ID: 945986811

View in Genome Browser
Species Human (GRCh38)
Location 2:216361410-216361432
Sequence AATCCCTTGCTGTTACATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 116}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945986805_945986811 20 Left 945986805 2:216361367-216361389 CCAGGCTTTCAGAAACACTCGTC 0: 1
1: 0
2: 0
3: 12
4: 130
Right 945986811 2:216361410-216361432 AATCCCTTGCTGTTACATATTGG 0: 1
1: 0
2: 2
3: 9
4: 116
945986801_945986811 30 Left 945986801 2:216361357-216361379 CCATCCCATCCCAGGCTTTCAGA 0: 1
1: 0
2: 2
3: 48
4: 534
Right 945986811 2:216361410-216361432 AATCCCTTGCTGTTACATATTGG 0: 1
1: 0
2: 2
3: 9
4: 116
945986803_945986811 25 Left 945986803 2:216361362-216361384 CCATCCCAGGCTTTCAGAAACAC 0: 1
1: 0
2: 1
3: 26
4: 274
Right 945986811 2:216361410-216361432 AATCCCTTGCTGTTACATATTGG 0: 1
1: 0
2: 2
3: 9
4: 116
945986802_945986811 26 Left 945986802 2:216361361-216361383 CCCATCCCAGGCTTTCAGAAACA 0: 1
1: 0
2: 1
3: 32
4: 375
Right 945986811 2:216361410-216361432 AATCCCTTGCTGTTACATATTGG 0: 1
1: 0
2: 2
3: 9
4: 116
945986808_945986811 -2 Left 945986808 2:216361389-216361411 CCAAGGAGGACCCTCAATGCAAA 0: 1
1: 0
2: 1
3: 12
4: 137
Right 945986811 2:216361410-216361432 AATCCCTTGCTGTTACATATTGG 0: 1
1: 0
2: 2
3: 9
4: 116
945986804_945986811 21 Left 945986804 2:216361366-216361388 CCCAGGCTTTCAGAAACACTCGT 0: 1
1: 0
2: 1
3: 13
4: 125
Right 945986811 2:216361410-216361432 AATCCCTTGCTGTTACATATTGG 0: 1
1: 0
2: 2
3: 9
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945986811 Original CRISPR AATCCCTTGCTGTTACATAT TGG Intronic
902651599 1:17841170-17841192 AATCCCATGCTTTTTCATGTGGG + Intergenic
903579736 1:24361840-24361862 AACCCCTTCCTTTTACAGATGGG - Intronic
909073247 1:71022438-71022460 AATCCCTTCCTGTGACATAGTGG + Intronic
910886064 1:91964792-91964814 AATTCTTTGCCATTACATATAGG + Intronic
912596340 1:110880571-110880593 AATTCCTTTCTGTTACTGATGGG + Intronic
918266301 1:182845158-182845180 AATCCCTTCATTTTACAGATAGG - Intronic
919085373 1:192914712-192914734 AATCCCTTCCTTTTCCAAATAGG - Intergenic
919520920 1:198585290-198585312 AATCTCTTGCAGTTCTATATTGG + Intergenic
923478961 1:234364951-234364973 AATACCTTGTCGCTACATATGGG - Intergenic
924404457 1:243728213-243728235 AATCCCTTGCTGTTGCATAATGG + Intronic
924766265 1:247033576-247033598 ACTCCTTTGCTGTGTCATATGGG + Intergenic
1073376197 10:103037123-103037145 AATCCTTTGCTGTTACAAAATGG - Intronic
1080771326 11:35344838-35344860 AAGCCCTTCCTGTTACAGAGAGG - Intronic
1085332610 11:75666853-75666875 TCTCCCTAGCTGTGACATATTGG - Intronic
1087933928 11:104009267-104009289 AATAGTTTGCTGTTATATATGGG + Intronic
1093443043 12:19222253-19222275 AATCCTTTGGAGTTACAGATGGG + Intronic
1097912884 12:64989618-64989640 AGTCCCTTTCTTTTACTTATAGG + Intergenic
1098403636 12:70100807-70100829 ATTCCATTGCAGTTACATGTAGG + Intergenic
1099885015 12:88518293-88518315 ATTCCTTTGCTGTGACCTATGGG + Intronic
1100541395 12:95560876-95560898 AATATCTTTTTGTTACATATAGG - Intergenic
1102217231 12:111170080-111170102 AATCCCTTACTGCTGCATAGGGG - Intronic
1105831489 13:24166272-24166294 ACTGCTTTGCTTTTACATATGGG - Intronic
1107346263 13:39464334-39464356 TATCCTTTGCTGTTTTATATAGG - Intronic
1107749964 13:43554368-43554390 AATCACTTGCATTTACATAAAGG - Intronic
1110725086 13:78813186-78813208 ATTCCATAGCTGTTAAATATTGG + Intergenic
1110750456 13:79108938-79108960 AATATTTTGCTGTTATATATTGG - Intergenic
1114997853 14:28379814-28379836 AATACCTTACTGTTAACTATAGG - Intergenic
