ID: 946003071

View in Genome Browser
Species Human (GRCh38)
Location 2:216499084-216499106
Sequence GGCCGCGCGCTCCGAAGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 132}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946003071_946003081 13 Left 946003071 2:216499084-216499106 CCGGGCCTTCGGAGCGCGCGGCC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 946003081 2:216499120-216499142 GGTTTCGTTGGGTTGAATTTAGG 0: 1
1: 0
2: 0
3: 9
4: 104
946003071_946003079 2 Left 946003071 2:216499084-216499106 CCGGGCCTTCGGAGCGCGCGGCC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 946003079 2:216499109-216499131 CCCTGGGCACTGGTTTCGTTGGG 0: 1
1: 0
2: 1
3: 9
4: 94
946003071_946003082 14 Left 946003071 2:216499084-216499106 CCGGGCCTTCGGAGCGCGCGGCC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 946003082 2:216499121-216499143 GTTTCGTTGGGTTGAATTTAGGG 0: 1
1: 0
2: 0
3: 6
4: 113
946003071_946003077 1 Left 946003071 2:216499084-216499106 CCGGGCCTTCGGAGCGCGCGGCC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 946003077 2:216499108-216499130 GCCCTGGGCACTGGTTTCGTTGG 0: 1
1: 0
2: 0
3: 21
4: 124
946003071_946003083 23 Left 946003071 2:216499084-216499106 CCGGGCCTTCGGAGCGCGCGGCC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 946003083 2:216499130-216499152 GGTTGAATTTAGGGAAAACTAGG 0: 1
1: 0
2: 0
3: 15
4: 183
946003071_946003075 -8 Left 946003071 2:216499084-216499106 CCGGGCCTTCGGAGCGCGCGGCC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 946003075 2:216499099-216499121 GCGCGGCCAGCCCTGGGCACTGG 0: 1
1: 0
2: 6
3: 29
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946003071 Original CRISPR GGCCGCGCGCTCCGAAGGCC CGG (reversed) Intronic
900166751 1:1247013-1247035 GCCCGGGCGCCCCGACGGCCAGG + Intergenic
900310290 1:2030138-2030160 GGCAGCCCGCTCAGGAGGCCAGG + Exonic
900536371 1:3179676-3179698 GGCCGCCCGCTCTCAAGGCCGGG + Intronic
900579678 1:3402885-3402907 GGCTGCGCTCTACGAGGGCCTGG + Exonic
901801246 1:11709315-11709337 GGCAGAGCTCTCCGAAGCCCAGG + Exonic
902783088 1:18716926-18716948 GGGCGCGGGCTCCCGAGGCCGGG + Intronic
902872710 1:19324190-19324212 GGACGTGCGGGCCGAAGGCCTGG - Intronic
903860112 1:26360025-26360047 GGCCGAGCGGTGCGGAGGCCCGG - Intergenic
904724872 1:32539644-32539666 GGCCGCGGGCTCTGACGGCCCGG + Intronic
904822930 1:33256775-33256797 GCCGGGGCGCTCCGAGGGCCCGG + Intronic
905107782 1:35574325-35574347 GGCCGTGCGCGCCGTCGGCCAGG - Exonic
905617254 1:39409433-39409455 TGCCGCGCGCCCCGAGGGCCAGG - Intronic
910291871 1:85607307-85607329 GGCAGCGCTCTCGGTAGGCCTGG + Intergenic
921671110 1:217925066-217925088 GGCCGAGCGCGCCCAGGGCCTGG - Intergenic
921945010 1:220880151-220880173 GGTGGCGCCCTCCGAAGTCCCGG + Exonic
1063381289 10:5587797-5587819 GGGCGAGCGCTCCCCAGGCCTGG + Intergenic
1067082351 10:43218789-43218811 GGGCGCCCGCTCCAGAGGCCTGG + Intronic
