ID: 946003071

View in Genome Browser
Species Human (GRCh38)
Location 2:216499084-216499106
Sequence GGCCGCGCGCTCCGAAGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 132}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946003071_946003075 -8 Left 946003071 2:216499084-216499106 CCGGGCCTTCGGAGCGCGCGGCC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 946003075 2:216499099-216499121 GCGCGGCCAGCCCTGGGCACTGG 0: 1
1: 0
2: 6
3: 29
4: 326
946003071_946003083 23 Left 946003071 2:216499084-216499106 CCGGGCCTTCGGAGCGCGCGGCC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 946003083 2:216499130-216499152 GGTTGAATTTAGGGAAAACTAGG 0: 1
1: 0
2: 0
3: 15
4: 183
946003071_946003081 13 Left 946003071 2:216499084-216499106 CCGGGCCTTCGGAGCGCGCGGCC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 946003081 2:216499120-216499142 GGTTTCGTTGGGTTGAATTTAGG 0: 1
1: 0
2: 0
3: 9
4: 104
946003071_946003077 1 Left 946003071 2:216499084-216499106 CCGGGCCTTCGGAGCGCGCGGCC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 946003077 2:216499108-216499130 GCCCTGGGCACTGGTTTCGTTGG 0: 1
1: 0
2: 0
3: 21
4: 124
946003071_946003082 14 Left 946003071 2:216499084-216499106 CCGGGCCTTCGGAGCGCGCGGCC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 946003082 2:216499121-216499143 GTTTCGTTGGGTTGAATTTAGGG 0: 1
1: 0
2: 0
3: 6
4: 113
946003071_946003079 2 Left 946003071 2:216499084-216499106 CCGGGCCTTCGGAGCGCGCGGCC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 946003079 2:216499109-216499131 CCCTGGGCACTGGTTTCGTTGGG 0: 1
1: 0
2: 1
3: 9
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946003071 Original CRISPR GGCCGCGCGCTCCGAAGGCC CGG (reversed) Intronic