ID: 946002727

View in Genome Browser
Species Human (GRCh38)
Location 2:216496375-216496397
Sequence CCAATCTGTTATTCCAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946002727 Original CRISPR CCAATCTGTTATTCCAGCTC TGG (reversed) Intergenic
900320931 1:2083286-2083308 CCAGTCTCTGATTCCAGCTCCGG + Intronic
901814169 1:11784620-11784642 CCACTCTGTGCTTCCAGCTCAGG + Intronic
904105533 1:28078840-28078862 CCAACCTGGTATTCGAGCCCAGG + Intronic
905388141 1:37618524-37618546 CCAAACAGTTCTTCCATCTCTGG - Intronic
905890244 1:41514364-41514386 GAAATCTGTTATTCCAGGACAGG + Intronic
907079674 1:51609675-51609697 CAAATGTGTAATTCCAGCACTGG + Intronic
908719041 1:67103836-67103858 CCAATCTGATACTCTAGCTTAGG - Intronic
908902679 1:68974282-68974304 ACAATCTGTTCTTCAAGCACTGG - Intergenic
911149368 1:94582577-94582599 GCAATCTGTGATGGCAGCTCAGG - Intergenic
911685338 1:100769475-100769497 CCAGTCTGTATCTCCAGCTCTGG - Intergenic
912615827 1:111098765-111098787 CCAATCTGTTGTTCCATCTCAGG + Intergenic
915581661 1:156816540-156816562 CCAATCAGCTTTGCCAGCTCTGG + Intronic
915782556 1:158568721-158568743 CCACTCTGTTATTTTACCTCTGG + Intergenic
916455519 1:164967605-164967627 CCAATCTATGATGGCAGCTCAGG + Intergenic
916962379 1:169902306-169902328 CAAAGCTGTGCTTCCAGCTCAGG + Intergenic
918471533 1:184880646-184880668 CAAGTCTGTTCTTCCAGCTCAGG - Intronic
919483238 1:198114776-198114798 CAAATCAGTTATTCTATCTCAGG + Intergenic
919899015 1:202030018-202030040 CCAATCTGTTCTTCCTCCTAAGG - Intergenic
1062970667 10:1645893-1645915 TCAATCAGTCATTCCAGCACAGG + Intronic
1068445932 10:57123132-57123154 CCTATCTGTTATCTCAGCACTGG + Intergenic
1070230041 10:74556131-74556153 AAAATTTGTTATTGCAGCTCCGG + Intronic
1078858208 11:15223814-15223836 CTAATCTGTTTTTCCAGTCCTGG + Intronic
1079331805 11:19539919-19539941 CCCATCTCTTATTCAAGCTTGGG + Intronic
1080702274 11:34653986-34654008 CCAGCCTGTCATGCCAGCTCGGG + Intronic
1086482564 11:87258599-87258621 GCAAATGGTTATTCCAGCTCTGG - Intronic
1093595176 12:20950741-20950763 TCAAACTGCTATTACAGCTCAGG - Intergenic
1101422612 12:104562034-104562056 CCAATCTGGTGTTTCTGCTCTGG + Intronic
1103680914 12:122692927-122692949 CCAATGTGTTAGTCCTGCTAAGG + Intergenic
1106588931 13:31081638-31081660 CTAATCTGTTGTTTCAGCCCTGG - Intergenic
1107205839 13:37786777-37786799 CCAATCAGTCATTCCACTTCTGG - Intronic
1109429658 13:62214779-62214801 CAAATATGTTATTCCAGATTTGG + Intergenic
1112802338 13:103126291-103126313 CCCAGCTGTTATTCCCGCCCAGG - Intergenic
1118711851 14:68525968-68525990 CCAATTTCTTAACCCAGCTCAGG - Intronic
1119694559 14:76702375-76702397 CCAATCTATGAGTCCAGCTATGG + Intergenic
1120348374 14:83320042-83320064 TCATTCTTTTTTTCCAGCTCTGG + Intergenic