1070660646 10:78303211-78303233 GGCCGCGCGGGCCGAGGGGCGGG - Intergenic
1071328706 10:84540748-84540770 GGCCGCGGGATCCCAGGGCCGGG + Intergenic
1071545015 10:86522163-86522185 GGCGGCGGCCTCCGCAGGCCCGG - Intergenic
1074055972 10:109923253-109923275 GGCCGCGCTCGCCGGAGCCCCGG - Intronic
1077464788 11:2728582-2728604 GCCCTCACGCTCCCAAGGCCCGG - Intronic
1078517117 11:12032107-12032129 GGCCTGGCCCTCCCAAGGCCTGG + Intergenic
1083312718 11:61793007-61793029 GGCCGCGTGTCCCAAAGGCCAGG + Exonic
1083335137 11:61917637-61917659 CGGCGCGCGCTCCCAAGGCCTGG + Intronic
1083571246 11:63763280-63763302 GGCCGCGCCCCCCGCTGGCCGGG - Exonic
1083741443 11:64713612-64713634 GGCGGCGCGCGCGGACGGCCTGG - Exonic
1084195796 11:67523195-67523217 GGCAGAGCCCTCCGAGGGCCGGG - Intronic
1085263622 11:75223639-75223661 GGCAGCGGGCTCTGGAGGCCAGG - Intergenic
1086666639 11:89491498-89491520 GGCCGCGCGCTCAGAGCGCTGGG - Intronic
1090780428 11:130002338-130002360 GGCTGCGCGCGGCGAAGGCAGGG + Intronic
1101365191 12:104064435-104064457 GGCCGCGGGCGCCGGCGGCCAGG - Exonic
1101466897 12:104958293-104958315 GGCCGCGGGCGCCGACGGCCGGG - Intronic
1102101453 12:110281570-110281592 GGCCCCGAGCTCCGCAGGGCGGG - Intronic
1102469993 12:113154434-113154456 GGTGGCGCGCTTCGACGGCCTGG + Exonic
1105409585 13:20160859-20160881 GGCCGGGCGCCCCGGAGGCCAGG - Intronic
1105507513 13:21023157-21023179 CTCCGAGGGCTCCGAAGGCCGGG + Intronic
1106602471 13:31199911-31199933 GGCCGCGCCCTCTGGCGGCCGGG - Intergenic
1108292511 13:48975849-48975871 GGCCGCGGGCTCCGTCGGCGGGG + Intergenic
1113379034 13:109786399-109786421 GGCCGCGCGCGCCTTAGGCTCGG - Exonic
1114612446 14:24051818-24051840 TGCCCCCCGCCCCGAAGGCCCGG + Intergenic
1115261391 14:31457517-31457539 GGCCCCGCCCTCCTAAGGGCGGG - Intergenic
1118220979 14:63853788-63853810 GGGGGGGCGCTCCGACGGCCGGG + Intronic
1118312682 14:64705025-64705047 GGCCGCGCGCGCCCGAGGGCTGG + Intronic
1119519723 14:75277165-75277187 GGCCGGGCGCGCCGTCGGCCTGG - Intergenic
1121803997 14:96798052-96798074 GGCCTCGCGGTCCCCAGGCCTGG - Intronic
1122283650 14:100638623-100638645 GGCCACGCGCCCTGGAGGCCTGG - Intergenic
1124469354 15:29969044-29969066 GGCGGCGCGCTCCGGTGGGCGGG + Intergenic
1124803936 15:32862049-32862071 AGCCACGCGCCCCGGAGGCCAGG + Intronic
1126100800 15:45117139-45117161 GGCCCCGCTCTACGGAGGCCTGG + Exonic
1129986885 15:79926194-79926216 GGCCGTGCGCTCCGAGTGCGGGG - Intergenic
1130370652 15:83283603-83283625 AGCCGCGGGCTCCGCAGCCCAGG + Intronic
1130994266 15:88895309-88895331 GGCCGGGCACTGCGGAGGCCCGG - Intronic
1131992394 15:98104503-98104525 GGCCGGGCGCTCCGAGTGCGAGG + Intergenic
1132365036 15:101251267-101251289 CGCCGCGCGCCCCGCCGGCCTGG + Exonic
1132555447 16:570061-570083 GGCCGCGCGCTCGGGCGGCGGGG - Exonic
1132807662 16:1782512-1782534 CGCTGCGCGCTCCGCCGGCCCGG + Exonic
1132953455 16:2578144-2578166 GGCCGAGCAACCCGAAGGCCGGG - Intronic
1132960897 16:2622024-2622046 GGCCGAGCAACCCGAAGGCCGGG + Intergenic
