ID: 946003075

View in Genome Browser
Species Human (GRCh38)
Location 2:216499099-216499121
Sequence GCGCGGCCAGCCCTGGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 6, 3: 29, 4: 326}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946003061_946003075 29 Left 946003061 2:216499047-216499069 CCTTGGCTGGGCCTGGCGCGCTC 0: 1
1: 0
2: 0
3: 30
4: 218
Right 946003075 2:216499099-216499121 GCGCGGCCAGCCCTGGGCACTGG 0: 1
1: 0
2: 6
3: 29
4: 326
946003071_946003075 -8 Left 946003071 2:216499084-216499106 CCGGGCCTTCGGAGCGCGCGGCC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 946003075 2:216499099-216499121 GCGCGGCCAGCCCTGGGCACTGG 0: 1
1: 0
2: 6
3: 29
4: 326
946003064_946003075 18 Left 946003064 2:216499058-216499080 CCTGGCGCGCTCCAGCCGGGTTA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 946003075 2:216499099-216499121 GCGCGGCCAGCCCTGGGCACTGG 0: 1
1: 0
2: 6
3: 29
4: 326
946003068_946003075 3 Left 946003068 2:216499073-216499095 CCGGGTTAACGCCGGGCCTTCGG 0: 1
1: 0
2: 0
3: 0
4: 32
Right 946003075 2:216499099-216499121 GCGCGGCCAGCCCTGGGCACTGG 0: 1
1: 0
2: 6
3: 29
4: 326
946003067_946003075 7 Left 946003067 2:216499069-216499091 CCAGCCGGGTTAACGCCGGGCCT 0: 1
1: 0
2: 0
3: 0
4: 32
Right 946003075 2:216499099-216499121 GCGCGGCCAGCCCTGGGCACTGG 0: 1
1: 0
2: 6
3: 29
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946003075 Original CRISPR GCGCGGCCAGCCCTGGGCAC TGG Intronic