ID: 946003077

View in Genome Browser
Species Human (GRCh38)
Location 2:216499108-216499130
Sequence GCCCTGGGCACTGGTTTCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 124}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946003064_946003077 27 Left 946003064 2:216499058-216499080 CCTGGCGCGCTCCAGCCGGGTTA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 946003077 2:216499108-216499130 GCCCTGGGCACTGGTTTCGTTGG 0: 1
1: 0
2: 0
3: 21
4: 124
946003068_946003077 12 Left 946003068 2:216499073-216499095 CCGGGTTAACGCCGGGCCTTCGG 0: 1
1: 0
2: 0
3: 0
4: 32
Right 946003077 2:216499108-216499130 GCCCTGGGCACTGGTTTCGTTGG 0: 1
1: 0
2: 0
3: 21
4: 124
946003071_946003077 1 Left 946003071 2:216499084-216499106 CCGGGCCTTCGGAGCGCGCGGCC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 946003077 2:216499108-216499130 GCCCTGGGCACTGGTTTCGTTGG 0: 1
1: 0
2: 0
3: 21
4: 124
946003072_946003077 -4 Left 946003072 2:216499089-216499111 CCTTCGGAGCGCGCGGCCAGCCC 0: 1
1: 0
2: 0
3: 13
4: 96
Right 946003077 2:216499108-216499130 GCCCTGGGCACTGGTTTCGTTGG 0: 1
1: 0
2: 0
3: 21
4: 124
946003067_946003077 16 Left 946003067 2:216499069-216499091 CCAGCCGGGTTAACGCCGGGCCT 0: 1
1: 0
2: 0
3: 0
4: 32
Right 946003077 2:216499108-216499130 GCCCTGGGCACTGGTTTCGTTGG 0: 1
1: 0
2: 0
3: 21
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946003077 Original CRISPR GCCCTGGGCACTGGTTTCGT TGG Intronic