ID: 945986089

View in Genome Browser
Species Human (GRCh38)
Location 2:216354743-216354765
Sequence TTCACCAGTCTTGCTCAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945986089_945986093 -1 Left 945986089 2:216354743-216354765 CCTCATTGAGCAAGACTGGTGAA 0: 1
1: 0
2: 0
3: 11
4: 131
Right 945986093 2:216354765-216354787 ATACCTGGTGGGACTCACTCAGG 0: 1
1: 0
2: 1
3: 6
4: 84
945986089_945986095 21 Left 945986089 2:216354743-216354765 CCTCATTGAGCAAGACTGGTGAA 0: 1
1: 0
2: 0
3: 11
4: 131
Right 945986095 2:216354787-216354809 GTCCTCTCTGTCTTTGACTCTGG 0: 1
1: 0
2: 4
3: 19
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945986089 Original CRISPR TTCACCAGTCTTGCTCAATG AGG (reversed) Intronic
901948993 1:12726401-12726423 TTCACGAGGCTTTCCCAATGTGG + Exonic
902182253 1:14698233-14698255 TCCACCATTCTGGCTAAATGGGG - Intronic
905325567 1:37149384-37149406 TCCTCCAGCCTTCCTCAATGTGG - Intergenic
907236192 1:53050335-53050357 TTCACCTGTCCTCCTCAAAGTGG - Intronic
911591449 1:99752847-99752869 GCCAACAGACTTGCTCAATGAGG + Intronic
911652214 1:100402559-100402581 TTCACCAGTCTTGCAAAAGTGGG - Intronic
915938037 1:160100200-160100222 TTCTCCAGGGTTCCTCAATGTGG - Intergenic
917270940 1:173273051-173273073 ATCATCAGTCTTCCTCAATTAGG + Intergenic
922065847 1:222141820-222141842 TTCACCACTGTTGCTCAATATGG + Intergenic
924603211 1:245509724-245509746 TTCACCTGTGTTTCTCCATGTGG - Intronic
1063343006 10:5285989-5286011 TTCACCAGCCTTGCTCTTGGGGG + Intergenic
1063986129 10:11504878-11504900 TTTACCACTCTGGCTCACTGGGG - Intronic
1065794852 10:29296775-29296797 TTGACCAGTCTTGTTCACTGGGG - Intronic
1065874139 10:29982706-29982728 ATGGCCTGTCTTGCTCAATGAGG + Intergenic
1066594022 10:37028872-37028894 TTCAAAAGACTTGCTGAATGAGG + Intergenic
1068046489 10:51892790-51892812 TTCAACAGTGTTTCTCCATGGGG - Intronic
1074472132 10:113736965-113736987 TTTTCCAGACTTGCTCAATTTGG - Intergenic
1077507837 11:2940365-2940387 TGCACCCGCCTTGCTCAGTGAGG + Intergenic
1078041716 11:7870232-7870254 TTCACCAATCTGCCTCCATGTGG + Intergenic
1078730822 11:13972328-13972350 TTCACCAGTCTAGGTTAAAGAGG - Intronic
1079532469 11:21471219-21471241 TTCAGCAGTCTTTCTCTATTTGG + Intronic
1080594846 11:33762861-33762883 TTCATCAATCTTGCTAGATGGGG - Intronic
1085894289 11:80619433-80619455 TTCAAAAGACTTGCTGAATGAGG - Intergenic
1086881233 11:92156041-92156063 GTCAACAGTCCTGCACAATGGGG - Intergenic
1087699467 11:101419252-101419274 TTCACCACTCTTATTCAATGTGG - Intergenic
1088013396 11:105031055-105031077 TTCTCCAGAACTGCTCAATGAGG + Intronic
1089102627 11:115976418-115976440 TTCACCAGGGTTGCTCTTTGTGG + Intergenic
1089898120 11:121952784-121952806 TTGACAACTCTTGGTCAATGTGG + Intergenic