1120861515 14:89258955-89258977 CAACTCTGTGTTTCCAGCTCTGG + Intronic
1121659594 14:95624846-95624868 CCAGTCTGTTATACCAGGACTGG + Intergenic
1123822012 15:24040122-24040144 CCTATGTGTTACTCCTGCTCTGG + Intergenic
1127781516 15:62320528-62320550 CCAATCTGTTTTTCCAGCACAGG - Intergenic
1129827716 15:78645541-78645563 CCCTTCAGTTATTCCAGCTGAGG - Intronic
1129922672 15:79333307-79333329 AGAACCTGTTTTTCCAGCTCTGG + Intronic
1131636647 15:94239889-94239911 CCAGTCTGTTATTACTGATCAGG - Intronic
1131889162 15:96953353-96953375 TCACTCTGTTATTCTAACTCTGG - Intergenic
1133057591 16:3153995-3154017 CTCTTCTGTTTTTCCAGCTCTGG + Intergenic
1133866790 16:9651503-9651525 GTAATCTGTTACTGCAGCTCTGG + Intergenic
1138094674 16:54202456-54202478 CCAATCCGTTACTCAAGCCCTGG + Intergenic
1138094815 16:54203258-54203280 CCAATCTGTTACTCAAGCCCTGG - Intergenic
1138796174 16:59972066-59972088 CTAATTTATTATTCCAGTTCTGG - Intergenic
1144445775 17:15326749-15326771 CCAATCTCTTTTTTCAGCCCAGG - Intronic
1146659288 17:34653664-34653686 CCAATCTCTTGCTCCAGCGCCGG + Intergenic
1147037463 17:37692391-37692413 CCAGTCTGGAAGTCCAGCTCTGG + Intronic
1148378429 17:47172013-47172035 GCAACCTGTTATTACCGCTCAGG - Exonic
1152768423 17:82153194-82153216 GCAATCTGTTTTACCAGCACAGG - Intronic
1153973435 18:10246590-10246612 CCCATCTGTTCTGGCAGCTCTGG - Intergenic
1154957422 18:21272685-21272707 CCAACCAGTTATTACAGCTAAGG - Intronic
1156579138 18:38355180-38355202 GGAATCTATTATTCTAGCTCAGG + Intergenic
1159148451 18:64486139-64486161 TAAATCTCTTATTCCACCTCGGG + Intergenic
1159367844 18:67492634-67492656 ACAATCTGTTTTACCAGTTCAGG - Intergenic
1162208771 19:9075540-9075562 CCAGTCTTTTCTTCCAGCTCAGG - Intergenic
1167841532 19:52125618-52125640 CCAGTATGTGATCCCAGCTCGGG - Intronic
1167845657 19:52162175-52162197 CCGGTATGTGATTCCAGCTCGGG - Intronic
927799060 2:26080144-26080166 CCATTATTTCATTCCAGCTCTGG - Intronic
931946134 2:67309780-67309802 GCAAATTCTTATTCCAGCTCTGG - Intergenic
932301879 2:70673240-70673262 CCAATATGTTACTCCAGATGTGG + Intronic
935856816 2:107283352-107283374 CCAATTTGTGGTTCAAGCTCAGG + Intergenic
936244390 2:110813956-110813978 ACACTCTGGTATTCCAGCACTGG + Intronic
940985257 2:160045952-160045974 CAAATCCCTTCTTCCAGCTCCGG - Intronic
942372565 2:175300856-175300878 CCAATCTCTCCTTCCAGCTTAGG - Intergenic
944437604 2:199706845-199706867 CCCATCTGTAATCCAAGCTCAGG + Intergenic
944759513 2:202799518-202799540 GCAAACTGTTCTTCCAGCACGGG - Intronic
946002727 2:216496375-216496397 CCAATCTGTTATTCCAGCTCTGG - Intergenic
947564715 2:231186350-231186372 CCAGTCTGTCCCTCCAGCTCAGG + Intergenic
1169579298 20:7001121-7001143 CCAATGTTTTATTGCAACTCTGG + Intergenic
1169918553 20:10708419-10708441 CCAGTCTGTTATTTCTGCCCAGG + Intergenic