1115682410 14:35756053-35756075 CCTCCCTAGTTGTTACATATTGG + Intronic
1119509131 14:75197422-75197444 AATCTCTTGCTGTTGCATATGGG - Intergenic
1119591052 14:75888309-75888331 CTTCCCTTGCTGATTCATATTGG + Intronic
1120146116 14:80980893-80980915 AATCCATTTCTGTTATATTTCGG + Intronic
1121225746 14:92320706-92320728 AATCCCTTCCTGTGACATGATGG - Intergenic
1121809047 14:96863421-96863443 AATTCCTTCCTGTTCCATCTGGG + Intronic
1123961787 15:25410589-25410611 GATACCTTGCTGTTTTATATTGG - Intronic
1124116576 15:26848989-26849011 AAAGTCTTGCTGTTACCTATAGG + Intronic
1124190935 15:27575633-27575655 AACCCCTTTCTGTTTCATACAGG + Intergenic
1128430957 15:67592828-67592850 ACACCTTTGCTTTTACATATAGG - Intronic
1130055943 15:80526136-80526158 AAGCCCTTTCTGTTACACAGTGG + Intronic
1131377343 15:91936672-91936694 AAGCCCTTGCAGATACATAGAGG + Intronic
1141953052 16:87351559-87351581 TATCCCTTGCTATTTCATATGGG - Intronic
1142015677 16:87745513-87745535 AAGACCTTCCTGTTTCATATGGG + Intronic
1142834113 17:2572021-2572043 ATTACCTTGCTTTTAAATATGGG - Intergenic
1143249943 17:5515694-5515716 AATCCCTTCCTTATGCATATGGG + Intronic
1144051877 17:11503765-11503787 TATCCTATGCTGTTTCATATAGG + Intronic
1146523842 17:33548976-33548998 AATCCCATGGTGTTACATCTGGG - Intronic
1146589447 17:34116019-34116041 AATCTCATGCTGTTCCATGTTGG - Intronic
1146657342 17:34642419-34642441 ATTCCCATGTTTTTACATATGGG - Intergenic
1148743066 17:49903706-49903728 ATTCCCTTGCTGTTAGTTAGAGG - Intergenic
1153330673 18:3870415-3870437 AATCACTTACTTTTACATGTAGG + Intronic
1155714459 18:28923565-28923587 AGTCTCTTGCTGTTACCAATAGG - Intergenic
1165973889 19:39657693-39657715 GAACCCTTGCTCTTACCTATGGG + Intronic
1165981351 19:39726943-39726965 GAACCCTTGCTCTTACCTATAGG - Intergenic
1168511561 19:56977793-56977815 AATCCCCTGATGTTATCTATTGG - Intergenic
928374870 2:30766012-30766034 ACTCCCTTGCTGTCCCATGTGGG + Intronic
931669287 2:64632171-64632193 AAAACCTTGCTGTTACAAATTGG - Exonic
942551739 2:177126803-177126825 AATCCCTAGGTGTTCCACATGGG + Intergenic
945986811 2:216361410-216361432 AATCCCTTGCTGTTACATATTGG + Intronic
1170467747 20:16638230-16638252 AATCCCTTTCTGTTTAACATAGG + Intergenic
1170837535 20:19897491-19897513 AATCCCTTCCTTCTACAGATGGG + Intronic
1172647234 20:36478337-36478359 AGTCCCCTGCTTTTACAGATGGG + Intronic
1173119590 20:40276513-40276535 AATCCCTTCCTGTTCCAAACTGG - Intergenic
1174159320 20:48539600-48539622 AATACATGGATGTTACATATTGG + Intergenic
1181890189 22:26055725-26055747 AATCACTTGCTCTTAAGTATAGG - Intergenic
1183487895 22:38099224-38099246 AAGCCTTTCCTGTTACAGATGGG - Intronic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
949228093 3:1717707-1717729 AATCCCTTTATGATAGATATTGG - Intergenic
951861028 3:27252787-27252809 AATTCCTAGCTGTTTCATCTGGG - Intronic
952177687 3:30884079-30884101 ATTCCCTTCCTGTTCCTTATTGG - Intronic
953778875 3:45847796-45847818 AATCCTTTCCTATTACATTTTGG + Intronic
958118116 3:89249029-89249051 TATCCCTTGCAGTTATATTTGGG + Intronic
959165690 3:102775573-102775595 TATCCTTTGCTGTTACCCATTGG + Intergenic
964497379 3:157306466-157306488 TATCCCATGCTATTACATATAGG + Intronic
964761905 3:160142286-160142308 TTTCCCTTGTTGTTACGTATAGG - Intergenic
970672045 4:18407850-18407872 ATTCTCTTGCTGTTAAAAATGGG - Intergenic
975262225 4:72316861-72316883 AATCCATTGCTGAGAAATATGGG + Intronic
977195882 4:94058735-94058757 TATGCCTTGATGTTACATAAAGG + Intergenic
977466858 4:97393199-97393221 ATTCCCTTGCTGTGACATAATGG - Intronic
977850358 4:101820261-101820283 AAACTCATGCTGATACATATTGG + Intronic
