ID: 946003083

View in Genome Browser
Species Human (GRCh38)
Location 2:216499130-216499152
Sequence GGTTGAATTTAGGGAAAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 183}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946003072_946003083 18 Left 946003072 2:216499089-216499111 CCTTCGGAGCGCGCGGCCAGCCC 0: 1
1: 0
2: 0
3: 13
4: 96
Right 946003083 2:216499130-216499152 GGTTGAATTTAGGGAAAACTAGG 0: 1
1: 0
2: 0
3: 15
4: 183
946003076_946003083 2 Left 946003076 2:216499105-216499127 CCAGCCCTGGGCACTGGTTTCGT 0: 1
1: 0
2: 1
3: 18
4: 152
Right 946003083 2:216499130-216499152 GGTTGAATTTAGGGAAAACTAGG 0: 1
1: 0
2: 0
3: 15
4: 183
946003080_946003083 -3 Left 946003080 2:216499110-216499132 CCTGGGCACTGGTTTCGTTGGGT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 946003083 2:216499130-216499152 GGTTGAATTTAGGGAAAACTAGG 0: 1
1: 0
2: 0
3: 15
4: 183
946003071_946003083 23 Left 946003071 2:216499084-216499106 CCGGGCCTTCGGAGCGCGCGGCC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 946003083 2:216499130-216499152 GGTTGAATTTAGGGAAAACTAGG 0: 1
1: 0
2: 0
3: 15
4: 183
946003078_946003083 -2 Left 946003078 2:216499109-216499131 CCCTGGGCACTGGTTTCGTTGGG 0: 1
1: 0
2: 2
3: 8
4: 98
Right 946003083 2:216499130-216499152 GGTTGAATTTAGGGAAAACTAGG 0: 1
1: 0
2: 0
3: 15
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946003083 Original CRISPR GGTTGAATTTAGGGAAAACT AGG Intronic