1171252240 20:23657240-23657262 CCAATCAGATATTCCAATTCTGG + Intergenic
1173876158 20:46373291-46373313 CCAAGCTGCTTTTCCAGCTCAGG + Intronic
1173935383 20:46857611-46857633 CCGATCTGTTATGCCTCCTCTGG - Intergenic
1175607581 20:60323565-60323587 GCAATGTGTTATGGCAGCTCCGG - Intergenic
1178487162 21:33026446-33026468 CCACTCGTTTATTCCAGCCCGGG + Exonic
951190504 3:19764405-19764427 TTACTCAGTTATTCCAGCTCGGG + Intergenic
953152633 3:40339003-40339025 CCAGTCTGTTTTTCCACCACAGG + Intergenic
956063942 3:65377190-65377212 CCATTCTGTGATACAAGCTCAGG - Intronic
956578252 3:70780341-70780363 CAACCCAGTTATTCCAGCTCAGG + Intergenic
957450499 3:80375877-80375899 ACAGTCTGTTGTTCCAGCTCAGG + Intergenic
958883194 3:99696526-99696548 CCAATCTGCTCTTCCATCTTTGG - Intronic
967439806 3:189493425-189493447 GCAAGTTGTTATTCCAGCTGAGG + Intergenic
967464063 3:189781695-189781717 CCAACCTATTATTCCTGCTGAGG + Intronic
970380639 4:15503805-15503827 TAAATCTGTTTTTCCAGGTCTGG - Intronic
971079495 4:23193494-23193516 CCTATCTGTTGTTCCAGATGTGG - Intergenic
975807429 4:78127432-78127454 CCAATCTGTTATCCAGGCTATGG - Intronic
979530304 4:121763815-121763837 CCAAACTGTCATTGCAGCTGTGG + Exonic
981342860 4:143642336-143642358 CAAATTTGTTATTTAAGCTCAGG - Intronic
985614898 5:914114-914136 CCAGTCTGTTATGCCACCTTCGG - Intronic
985841072 5:2306246-2306268 CTTAACTGTTCTTCCAGCTCTGG + Intergenic
986445789 5:7820037-7820059 CAAATAATTTATTCCAGCTCTGG - Intronic
988696647 5:33628047-33628069 CCAATCTGTTACACCAGTTCTGG - Intronic
989454006 5:41621189-41621211 TTCTTCTGTTATTCCAGCTCAGG + Intergenic
994227343 5:97268101-97268123 CCTATCTGGTATTCCAGCTCTGG + Intergenic
995292192 5:110469719-110469741 GCAATGTGTCATTTCAGCTCAGG - Intronic
995389563 5:111625652-111625674 CAAATCTGTCTTTTCAGCTCTGG - Intergenic
996266507 5:121547605-121547627 CCAATCTTTTAGTCCCTCTCAGG + Intergenic
997905915 5:137817022-137817044 CCAATCTGTAATTCTATATCTGG - Intergenic
1001680830 5:173555703-173555725 GCAATTTTTTATTCCAGCTCGGG - Intergenic
1003527193 6:6908283-6908305 TCATTCTTTTATTCCAACTCAGG - Intergenic
1003558568 6:7162373-7162395 CGAATCTCTTCTTCAAGCTCAGG + Intronic
1004029631 6:11853668-11853690 CCAATCTGTTGTTCCAGGGTGGG - Intergenic
1004468131 6:15904726-15904748 CTAATCTGTTAGTCCTGCACAGG + Intergenic
1004929231 6:20445859-20445881 TTAATCAGTTATTCCAGCTCGGG + Intronic
1006268749 6:32948154-32948176 CCAATCAGTTATGTCAGTTCTGG - Intronic
1006880801 6:37337790-37337812 CCAATCTGTTATTCATCCCCTGG + Intergenic
1014086482 6:117351669-117351691 CCAATCTGTCTTTCCAACTGGGG + Intronic
1014899847 6:126949400-126949422 CCAAACTGGAATTCCATCTCTGG - Intergenic
1016958820 6:149652343-149652365 CCAGTCTGTTACTGCAGCTATGG - Intergenic