1098846716 12:75546116-75546138 TTCCCTAGTTTTGCTTAATGTGG - Intergenic
1099689458 12:85933977-85933999 ATCACCACTCTTGCTCTTTGGGG + Intergenic
1100698278 12:97119167-97119189 TTCAACAGTCTTGGTAAAGGGGG - Intergenic
1101611160 12:106293320-106293342 TTCACCATTCTTGCCAAATGAGG - Intronic
1104023896 12:125012334-125012356 TTCACCAGTTTTTCTCAGTTAGG + Intronic
1105760603 13:23510733-23510755 TCCAGAAGTCTTGCTCAATCGGG + Intergenic
1107802028 13:44117216-44117238 TAAACCAGGCTTGCTCAAAGTGG + Intergenic
1107805315 13:44148321-44148343 TACACCAGCCTTGCTGATTGAGG + Intronic
1111075094 13:83224264-83224286 CTCACCAGTCTTTGTCAGTGTGG + Intergenic
1112080410 13:95963502-95963524 TTCACCACTCCTATTCAATGTGG + Intronic
1112794712 13:103044224-103044246 CTCACCTGTCTTGCTCAACAGGG + Exonic
1113159057 13:107358554-107358576 TTAACCCGTCTTACACAATGAGG - Intronic
1114252985 14:20977524-20977546 TGCAACAGCCTTCCTCAATGAGG + Intergenic
1115154076 14:30318479-30318501 TTCAGCAGTTTTCCTCCATGGGG - Intergenic
1121406429 14:93721947-93721969 TTCTGCAGTCTTCCTCAGTGTGG + Intronic
1123180366 14:106463758-106463780 TTCACCACTCTTAATCAATATGG + Intergenic
1131492796 15:92877415-92877437 TCCAGCAGTCTTGCTCCATCTGG - Intergenic
1139916598 16:70432143-70432165 TTTACCAATCATGCTAAATGGGG - Intronic
1144336842 17:14279032-14279054 TTCTCCAGAATTACTCAATGGGG + Intergenic
1144342073 17:14318271-14318293 TTCACCAGTCCTGCTGAGAGAGG + Intronic
1147768877 17:42854435-42854457 TTCTCCAGTCCTGCTCAGGGTGG - Exonic
1147771680 17:42872392-42872414 TTCTCCAGTCCTGCTCAGGGTGG - Intergenic
1150627769 17:66853247-66853269 TTCACCAGTTTTGGACACTGGGG + Intronic
1152102133 17:78308183-78308205 TTCATCACTCTTGCTGTATGTGG - Intergenic
1158488839 18:57892132-57892154 TTCAGCAGCTTTGCTCATTGAGG + Intergenic
1160310112 18:77781480-77781502 TTCACCATCCCTGCTGAATGTGG + Intergenic
1162882655 19:13671588-13671610 TTCACCACTCTTGAAGAATGAGG - Intergenic
1164690024 19:30203862-30203884 TTCAACAATGTTGCTGAATGTGG + Intergenic
1168611278 19:57802561-57802583 TTCACCACCCTTGCTCACTGTGG + Intronic
925116455 2:1382560-1382582 TTCACCAGTTTTGGTAACTGTGG - Intronic
925854040 2:8112258-8112280 TTCAACGGACTTTCTCAATGTGG - Intergenic
926250230 2:11151502-11151524 TTCCCCTGTCTTGATAAATGGGG - Intergenic
927343263 2:22006969-22006991 TTCATCAGTCTTCTTCAATTAGG + Intergenic
928067414 2:28179586-28179608 TTCACCAGTCCTGGTCAACATGG + Intronic
928184335 2:29095928-29095950 ATCACTAGTCTTGCTCACTCAGG - Intergenic
929315727 2:40476209-40476231 TTCACTTGTCTTTCTCAAAGGGG + Intronic
931096327 2:58944722-58944744 TTCACCAGGTTTGATCAATTGGG + Intergenic
931703726 2:64929092-64929114 TTCAGCAGCCTTGATGAATGTGG + Intergenic
