAGAGCAAGTAGGG + Intronic
972997844 4:44904732-44904754 CTAATCTCAAAGCTAACGGAAGG - Intergenic
973021395 4:45208318-45208340 CTCACCTCCCAGATGAAGGGCGG - Intergenic
974105049 4:57460459-57460481 CTCATCTGAAAGCTCAATGAGGG - Intergenic
974848739 4:67381280-67381302 CTCACCTCCCAGATGAAGGGTGG - Intergenic
976802935 4:89013220-89013242 TTCATCTGAAATATGAAAGAAGG + Intronic
978843759 4:113247617-113247639 CTTGTTTGAAAGATGAAGGAGGG - Intronic
979173322 4:117629268-117629290 CTCATTTCAATGATGAAAAAAGG - Intergenic
981960408 4:150530768-150530790 CTCATCTAAAAGAACAAGAAAGG - Intronic
982663358 4:158231252-158231274 CTCTTCTCAAAGATGAGTTATGG - Intronic
982846027 4:160253386-160253408 CTAATTTTAAAGATGAGGGAGGG - Intergenic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
984183840 4:176518157-176518179 CTCATCTCACTGATGAGAGAGGG - Intergenic
987381379 5:17289031-17289053 ATCATCCCAAGGATGAAGGGCGG - Intergenic
988602395 5:32652000-32652022 TTCATTTCACAGATGAAAGAGGG - Intergenic
988999119 5:36742842-36742864 CTGACTTCAAAGATGGAGGAAGG + Intergenic
989536756 5:42573107-42573129 CTCATCAGAATGCTGAAGGATGG - Intronic
990142146 5:52718071-52718093 CTAATATCAAAAATGAAAGAGGG - Intergenic
990620668 5:57555457-57555479 TGCATCTTGAAGATGAAGGAAGG - Intergenic
992008298 5:72501058-72501080 CTCATCTTAGAGCTGAAGAAAGG - Intronic
993202668 5:84836627-84836649 CACATATCAAAAATGAAGCATGG - Intergenic
993278940 5:85899508-85899530 TTCATCTCTAAAATGAAGGCAGG + Intergenic
994840017 5:104911367-104911389 TTCCTCTCAAACATGAAGCAGGG + Intergenic
995762613 5:115579335-115579357 TTCATTTCACAGATAAAGGAGGG + Exonic
996410642 5:123155327-123155349 CTCACCTCAAAGAAGATGTAGGG - Intronic
996753793 5:126915466-126915488 CTCTTCTTGATGATGAAGGATGG - Intronic
998202650 5:140137499-140137521 CTCATCTCAGAGATGGGGGCAGG + Intergenic
998465822 5:142342873-142342895 CTCATCTCAAAATAGAAGAAAGG - Intergenic
998478846 5:142444645-142444667 CTCAACTAAAAAGTGAAGGAGGG + Intergenic
999004030 5:147956148-147956170 CTGATCTCAAAGACAAAGAATGG - Intergenic
999388253 5:151171045-151171067 TTTATCTCAAAGATGAGGGCTGG + Intergenic
999634159 5:153602735-153602757 CACATCTCTACGATGGAGGAAGG + Intronic
1000234361 5:159343992-159344014 CTCATCACAAAGATGATGTAAGG - Intergenic
1001220273 5:169894662-169894684 CTCATCTCAGAAATGAAGAGTGG - Intronic
1002323267 5:178388344-178388366 CTCTTCTCAAAGGTGAAGAAAGG + Intronic
1002347835 5:178560375-178560397 CCCATTTCAAAGATGGAGAAAGG - Intronic
1003217622 6:4129121-4129143 TCCATCTCAAAAAAGAAGGAAGG - Intronic
1003250353 6:4423974-4423996 CTCATATCAGAAATGAAAGAGGG + Intergenic