1017628654 6:156374252-156374274 CCAATCTTCTATTTCAACTCTGG - Intergenic
1020563634 7:9768259-9768281 CCAATGTGCTATTCCATCTGGGG - Intergenic
1020656916 7:10939635-10939657 CCTATGTGTTATACCATCTCTGG - Intronic
1023930026 7:44699861-44699883 CCACTCTCTTACTCCTGCTCTGG - Intronic
1026401807 7:70021473-70021495 CCCATCTGCTATTCCAGATGGGG + Intronic
1027957996 7:84906570-84906592 ACAAACTTTTATTCCAGCTTTGG - Intergenic
1029459603 7:100687293-100687315 CCCACCTGTCATCCCAGCTCTGG + Exonic
1031956645 7:127949236-127949258 TCATTCTGTTCTTCCACCTCAGG + Intronic
1032204261 7:129847964-129847986 CCAATATATCATTCCAGCCCTGG + Intronic
1032294359 7:130622427-130622449 CTTATCTGTGATTCCAGCTGTGG - Intronic
1032856202 7:135835525-135835547 CTAATCTCTTCTTCCAGCGCTGG - Intergenic
1037456237 8:19067292-19067314 CATATCTATCATTCCAGCTCAGG + Intronic
1038418849 8:27419109-27419131 CCCACCTGTTAATCCATCTCTGG + Intronic
1038478138 8:27883336-27883358 GCAAGCTGTGATCCCAGCTCTGG - Intronic
1038947378 8:32376252-32376274 ACAAACTGTTATCCTAGCTCAGG + Intronic
1041758808 8:61341756-61341778 CCAATCTGTTAGTACAACCCTGG - Intronic
1042008052 8:64204871-64204893 CCAGGCTGTGATTTCAGCTCTGG + Intergenic
1042482266 8:69317620-69317642 GCATTCTGTTATAGCAGCTCTGG + Intergenic
1043356322 8:79416854-79416876 CCCATCTCTTCTTCCAGCTCAGG - Intergenic
1044876632 8:96674147-96674169 CCAAGCTGTAATGCCAGCTTTGG - Intronic
1045355660 8:101386756-101386778 TCAAGCTGTTCTTTCAGCTCAGG + Intergenic
1045974572 8:108116682-108116704 CCATTCTTTAATTCCAGCCCTGG + Intergenic
1050936947 9:11410377-11410399 CCATTGTGTTAACCCAGCTCTGG - Intergenic
1051274276 9:15384050-15384072 GCAATCTGTTTTTCCAGGTTTGG - Intergenic
1051600130 9:18864231-18864253 GCAATCTGTTTATCAAGCTCAGG + Intronic
1051938369 9:22472290-22472312 GCAATCTGTTCTTCCAAATCTGG + Intergenic
1052342228 9:27375085-27375107 CCCAGCTGTTATTCAAGCTCTGG + Intronic
1054741811 9:68813754-68813776 CCACTGTGTTACTCCAGCCCTGG - Intronic
1055551640 9:77437009-77437031 CCAATCTGTAATTCCAACTTGGG + Intronic
1060722682 9:125989269-125989291 CCAGGCTGTGATTCCAGGTCAGG + Intergenic
1061998209 9:134199660-134199682 CGCATCTGTAATTCCAGCACTGG + Intergenic
1185801166 X:3012414-3012436 CACATCTGTAATTCCAGCTAGGG + Intronic
1187663483 X:21575953-21575975 TCAATCTGTCCTTCCAGTTCTGG - Intronic
1187912379 X:24122703-24122725 GCAATGTCTTATTCCAGGTCTGG + Intergenic
1189594696 X:42551713-42551735 ACAATCTGTTAATATAGCTCTGG + Intergenic
1190474084 X:50811001-50811023 CTAATCTTTTATGCTAGCTCTGG - Intronic
1192582193 X:72293631-72293653 CGCATCTGTAATTCCAGCTGAGG - Intronic
1197186776 X:123596248-123596270 CCAATTTGTTATACCAGCCCAGG - Intergenic
1199963052 X:152794930-152794952 CCTCTCTCTTATTCCTGCTCTGG + Intergenic