933048188 2:77565735-77565757 TCCAACAGACTTGCTCAATGCGG - Intronic
933374518 2:81462231-81462253 TTTACATGGCTTGCTCAATGTGG - Intergenic
937233203 2:120414069-120414091 TTAATCAGTGTTGCTCAAAGTGG - Intergenic
937622685 2:124007083-124007105 TTCCCCTGTCTTCCTGAATGAGG - Intergenic
940717481 2:157244142-157244164 TTCCCTAGTGTTCCTCAATGGGG + Intergenic
943892370 2:193306536-193306558 TTCACCACTATACCTCAATGGGG + Intergenic
944138185 2:196424006-196424028 ACCAACAGACTTGCTCAATGTGG - Intronic
945174418 2:207028136-207028158 TTCACCACTCTTACTCAACATGG + Intergenic
945204113 2:207313420-207313442 TTCACCACTCATGGTCAATCTGG - Intergenic
945986089 2:216354743-216354765 TTCACCAGTCTTGCTCAATGAGG - Intronic
948936226 2:241166708-241166730 TTCCCTAGGCTTCCTCAATGGGG + Intronic
1169427738 20:5509780-5509802 TCCACCAGTCTTGCTGGGTGAGG - Intergenic
1169961598 20:11166259-11166281 TTCACCAGTGCTTCTCAATGTGG + Intergenic
1170031587 20:11949577-11949599 TTTACCAGAATTCCTCAATGGGG - Intergenic
1173633467 20:44533934-44533956 TTCACCAAATCTGCTCAATGAGG - Intronic
1174692223 20:52517548-52517570 TTCACCAGCTTTCCTCAATGAGG - Intergenic
1177078571 21:16609687-16609709 TTCACCAGTTTTGCACAACTGGG - Intergenic
1177120567 21:17132673-17132695 TGCACCAGTCTTGCTGAGGGAGG - Intergenic
1181508566 22:23378535-23378557 CGCAACAGTCCTGCTCAATGAGG + Intergenic
1183805871 22:40210366-40210388 ATTACCAGGCTTGCTCAGTGAGG - Intronic
954017929 3:47711444-47711466 TCCAACAGTATTTCTCAATGGGG + Intronic
954713862 3:52517525-52517547 GTCCCCAGTCTTGATCAGTGGGG - Intronic
955643586 3:61112606-61112628 TTCACTAGTCCTACTCAATTAGG - Intronic
956202448 3:66720433-66720455 TTCAACAGTCTTGCTGGAGGTGG - Intergenic
958073085 3:88639930-88639952 TTGGCCTGTCTTGCTCATTGGGG + Intergenic
958510247 3:95038104-95038126 CTGAGCATTCTTGCTCAATGGGG - Intergenic
959839500 3:110958465-110958487 GTCACCAGTCTTGCTGAAACAGG + Intergenic
963049862 3:141131854-141131876 TTCAGCAGTTTTAGTCAATGTGG + Intronic
967708241 3:192677276-192677298 TTCACCAGTTATTATCAATGTGG - Intronic
968888721 4:3353949-3353971 TTCCCCAGTCTTTCTCCATAGGG - Intronic
972138471 4:35924413-35924435 ATCACCACTCTTGCTCTTTGAGG + Intergenic
972934729 4:44119404-44119426 TACAACAGTCTTTCTGAATGAGG - Intergenic
979782769 4:124675262-124675284 TTCACCAGTACTGCGTAATGCGG - Intronic
980489558 4:133507124-133507146 TTGACCTGTCTTGCTCAGTTGGG - Intergenic
980880627 4:138706780-138706802 TTCACCTGTGTTGCTCTGTGGGG + Intergenic
981951233 4:150410141-150410163 TTCCCCACTCTTGTTCAGTGGGG + Intronic
986811563 5:11365129-11365151 TTCACTGGTCTTGTTCCATGTGG - Intronic
986823042 5:11489717-11489739 TTCTCCATACTTGCTCACTGAGG + Intronic
988090261 5:26530135-26530157 TTCAAAAGTCTTTCACAATGAGG - Intergenic