1003349614 6:5303651-5303673 ATAATCACAAAGATGGAGGAAGG - Intronic
1003888216 6:10540070-10540092 CCCATCTCAAAAAAAAAGGAAGG + Intronic
1004031134 6:11870584-11870606 ATCATCTCCAAGGTGAAGGCAGG - Intergenic
1004314665 6:14575402-14575424 CACATTTCACAGATGAAGAAAGG + Intergenic
1004994415 6:21174940-21174962 CTCATCTGAAAAATAAAGTAGGG + Intronic
1006435651 6:34024886-34024908 GTCATTTCAGAGATGAAGGTGGG - Intronic
1006531536 6:34659321-34659343 CTCATCTATAAAATGAAGGTTGG - Intronic
1006946109 6:37785443-37785465 CTCACCTCCAAAATGAAGCAGGG - Intergenic
1009190861 6:60628003-60628025 CTCATCTGAAAGCTCAAGCAAGG + Intergenic
1009869079 6:69432993-69433015 CCCATCTCCCAGATGAAGGGTGG + Intergenic
1009976704 6:70678761-70678783 CTAGTTTCAAAGATGGAGGAAGG - Intronic
1010083342 6:71887710-71887732 TTCATCTCACAGATCAAGGTTGG + Intronic
1010106388 6:72174117-72174139 CTCAAATCACAGATGGAGGAGGG - Intronic
1010953926 6:82069156-82069178 CTCATGAGAAAGATGAACGAGGG + Intergenic
1012510443 6:99994924-99994946 CTCATCTTATAGATGAAGGAAGG - Intergenic
1013047538 6:106502258-106502280 TTCATGTCAAAGATCAAGAATGG - Intergenic
1013204325 6:107933135-107933157 CCCTTTTTAAAGATGAAGGAAGG + Intronic
1014269701 6:119322824-119322846 ATCATTTCAAAGTAGAAGGAAGG + Intronic
1016597670 6:145819626-145819648 CTCATCTAAGAGATGAGAGAAGG - Intergenic
1017855668 6:158348932-158348954 CTCACCTCCCAGATGAAGGGCGG + Intronic
1017969022 6:159294204-159294226 CTCATGTCAGAAATTAAGGAGGG - Intergenic
1020772556 7:12413392-12413414 CTGGTTTTAAAGATGAAGGAAGG - Intergenic
1021338319 7:19432065-19432087 CTCATATCAAAAATAAAAGAGGG + Intergenic
1021679536 7:23116039-23116061 CTCCTCTCAAAAATGAGAGAAGG - Intronic
1022040681 7:26578641-26578663 CTCATCTGGAAGATGAAAGCAGG - Intergenic
1022080121 7:27012217-27012239 CTCATCTAAAAGTTGCAGAAAGG - Intergenic
1024371112 7:48585001-48585023 CTCATATGAGAGATGAAGGAAGG - Intronic
1024581572 7:50805101-50805123 CCCATCTCACAGATGAGGAAAGG - Intergenic
1025228859 7:57185703-57185725 CTATTCTCAGAAATGAAGGAAGG - Intergenic
1026099319 7:67371656-67371678 CTCAACTGAAAAACGAAGGAAGG - Intergenic
1026155973 7:67826113-67826135 CACATGTCAAAGGTGGAGGATGG + Intergenic
1026185835 7:68082146-68082168 CTCACCTCCCAGATGAAGGGCGG - Intergenic
1026185885 7:68082330-68082352 CTCACCTCCCAGATGAAGGGCGG - Intergenic
1026185906 7:68082406-68082428 CTCACCTCCCAGATGAAGGGTGG - Intergenic
1026898203 7:74022608-74022630 CTCATCTCAAAGATGACTTTCGG - Intergenic
1028027368 7:85862397-85862419 CTCATATCAGAAATGAAAGAAGG + Intergenic
1028310766 7:89332116-89332138 TTCATCTCAAAGATAAATAAAGG + Intronic
