ID: 946003081

View in Genome Browser
Species Human (GRCh38)
Location 2:216499120-216499142
Sequence GGTTTCGTTGGGTTGAATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 104}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946003071_946003081 13 Left 946003071 2:216499084-216499106 CCGGGCCTTCGGAGCGCGCGGCC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 946003081 2:216499120-216499142 GGTTTCGTTGGGTTGAATTTAGG 0: 1
1: 0
2: 0
3: 9
4: 104
946003067_946003081 28 Left 946003067 2:216499069-216499091 CCAGCCGGGTTAACGCCGGGCCT 0: 1
1: 0
2: 0
3: 0
4: 32
Right 946003081 2:216499120-216499142 GGTTTCGTTGGGTTGAATTTAGG 0: 1
1: 0
2: 0
3: 9
4: 104
946003072_946003081 8 Left 946003072 2:216499089-216499111 CCTTCGGAGCGCGCGGCCAGCCC 0: 1
1: 0
2: 0
3: 13
4: 96
Right 946003081 2:216499120-216499142 GGTTTCGTTGGGTTGAATTTAGG 0: 1
1: 0
2: 0
3: 9
4: 104
946003076_946003081 -8 Left 946003076 2:216499105-216499127 CCAGCCCTGGGCACTGGTTTCGT 0: 1
1: 0
2: 1
3: 18
4: 152
Right 946003081 2:216499120-216499142 GGTTTCGTTGGGTTGAATTTAGG 0: 1
1: 0
2: 0
3: 9
4: 104
946003068_946003081 24 Left 946003068 2:216499073-216499095 CCGGGTTAACGCCGGGCCTTCGG 0: 1
1: 0
2: 0
3: 0
4: 32
Right 946003081 2:216499120-216499142 GGTTTCGTTGGGTTGAATTTAGG 0: 1
1: 0
2: 0
3: 9
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946003081 Original CRISPR GGTTTCGTTGGGTTGAATTT AGG Intronic