ID: 946006956

View in Genome Browser
Species Human (GRCh38)
Location 2:216533524-216533546
Sequence CCCCATAGGGAGACAATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946006948_946006956 10 Left 946006948 2:216533491-216533513 CCCTTGCTGGATGAAGGAATGCC 0: 1
1: 0
2: 1
3: 13
4: 168
Right 946006956 2:216533524-216533546 CCCCATAGGGAGACAATGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 165
946006949_946006956 9 Left 946006949 2:216533492-216533514 CCTTGCTGGATGAAGGAATGCCA 0: 1
1: 0
2: 1
3: 17
4: 182
Right 946006956 2:216533524-216533546 CCCCATAGGGAGACAATGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946006956 Original CRISPR CCCCATAGGGAGACAATGGA GGG Intronic
902005129 1:13225906-13225928 CCCCAGAGGGAGGCAGGGGAAGG + Intergenic
902024354 1:13371700-13371722 CCCCAGAGGGAGGCAGGGGAAGG + Intergenic
902765995 1:18615657-18615679 CCCCAAGGAGAGCCAATGGACGG + Intergenic
903672353 1:25044043-25044065 TCAAATAGGGAGAAAATGGAAGG + Intergenic
904704531 1:32379957-32379979 TCCCATAGAGAGCCAATGAAAGG - Intronic
904848956 1:33442529-33442551 CCCCATAGAGAGACACTACACGG + Intergenic
905921773 1:41724342-41724364 CCCCTTAGGGAGAAAAGGGCTGG + Intronic
907986914 1:59541254-59541276 CCCCATAGAAAGATGATGGAAGG + Intronic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
914238419 1:145833561-145833583 CCTCATTGGAAGACAATGGCTGG - Exonic
918198808 1:182247737-182247759 ACCCAGAGGGAGTCAAAGGAAGG + Intergenic
918645162 1:186895551-186895573 TCCCAGAGGGAGATAATTGAGGG - Intronic
922064911 1:222127147-222127169 CCTCATAAGGTGACATTGGAGGG - Intergenic
922274465 1:224064335-224064357 CCCGCTAGGGAAACAATGGGAGG + Intergenic
922443605 1:225677627-225677649 GCCCTTAGGGAGAGAATTGATGG + Intergenic
922600387 1:226847052-226847074 TCCAAAAGGGAGAAAATGGAAGG - Intergenic
924390349 1:243548765-243548787 CCGCATAGGAAGATAAAGGAGGG + Intronic
924507705 1:244701640-244701662 TCCAAAAGGGAGAAAATGGAAGG - Intronic
924659107 1:246000425-246000447 CCCCAGTGGGAGAGAAGGGAAGG - Intronic
1063864841 10:10352847-10352869 CCCCATAGGGCTACAGTGGAAGG - Intergenic
1066309630 10:34183766-34183788 CCCCATACAGAGAAAAGGGAGGG - Intronic
1069819455 10:71218389-71218411 CCCCAACGGAATACAATGGATGG - Intronic
1070675190 10:78407307-78407329 CCACCTAGGGAGACAAGGGAGGG + Intergenic
1071457597 10:85862868-85862890 ACCCAGAGGGAGGAAATGGAGGG + Intronic
1076509216 10:131000127-131000149 CCTCAAAGAGAGACAATGGAAGG - Intergenic
1080843862 11:36008990-36009012 CTCCATGTGGAGACAAAGGAAGG - Intronic
1081542025 11:44041796-44041818 CACAATTGGGAAACAATGGAGGG - Intergenic
1082875548 11:57984690-57984712 CCCCATAGGAAGAAAATAAATGG + Intergenic
1083170858 11:60923502-60923524 CCCCACAGGGAGAAATTGGGAGG - Intergenic
1083187551 11:61026471-61026493 CAACAAAGGGAGACAAAGGAGGG + Intergenic
1083911432 11:65712373-65712395 CCCCAGGGGGAGATAATCGAGGG + Exonic
1084769063 11:71330998-71331020 CCTCAGATGGAGAGAATGGAGGG + Intergenic
1085427908 11:76421458-76421480 CCCCATGGGGAGTGAAGGGACGG - Intergenic
1088485148 11:110333424-110333446 CTCCCTAGTGAGAGAATGGAAGG - Intergenic
1088767164 11:112993838-112993860 TCACATAGGCAGACAATGAAAGG - Intronic
1092769104 12:11880872-11880894 ACCTATAGGGAGACATAGGAGGG + Intronic