990773641 5:59280227-59280249 TTAACCAGTATTGCCTAATGAGG - Intronic
993562564 5:89428982-89429004 TTTACCAGTTTTGAGCAATGTGG - Intergenic
994179267 5:96745892-96745914 TTCATCTGTCTTACTCAACGAGG - Intronic
995834688 5:116388293-116388315 TTGAACAGTCATTCTCAATGGGG - Intronic
997836879 5:137201726-137201748 TTAAGCAGTCTTTCTCAGTGTGG - Intronic
1000933073 5:167275891-167275913 CTCACCAGTCTTGTTCAACATGG - Intergenic
1002028945 5:176414192-176414214 TTCCTCAGTCTGGCTCACTGGGG - Intronic
1011260487 6:85465140-85465162 TTCACCTCTCTTGCCCCATGGGG - Intronic
1012149398 6:95727453-95727475 GTCAGCAAACTTGCTCAATGAGG - Intergenic
1012421744 6:99073139-99073161 TTTACCAGTCTCCCTCAATCTGG + Intergenic
1018540148 6:164870841-164870863 TTCACCTGTTATGCTTAATGAGG + Intergenic
1020381655 7:7554197-7554219 TACTCAAGTCTTGTTCAATGAGG + Intergenic
1021686341 7:23190834-23190856 TTCTCAAGTCTTGCAAAATGGGG - Intronic
1021829883 7:24594950-24594972 TTCAATAGACTTGATCAATGTGG + Intronic
1022627342 7:32051479-32051501 TTCACAAGTCTGGCTCATGGTGG - Intronic
1023326969 7:39070900-39070922 TTGATCTGTCTTGTTCAATGAGG + Intronic
1023751493 7:43377255-43377277 TTTACCCTTCTTGCTCTATGAGG + Intronic
1028632497 7:92950342-92950364 TTCAACTGTCTAGCTCAATTTGG - Intergenic
1034120361 7:148621208-148621230 CTCTCCAGTCTTGTTAAATGTGG + Intergenic
1034121146 7:148628906-148628928 TTCACCAGCCTTGCTGATTTGGG + Intergenic
1034366623 7:150555241-150555263 TTCACCAGTCTTATTCAATATGG + Intergenic
1035461618 7:159042750-159042772 TTCCTCAGTCTAGCTCCATGGGG + Intronic
1036681745 8:10879267-10879289 TTTACAAGTCTTGCACAAGGTGG - Intergenic
1039404949 8:37304478-37304500 TTCCCCAGACTTGCTCAGTGAGG + Intergenic
1039586818 8:38713858-38713880 CCTACCAGTCTTGCTCAATTTGG - Intergenic
1042834665 8:73068719-73068741 TTCAGAACTGTTGCTCAATGGGG - Intronic
1046030753 8:108781064-108781086 TTCAGCAGTGTGGCCCAATGGGG - Intronic
1046079330 8:109352092-109352114 TTTACCAGTCTTCCTGAATCTGG + Intergenic
1046094574 8:109541621-109541643 TCCATCAGTCTTGCTCATTCTGG - Intronic
1048136640 8:131752777-131752799 TTCCCCACTCTGGCTCAGTGAGG - Intergenic
1051816497 9:21113158-21113180 TTCACCAAACTTGCTAAATTTGG - Intergenic
1058523173 9:105832182-105832204 TTGACAAGTCTTCCTCAATGAGG - Intergenic
1058693854 9:107542482-107542504 ATCACCATTCTTGCTCTTTGGGG + Intergenic
1058886053 9:109321743-109321765 TTGACCAGTGCTGCTAAATGAGG + Intergenic
1185735862 X:2495734-2495756 TGCACCAGTCTTGAAGAATGAGG - Intronic
1197099838 X:122639385-122639407 TTCACCAGTCTTGTTAAAGTTGG + Intergenic
1199512397 X:148637113-148637135 TGCACCAGTGATGCTCAATTGGG + Intronic
1200416892 Y:2921438-2921460 TTGGCCTGTCTTGCTCAGTGGGG + Intronic