1028632299 7:92948143-92948165 CTAATCTCAGAGATTAAAGAAGG - Intergenic
1028879323 7:95861847-95861869 TAAATCTCACAGATGAAGGATGG - Intronic
1029722434 7:102377873-102377895 TCCATCTCAAAAAGGAAGGAAGG - Intronic
1030975371 7:116115481-116115503 CACACTTCAAAGATGGAGGAAGG - Intronic
1034863040 7:154616433-154616455 TTCAACTCAAAAATAAAGGAGGG - Intronic
1034942556 7:155240383-155240405 CTCCTGTAAAAGATGAAGAATGG + Intergenic
1035262879 7:157673059-157673081 TTCATCTCAAAAAAAAAGGATGG - Intronic
1035955721 8:4077099-4077121 CTCATCACTAAAATGAAGTAGGG - Intronic
1037089255 8:14893229-14893251 CTCATTTTAAAGATGGAGGAAGG + Intronic
1037878588 8:22561616-22561638 CTCATCTTATAGATGAGGAAAGG - Intronic
1038105247 8:24426344-24426366 CTCATCTTTAAAATGGAGGATGG - Intergenic
1039487655 8:37924255-37924277 CTCACCTGAATGATGAAGGCAGG - Intergenic
1039915974 8:41860584-41860606 CTCATCTGAAAAATGGGGGAAGG + Intronic
1039956653 8:42212586-42212608 GTTTTCTCAAAGATGAAGAAAGG + Intergenic
1040526632 8:48231357-48231379 CTCAACTCAAAAATGAAACAAGG - Intergenic
1040916856 8:52573149-52573171 CTCACCTCCCAGATGAAGGGCGG + Intergenic
1041599358 8:59697883-59697905 CTCATGTCAAAGAAGAAAAAAGG - Intergenic
1042745156 8:72099218-72099240 GTTATCTCAGAGATGAATGAAGG + Intronic
1043089556 8:75880904-75880926 GTCATCTCCAAGAATAAGGAAGG + Intergenic
1044226214 8:89721728-89721750 CTCCTCTGAAACATGACGGATGG - Intergenic
1044378771 8:91507010-91507032 CTCTTTTGAAAGATGGAGGAGGG - Intergenic
1046813855 8:118562484-118562506 AGCATCTCATAGACGAAGGAAGG + Intronic
1046878899 8:119286553-119286575 ATTATCTCAAAGATGCAGAAAGG - Intergenic
1046881235 8:119310676-119310698 ATTATCTCAAAGATGCAGAAAGG + Intergenic
1047222615 8:122930796-122930818 ACCATCTAAAAGATGGAGGACGG + Intronic
1048682625 8:136861422-136861444 CTAATATCAGAAATGAAGGAGGG - Intergenic
1049168864 8:141145311-141145333 GGCATCTCAAAGAGGAAGGAGGG - Intronic
1051156102 9:14147972-14147994 CTCATCTCAATGAATAAGAAAGG + Intronic
1051462832 9:17342741-17342763 CTCATTCCAAAAATGAAGCACGG - Intronic
1053269207 9:36738795-36738817 CTCATCTCTAAGGAGCAGGAAGG - Intergenic
1053349339 9:37402594-37402616 CCCATCTCAAAAAAGAAGAAAGG + Intergenic
1053634831 9:39987063-39987085 CTCATTTTAAAAATGGAGGAAGG - Intergenic
1053771095 9:41477271-41477293 CTCATTTTAAAAATGGAGGAAGG + Intergenic
1054209056 9:62263634-62263656 CTCATTTTAAAAATGGAGGAAGG + Intergenic
1054315756 9:63584505-63584527 CTCATTTTAAAAATGGAGGAAGG - Intergenic
1054549829 9:66389076-66389098 CTCATTTTAAAAATGGAGGAAGG + Intergenic