1096770428 12:53932909-53932931 CCTAAAAGGGAGATAATGGAAGG - Intergenic
1096823874 12:54259466-54259488 CCCCAAAGGTAGAAAATGAATGG + Intronic
1101068244 12:101045861-101045883 CCACTTAAGGAGACAAGGGAAGG - Intronic
1101210090 12:102526720-102526742 CCCCACAGGGAGAAAAAGAAGGG - Intergenic
1101396795 12:104355865-104355887 CACCATTGGGAGCCACTGGAGGG + Intergenic
1107857115 13:44627271-44627293 TCCAAAAGGGAGACAATAGAAGG - Intergenic
1113654471 13:112059128-112059150 CCCCATCGGGCGGCAGTGGAGGG - Intergenic
1114414817 14:22534997-22535019 CCCAATAGGGAGAAAAGAGAGGG + Intergenic
1117651894 14:57916131-57916153 TCCCATGGTGAAACAATGGAAGG + Intronic
1117834430 14:59787629-59787651 CCTCATAGGGAGAAAATGGTGGG + Intronic
1121015995 14:90549438-90549460 TCCCAAAGGGAGACAAAGGTGGG - Intronic
1121906362 14:97749997-97750019 CCCCCCAGGGAAACAATGTAAGG - Exonic
1122028708 14:98896726-98896748 CCCCAGCCAGAGACAATGGAGGG + Intergenic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1128991881 15:72267575-72267597 CCACAAAGGGAGACAAGGTAGGG + Exonic
1130067450 15:80616431-80616453 GCCTTTAGGGAGATAATGGAGGG - Intergenic
1131995070 15:98125508-98125530 ACCCATAAGGAGAGAATGCAAGG + Intergenic
1133867165 16:9654954-9654976 CCCTATAGGCAGACTATAGAAGG - Intergenic
1134124045 16:11604142-11604164 CAACATAGTGAGACACTGGAGGG + Intronic
1136078843 16:27838502-27838524 CACCATAGGGAGAAAAGGGGAGG + Intronic
1136169053 16:28477332-28477354 CCCAAGTGGGAGACAATGGCTGG + Exonic
1139005066 16:62559718-62559740 TCCTATAGGGAGACAATTGCTGG + Intergenic
1141340555 16:83200008-83200030 ACCCATGGGGAGACAGTGGCTGG + Intronic
1141369620 16:83474863-83474885 CCCCATAGGGAAACAACCGCTGG + Intronic
1141719417 16:85747495-85747517 ACCCATAGGGAAACCATGGCTGG + Intronic
1142286363 16:89173113-89173135 CCCCATCTGGAGACAGTGGTGGG + Intronic
1142491827 17:284574-284596 CCCCACTGGGAGAGCATGGAGGG - Intronic
1142648126 17:1328599-1328621 CCCCACAGAGAAACACTGGAAGG + Intergenic
1144638472 17:16925287-16925309 CCCCAGAGGGAGACTCCGGAGGG + Intergenic
1144876727 17:18400982-18401004 CCCCAGAGGGTGACATGGGAGGG - Intergenic
1145155500 17:20543437-20543459 CCCCAGAGGGTGACATGGGAGGG + Intergenic
1146842933 17:36167501-36167523 CCCCAGAGGGTGACATGGGAGGG + Intronic
1146855238 17:36255442-36255464 CCCCAGAGGGTGACATGGGAGGG + Intronic
1146865382 17:36332933-36332955 CCCCAGAGGGTGACATGGGAGGG - Intronic
1146871144 17:36379353-36379375 CCCCAGAGGGTGACATGGGAGGG + Intronic
1146878504 17:36430435-36430457 CCCCAGAGGGTGACATGGGAGGG + Intronic
1146882452 17:36451581-36451603 CCCCAGAGGGTGACATGGGAGGG + Intergenic
1147068243 17:37933527-37933549 CCCCAGAGGGTGACATGGGAGGG - Intronic
1147074030 17:37979977-37979999 CCCCAGAGGGTGACATGGGAGGG + Intronic
1147079774 17:38013082-38013104 CCCCAGAGGGTGACATGGGAGGG - Intronic
1147085551 17:38059515-38059537 CCCCAGAGGGTGACATGGGAGGG + Intronic
1147095715 17:38137024-38137046 CCCCAGAGGGTGACATGGGAGGG - Intergenic
1147101498 17:38183481-38183503 CCCCAGAGGGTGACATGGGAGGG + Intergenic
1147326288 17:39671342-39671364 CCCCACAGGAATAGAATGGAGGG - Exonic
1149158575 17:53664061-53664083 CACCAAAGGGAGAAATTGGAAGG - Intergenic
1149846097 17:60009987-60010009 CCCCAGAGGGTGACATGGGAGGG + Intergenic
