ID: 945991683

View in Genome Browser
Species Human (GRCh38)
Location 2:216400838-216400860
Sequence CAGGGAATACAGAATCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945991683_945991688 15 Left 945991683 2:216400838-216400860 CCTTCCTGATTCTGTATTCCCTG No data
Right 945991688 2:216400876-216400898 AGCTCCTCACTAAACCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945991683 Original CRISPR CAGGGAATACAGAATCAGGA AGG (reversed) Intergenic
No off target data available for this crispr