1136623061 16:31442857-31442879 GGCCGTGGGCTCCGGACGCCGGG - Exonic
1137620970 16:49876533-49876555 GGCCGGGGGCTCCGAGGCCCCGG + Intergenic
1138471964 16:57245154-57245176 GGCGGCGCGCGCAGAGGGCCAGG + Exonic
1140442664 16:74999357-74999379 GCCCCCGGGCTCCGAAAGCCGGG - Exonic
1141682619 16:85553371-85553393 GGCCGCCGGCGCCGAGGGCCTGG + Intergenic
1142230165 16:88896391-88896413 TGCCGCGCGCTCCAGAGGGCCGG - Intronic
1142374657 16:89700873-89700895 GGCCCCGCGACCCGCAGGCCAGG + Intronic
1142986071 17:3696019-3696041 GGCCGGGCGGTCCGCAAGCCCGG - Exonic
1146398402 17:32486422-32486444 GGCCGCGCGCTGCCAGGGCAGGG + Intergenic
1146798784 17:35801901-35801923 GGCCGCTCTCTAGGAAGGCCAGG + Intronic
1147992880 17:44345688-44345710 GGCTGGGAGCTCCGAGGGCCTGG + Intronic
1150548960 17:66191836-66191858 GGGCGCGCGCCCCCCAGGCCCGG + Exonic
1150649349 17:66999864-66999886 GGCCGCGCACTCAGACAGCCCGG - Intronic
1151370570 17:73644290-73644312 GGCAGCGCGCCCGGAAGGCGAGG + Intergenic
1151797147 17:76353872-76353894 CGCCGGGCGCTGCGAAGGCTCGG - Exonic
1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG + Intronic
1154173762 18:12068370-12068392 GGCCGTGCCCTCCGACAGCCAGG - Intergenic
1160019661 18:75170562-75170584 GGCTGAGCGCCGCGAAGGCCGGG + Intergenic
1161309397 19:3585662-3585684 GGCCGGGGGCTCCGAGGGCGCGG - Exonic
1161483751 19:4523875-4523897 GGCCGCGCTGGCCGAGGGCCGGG - Exonic
1162479647 19:10920985-10921007 GGCCGCCCTCGCCGCAGGCCTGG + Intronic
1162731753 19:12722390-12722412 GGCCGCGCGCGGCGCAGGCTCGG + Intronic
1162769085 19:12938331-12938353 GGCCGCGAGCACCTCAGGCCAGG - Intergenic
1163631410 19:18419675-18419697 GGCCGTGCCCTCCGACAGCCAGG + Exonic
1163701193 19:18787436-18787458 GGCGGCGGGCACCGAAGGGCGGG - Intronic
1166679413 19:44757942-44757964 GGCCCCGCCCTGCGATGGCCTGG + Intronic
927692215 2:25216166-25216188 GGCCACGCGCTCGGGGGGCCCGG + Intergenic
931665926 2:64609498-64609520 CGCGTCGCGCTCCCAAGGCCCGG + Intergenic
932572969 2:72947584-72947606 GACAGAGCTCTCCGAAGGCCAGG - Intronic
933741875 2:85539768-85539790 GGGCGCGCGCTCCCGAGGGCCGG - Intronic
939465110 2:142546142-142546164 GGCCGCCCGCTCCGAGTGCGGGG - Intergenic
940293478 2:152099151-152099173 TGCCGCGCTCTCCGAAGTGCGGG - Intergenic
942098585 2:172556336-172556358 GGCCGCACTCACCGAAGTCCAGG - Exonic
946003071 2:216499084-216499106 GGCCGCGCGCTCCGAAGGCCCGG - Intronic
946418687 2:219552964-219552986 GGCGGCGCGTGCCGAGGGCCTGG + Exonic
947435460 2:230068520-230068542 GGCCGCGCGCGCCGCGGGCCTGG - Intronic
947542932 2:230991043-230991065 GGCGGCGCGCTTGGAAGTCCAGG - Intergenic
1172284629 20:33732107-33732129 GGCCGGGCGCTGCGAGGGCGCGG - Intronic
1176150872 20:63590134-63590156 GGCCGTGTGCTCCTCAGGCCCGG + Exonic
1177318709 21:19493678-19493700 GGCCGGCCGCTCCGAGTGCCGGG - Intergenic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1182435437 22:30326834-30326856 GGCCGCGCGCGCCCGCGGCCGGG - Exonic