1150084446 17:62266567-62266589 CCCCAGAGGGTGACATGGGAGGG + Intergenic
1153924095 18:9817886-9817908 CCCCAGTGGGAGAAAATGCAGGG + Intronic
1154358013 18:13637144-13637166 TCACATAGGGAGGCAGTGGATGG - Intronic
1158423550 18:57318316-57318338 ACACATAGGGAGAAAATGAAGGG - Intergenic
1160564912 18:79781037-79781059 CTTCATAGGGAGAAAAAGGAGGG - Intergenic
1161716024 19:5876778-5876800 GCACATGGGGAGACAATGGGGGG + Intronic
1162770156 19:12944489-12944511 CCCCAGAAGGAGACACAGGAGGG - Exonic
1163653645 19:18532960-18532982 CCTCCTAGGGAGCCAATTGATGG + Intronic
1164709931 19:30348587-30348609 CTCCATGGGGATGCAATGGATGG + Intronic
1164842692 19:31405349-31405371 TCCCATCTGGAGGCAATGGAGGG + Intergenic
1165472267 19:36010433-36010455 CCCCATGAGGGGACAAGGGAAGG + Intronic
1166046434 19:40233362-40233384 CCCCATAGGGGGACAGCGGGTGG + Exonic
1167693184 19:50999892-50999914 CCCCAGAGGGAGACAAAGAAGGG - Intronic
926136032 2:10337188-10337210 TCCCATAGGGAGGCCAGGGAGGG + Intronic
933328028 2:80863466-80863488 CCCCAGGGGCAGACACTGGAGGG - Intergenic
933577224 2:84082920-84082942 TGCCATAGGGAGACACTGGATGG - Intergenic
934220522 2:90078072-90078094 CCCCATACAGAGACAGGGGAAGG + Intergenic
934972143 2:98772480-98772502 CACCACAGGGACACAATGGATGG + Intergenic
935033121 2:99341427-99341449 CCCCACAGGGACAGCATGGAAGG - Intronic
939621182 2:144420857-144420879 CGCCATTGGTATACAATGGATGG + Intronic
940308686 2:152253898-152253920 CACCATAGGGAGCCAATAAAAGG + Intergenic
944477847 2:200125541-200125563 CCCCATACAGAGACAGAGGAGGG + Intergenic
944786082 2:203071795-203071817 TCCAAAAGGGAGACAGTGGAAGG + Intronic
946006956 2:216533524-216533546 CCCCATAGGGAGACAATGGAGGG + Intronic
948163536 2:235844115-235844137 TCTCACAGGCAGACAATGGATGG - Intronic
1168851389 20:979337-979359 CCCCACAAGGAGACATTTGAGGG - Intronic
1169055915 20:2620900-2620922 ACCAAAAGGGAGAAAATGGAAGG - Intronic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1170189013 20:13626098-13626120 CCCCATAGGGGTCCAATGTATGG + Intronic
1170975895 20:21164232-21164254 CACCATAAGTAGACAATGAATGG - Intronic
1172643235 20:36454555-36454577 CCCAGTAGGGAGACAGTGGCTGG - Intronic
1173040749 20:39460180-39460202 TCCCATGGGGAGAAAAGGGAAGG + Intergenic
1175157043 20:56978208-56978230 CCACATTGGGAGAGAATGGGGGG - Intergenic
1177907366 21:26988148-26988170 TCCAAAAAGGAGACAATGGAAGG + Intergenic
1178430898 21:32517871-32517893 TCCCATAGGGAGAAATTGAAGGG + Intergenic
1178521032 21:33288650-33288672 CACCAGAGGGAGAGAATGGGAGG + Intronic
1179450929 21:41467872-41467894 TCCCACAGGGTGACAGTGGAGGG - Exonic
1180728566 22:17964061-17964083 CCCCAAAGGCAGACAAAGGTTGG + Intronic
1181455643 22:23058814-23058836 ACCCAAAGGGAGAGAATGGAGGG + Intergenic
1182081643 22:27533448-27533470 CCCAAAAGGAGGACAATGGAGGG - Intergenic
1182353303 22:29710841-29710863 CCCCATTGGGAGGCAGTGGGGGG - Intergenic
1183097994 22:35565786-35565808 CACCACAGGGAGGCAATGCAGGG + Intergenic
1183925808 22:41205192-41205214 GCCCACAGGGAGAGAATGGCGGG + Exonic
1184791917 22:46705325-46705347 GGCCATAGGGAGACAGTGCAAGG + Intronic
1184878691 22:47291569-47291591 CCCCACAGGGGGACAGTGCATGG + Intergenic
950714600 3:14838776-14838798 CCAAACAGGGAGAAAATGGAAGG + Intronic
954929286 3:54266885-54266907 CCTCTTAGGGAGAGCATGGAGGG + Intronic