1054950992 9:70851725-70851747 CCCATCTTACAGATGAAGAAAGG + Intronic
1055072050 9:72176395-72176417 CCCACCTCAAGGGTGAAGGAGGG + Intronic
1056637263 9:88341632-88341654 CACTTCTCAAAAATGAAAGAGGG - Intergenic
1057052829 9:91938614-91938636 TTCATCTCAAAAAGGAAGAAGGG + Intronic
1058502317 9:105633345-105633367 CTCATCAAAAAGCTGAAAGAGGG - Intronic
1058551190 9:106116662-106116684 CCCATTGCACAGATGAAGGATGG + Intergenic
1058587261 9:106522893-106522915 CTATTCTAAAAGATGGAGGAGGG + Intergenic
1059024728 9:110614273-110614295 CTCATATTAAAAAAGAAGGAAGG + Intergenic
1059765506 9:117380191-117380213 CTCAACTCTAAGCTCAAGGAAGG - Intronic
1059820150 9:117963633-117963655 CTCTTTTCATAGCTGAAGGAGGG - Intergenic
1060341078 9:122777734-122777756 CACATCTCAAAGATGCACAAGGG + Intergenic
1060682991 9:125582273-125582295 CTCACCAAACAGATGAAGGAAGG - Intronic
1061322579 9:129840326-129840348 CTCATCTCACAGAGGAGGAATGG - Intronic
1061403634 9:130382058-130382080 CTCATTTCACAGATGAGGCAGGG + Intronic
1061502675 9:131012907-131012929 CTCAGCTCAGAGATGACGGGAGG - Intronic
1062118877 9:134823243-134823265 CTCATCTCAAGGATCCAGGAGGG + Intronic
1062721678 9:138047501-138047523 CCCATCTCAATCATGAGGGAGGG - Intronic
1062743964 9:138199654-138199676 TTCATGTGACAGATGAAGGAAGG - Intergenic
1185798991 X:2992535-2992557 CTGTTCTCAATGACGAAGGATGG - Intergenic
1185864307 X:3609460-3609482 CTCATCTCAAAAATGAAAACAGG - Intronic
1186832252 X:13402710-13402732 CTCAGCTCAGAGAGGAAGAAAGG + Intergenic
1187261251 X:17687033-17687055 CTCATCCAAGAGATCAAGGAAGG - Intronic
1189131802 X:38506635-38506657 CTAAGTTCAAACATGAAGGATGG - Intronic
1189268429 X:39733858-39733880 CTCTCCTCAAAGATCAGGGATGG + Intergenic
1190767877 X:53490475-53490497 CTCATGTGAAAGATAAAGAATGG - Intergenic
1192585587 X:72316011-72316033 CACATCTTACAGATGAAGGGAGG + Intergenic
1192764051 X:74124753-74124775 CCTTTCCCAAAGATGAAGGATGG + Intergenic
1193723906 X:85018472-85018494 GTCATCTCAAATTTGAAGGTGGG - Intronic
1194762960 X:97816136-97816158 CTCAGCTCAAAGAAGATTGAAGG + Intergenic
1195106124 X:101603046-101603068 CTACTCTCAAAGAGGAGGGAAGG + Intergenic
1195954016 X:110309713-110309735 CTTTGCTCAATGATGAAGGATGG - Intronic
1196117506 X:112013514-112013536 CTCAGCTATAAGATGAGGGAGGG - Intronic
1196230744 X:113218028-113218050 ACCATATCAAAGATGAAGGCTGG + Intergenic
1199811561 X:151354915-151354937 CTCATCTCTAAAGTGAAGAATGG + Intergenic
1199822628 X:151464271-151464293 CTCATCTTATAGATAAGGGAGGG - Intergenic
1201420224 Y:13790156-13790178 CTCATGTCAAATTGGAAGGATGG + Intergenic
1201945289 Y:19504112-19504134 GTGATCTCAAAGATGATGGGGGG - Intergenic