ID: 946003082

View in Genome Browser
Species Human (GRCh38)
Location 2:216499121-216499143
Sequence GTTTCGTTGGGTTGAATTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946003071_946003082 14 Left 946003071 2:216499084-216499106 CCGGGCCTTCGGAGCGCGCGGCC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 946003082 2:216499121-216499143 GTTTCGTTGGGTTGAATTTAGGG 0: 1
1: 0
2: 0
3: 6
4: 113
946003072_946003082 9 Left 946003072 2:216499089-216499111 CCTTCGGAGCGCGCGGCCAGCCC 0: 1
1: 0
2: 0
3: 13
4: 96
Right 946003082 2:216499121-216499143 GTTTCGTTGGGTTGAATTTAGGG 0: 1
1: 0
2: 0
3: 6
4: 113
946003068_946003082 25 Left 946003068 2:216499073-216499095 CCGGGTTAACGCCGGGCCTTCGG 0: 1
1: 0
2: 0
3: 0
4: 32
Right 946003082 2:216499121-216499143 GTTTCGTTGGGTTGAATTTAGGG 0: 1
1: 0
2: 0
3: 6
4: 113
946003076_946003082 -7 Left 946003076 2:216499105-216499127 CCAGCCCTGGGCACTGGTTTCGT 0: 1
1: 0
2: 1
3: 18
4: 152
Right 946003082 2:216499121-216499143 GTTTCGTTGGGTTGAATTTAGGG 0: 1
1: 0
2: 0
3: 6
4: 113
946003067_946003082 29 Left 946003067 2:216499069-216499091 CCAGCCGGGTTAACGCCGGGCCT 0: 1
1: 0
2: 0
3: 0
4: 32
Right 946003082 2:216499121-216499143 GTTTCGTTGGGTTGAATTTAGGG 0: 1
1: 0
2: 0
3: 6
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946003082 Original CRISPR GTTTCGTTGGGTTGAATTTA GGG Intronic