ID: 946001693

View in Genome Browser
Species Human (GRCh38)
Location 2:216487678-216487700
Sequence CAGAGCAACCACTCACAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946001693_946001701 28 Left 946001693 2:216487678-216487700 CCCCCTTGTGAGTGGTTGCTCTG No data
Right 946001701 2:216487729-216487751 AACAACTTTTGGTCAACAATGGG No data
946001693_946001700 27 Left 946001693 2:216487678-216487700 CCCCCTTGTGAGTGGTTGCTCTG No data
Right 946001700 2:216487728-216487750 TAACAACTTTTGGTCAACAATGG No data
946001693_946001698 17 Left 946001693 2:216487678-216487700 CCCCCTTGTGAGTGGTTGCTCTG No data
Right 946001698 2:216487718-216487740 ATTCACCACATAACAACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946001693 Original CRISPR CAGAGCAACCACTCACAAGG GGG (reversed) Intergenic
No off target data available for this crispr