981311537 4:143302652-143302674 ATTCCCTTGGTATTACATTTGGG + Intergenic
982778361 4:159465386-159465408 ACTCCCAGGCTGTGACATATGGG + Intergenic
986200622 5:5575049-5575071 CATCCCGTCCTGTTACATTTTGG - Intergenic
991518759 5:67470220-67470242 CATCCATTGCTGATACATACTGG - Intergenic
994820239 5:104640459-104640481 AATTCCTTCATTTTACATATTGG - Intergenic
997941720 5:138163886-138163908 ATTCACATGCTGTTTCATATGGG + Intronic
999329311 5:150661936-150661958 AACCCCCTACTGTTACAGATGGG + Intronic
1000461980 5:161534235-161534257 AATCCCTTGCTTCTACCTAATGG - Intronic
1001015265 5:168135217-168135239 AATCCCCAGATGTTACACATGGG - Intronic
1001364549 5:171123311-171123333 AATCCCTGGATGGTACACATAGG - Intronic
1005412447 6:25564783-25564805 AAAATATTGCTGTTACATATGGG + Intronic
1009290831 6:61879912-61879934 AATCTCTTCCTGTTACCTAAAGG - Intronic
1011481310 6:87796576-87796598 AATCCCCTGCTGTCACACACTGG + Intergenic
1014249596 6:119101693-119101715 TATCCCTTGCTGGTACAAGTGGG + Intronic
1016556099 6:145340625-145340647 AATCCTTTGCTGGAACATAGAGG + Intergenic
1020941732 7:14547896-14547918 GATCCCTTGCTTTGAAATATGGG + Intronic
1021255959 7:18392477-18392499 AATCCGTTACTGGTAAATATAGG + Intronic
1021362915 7:19738705-19738727 AATCCCATGCTGTTTTATTTTGG - Intronic
1025611501 7:63078648-63078670 ACTCCCTTGCTGTCACTTTTGGG - Intergenic
1027543152 7:79493424-79493446 AATGCCTTCTTGTTACCTATTGG - Intergenic
1029299915 7:99573205-99573227 AATTCCTTGTTGTTTAATATAGG - Exonic
1029908767 7:104121319-104121341 ATTCCCTTCCTGTTAAGTATAGG + Intergenic
1030192103 7:106820415-106820437 AAGCCCTTGCTGTGACTTGTGGG - Intergenic
1030747867 7:113190065-113190087 AATCCTTTATTGTTAAATATGGG - Intergenic
1031495842 7:122446992-122447014 AATCCCCTGCTGCTCCATCTTGG + Intronic
1034515596 7:151575965-151575987 AATTCCTTGCTTTTACATACTGG - Intronic
1034907204 7:154960338-154960360 ACTGACTTGCTGTTACATCTTGG - Intronic
1035012305 7:155730047-155730069 AATACCTTGCTATTACAAACAGG + Intronic
1036571413 8:9982899-9982921 AATCCCTTCCTGTTAAAACTGGG + Intergenic
1037220137 8:16509212-16509234 GATCGTTTGCTGTTACCTATAGG + Intronic
1037790616 8:21936954-21936976 AGTGCCTTGGTGTTACATACTGG + Intronic
1039412534 8:37367061-37367083 TCCCCCTTGCTGTTATATATGGG - Intergenic
1041635250 8:60135707-60135729 CAGACCTTGCTATTACATATCGG + Intergenic
1042350848 8:67776064-67776086 AATCTGTTGGTGTCACATATAGG - Intergenic
1042482035 8:69315052-69315074 GCTCCCTTGCTGCTAGATATGGG + Intergenic
1043049623 8:75369083-75369105 AATCCCTTCCAGTGACATTTTGG - Intergenic
1047644144 8:126851930-126851952 GATCCCTTGCTGTAAGACATAGG + Intergenic
1047644378 8:126854464-126854486 GATCCCTTGCTGTAAGACATAGG + Intergenic
1051532008 9:18114698-18114720 AATCCCTTGCTGATGAATATTGG + Intergenic
1051726838 9:20096575-20096597 AATCTCTTTCTGTTTCATAGAGG + Intergenic
1056330053 9:85513653-85513675 AATCCCTTATTGTTGCAGATGGG - Intergenic
1059584830 9:115594836-115594858 AATCCCATGGCGTCACATATAGG - Intergenic
1060337886 9:122743827-122743849 TATCCTTTGCTCCTACATATTGG - Intergenic
1186532708 X:10313503-10313525 CATACCTTGATTTTACATATGGG + Intergenic
1193775197 X:85632851-85632873 ATTCCCTTTCTGTTATATACTGG + Intergenic
1194972347 X:100358080-100358102 TATCCCTTTCAGTTATATATAGG - Intronic
1199285299 X:146048159-146048181 AGTCCCTTGCAGTCACATAGTGG - Intergenic
1202031612 Y:20580828-20580850 TATACCATGCTGTTACAAATAGG + Intronic
1202336669 Y:23819042-23819064 TATTCCTTGTTGTTACATGTAGG - Intergenic
1202534096 Y:25851029-25851051 TATTCCTTGTTGTTACATGTAGG + Intergenic