1183546250 22:38455961-38455983 GGCCGCGCGCCCCCCAGCCCGGG + Intergenic
1184034073 22:41910338-41910360 GGCCCCGCGCTTCGCAGTCCGGG + Intronic
1185245781 22:49771951-49771973 GGCCGCCCTCTCTGAAGGCTTGG - Intergenic
1185385593 22:50530154-50530176 GGCCCCGGGCCCCGACGGCCCGG - Intronic
950549067 3:13655442-13655464 GCCCGCCCGCGCCCAAGGCCAGG + Intergenic
954558868 3:51539046-51539068 GACCCCGTGCCCCGAAGGCCCGG - Intergenic
961474005 3:127135854-127135876 GGCCGGGGGCTGCGATGGCCTGG - Intergenic
968506449 4:973364-973386 GGCCGCGCGCGCCCGGGGCCGGG - Exonic
974068059 4:57098589-57098611 GGCCTCTGGCTCCGAAGCCCTGG + Intronic
978748548 4:112222505-112222527 AGGCGCGCGCTCGGCAGGCCCGG + Intergenic
984146333 4:176065913-176065935 GCCCGCGGGCTCCGAGGGGCGGG - Intronic
985660700 5:1155503-1155525 CGCCGCGCGCTCCGGGGACCTGG - Intergenic
986993264 5:13578593-13578615 GGCCGGCCGCTCCGAGGGCGGGG - Intergenic
999166218 5:149551451-149551473 GGGCGCTCGCTCCGAAGGATCGG + Intronic
1001506426 5:172283876-172283898 GGCCGCCCGCCCGGCAGGCCTGG + Exonic
1001902742 5:175444809-175444831 CGCCGCGCGCTCCGTGTGCCCGG + Intergenic
1002567299 5:180119203-180119225 GGCCGGGCTCTCTGAAGGCCTGG - Intronic
1010980559 6:82364906-82364928 CGGCGCCCGCTCCGAAGGCTCGG - Exonic
1019032621 6:169025418-169025440 GGCCCCGCGCCCCAAAGACCAGG + Intergenic
1019681947 7:2355260-2355282 GGACGAGCGCTCCGACAGCCGGG + Exonic
1024210104 7:47195896-47195918 GGCCGTGCCTTCCAAAGGCCTGG + Intergenic
1024819900 7:53316153-53316175 GGCTGCGAGCTCCTCAGGCCCGG - Intergenic
1025976863 7:66377045-66377067 GGCCGCGGCCTCCCCAGGCCAGG - Intronic
1027218887 7:76201810-76201832 CGCAGCGCCCTCCGCAGGCCTGG - Intergenic
1028709380 7:93890463-93890485 TGCCGCGCGCTCCGCTGGCAGGG - Intronic
1029711250 7:102301174-102301196 GGCCGCGGGCTCCGGGGGCTCGG + Exonic
1034522535 7:151632023-151632045 GGCCCGGCGCTCCCACGGCCCGG - Intronic
1035279467 7:157768480-157768502 GGCCGCGTGCTCTCATGGCCGGG - Intronic
1035580612 8:737519-737541 GCCCGCGCGCTCCCCAAGCCGGG + Intronic
1036811004 8:11867793-11867815 GTCCGCGCGCTCCGAAGCGTCGG - Intronic
1037815354 8:22109093-22109115 GGCTGCGCGCTCCCGAGGCCCGG + Intronic
1040471368 8:47738052-47738074 GGGCGCAGGCTCCGCAGGCCAGG + Exonic
1042997956 8:74721673-74721695 GGCCTCGCCCTTCAAAGGCCTGG - Intronic
1049035304 8:140070958-140070980 GGCCGAGTGCTGCCAAGGCCTGG - Intronic
1049762324 8:144337034-144337056 GGCTGCGGGCTCTGGAGGCCGGG - Intergenic
1049780806 8:144428043-144428065 GGCCGCCCGCGCCGAAGCCCTGG + Intronic
1058286545 9:103186992-103187014 GGCCCCGCACTCCGAACGGCAGG + Intergenic
1058699338 9:107587864-107587886 GGCCGCCCGCACGGAAGGGCCGG - Intergenic
1060106764 9:120877386-120877408 GGCCGCGGGCTCCAATGGCGAGG - Intronic
1062313033 9:135949729-135949751 GGCCGCACGCTCCCCGGGCCTGG + Intronic
1196668922 X:118345850-118345872 GGCCGCGCGCTCTCAGAGCCAGG + Intergenic
1200310374 X:155071400-155071422 GAACCCGCGCGCCGAAGGCCAGG + Intronic