958531410 3:95336633-95336655 CCCTATAAAGAGACTATGGAAGG + Intergenic
959197579 3:103204371-103204393 CCCCATAGGCAGGAAATGTATGG - Intergenic
959393540 3:105806017-105806039 CCCCATATGTAGACCATGGGAGG - Intronic
959429164 3:106231365-106231387 TCCCAAAGGGAGAGAATGGATGG - Intergenic
963943638 3:151120659-151120681 CCACATAAGGAAACAATGGAAGG + Intronic
968582367 4:1401051-1401073 CCCCACAGGGAGATGATAGAAGG - Intergenic
971248380 4:24950675-24950697 CCCCTTAGGGTGGCAGTGGAGGG + Intronic
975122915 4:70748691-70748713 TCCCATGGGGTGACACTGGATGG + Intronic
982071018 4:151694320-151694342 CCCAGTAGGGAGACAGTGCAGGG - Intronic
983499524 4:168483218-168483240 TCACAAAGGGAGAAAATGGAAGG - Intronic
985507954 5:295308-295330 TCCCAGAGGGAGAGAGTGGAGGG + Intronic
985528571 5:420633-420655 CCCCATGTGGAGAGGATGGAAGG + Intronic
985642113 5:1068549-1068571 CCCCAAAGGCAGCCAAGGGAAGG + Intronic
985740081 5:1610360-1610382 TCCCAGAGGGAGAGAGTGGAGGG - Intergenic
990504426 5:56430551-56430573 CCCTCCAGGGAAACAATGGAAGG + Intergenic
993744556 5:91580883-91580905 ACCCAGAGGGAGAAAATGGCAGG + Intergenic
997017324 5:129951664-129951686 CCACATGGAGAGACAATGGGTGG - Intronic
1000360267 5:160440648-160440670 CCCCCTGTGGAGACAGTGGATGG + Intergenic
1003183733 6:3813112-3813134 CCCCATAGTGAGAAATTAGAGGG - Intergenic
1012634134 6:101514412-101514434 CCCCATATGGAGACAGGGAAGGG + Intronic
1013163787 6:107571329-107571351 TCCAACAGGGACACAATGGATGG - Intronic
1015866256 6:137729728-137729750 CCCAATGGGGAGAAAATGCAAGG - Intergenic
1016787200 6:148023976-148023998 CTCTAAAGGGATACAATGGATGG - Intergenic
1017899050 6:158704696-158704718 CGCCATAGGGAGTCACTGAAGGG + Intronic
1018375287 6:163204678-163204700 CCCCATGGAGAGGCAATGGGAGG + Intronic
1019779260 7:2929937-2929959 CTGCAGGGGGAGACAATGGAGGG + Intronic
1022214172 7:28241695-28241717 CCCCAAAGGCAGACAAGAGATGG + Intergenic
1023132093 7:37013511-37013533 CCCCAAAGGGAGACAAGCGGAGG + Intronic
1023876259 7:44287898-44287920 GCCCATAGAGAGCCATTGGAAGG - Intronic
1024034374 7:45495162-45495184 CCCCATAGGGAGACCCTGCCCGG + Intergenic
1024442198 7:49433348-49433370 CTCCATAGGGATCCACTGGAGGG - Intergenic
1029250958 7:99236044-99236066 CCCCATAGGAAGACAAGAGGAGG + Intergenic
1030322023 7:108179209-108179231 TCCCTTAGGGAGACAATGAATGG - Intronic
1034847410 7:154459312-154459334 CCCAATAGGGAAATAATGGGTGG - Intronic
1037819789 8:22130090-22130112 CCCCAGAGAGAGGCAAGGGAGGG + Intronic
1039322802 8:36451382-36451404 CTCCATAGGGAGATATTGTAGGG - Intergenic
1045790051 8:105973002-105973024 CCCCATTAAGAGACATTGGAGGG - Intergenic
1051368525 9:16338739-16338761 CCCCAAAGGGTGACAATGAGTGG + Intergenic
1052787130 9:32839177-32839199 CCCGATAGGGAGAAAATGACTGG + Intergenic
1053069639 9:35093496-35093518 CCACAAATGGAGACCATGGAGGG - Exonic
1057563193 9:96144928-96144950 CCCCACTGGGAGACGATGGGTGG - Intergenic
1060883205 9:127133184-127133206 CCCCATGGGGAGGGAATGGGAGG + Intronic
1188190908 X:27170586-27170608 CCCCAGAAGGAGAGAATTGACGG + Intergenic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191706365 X:64098324-64098346 CCCCCTAGGGTGACAATCCATGG - Intergenic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1198959577 X:142170067-142170089 CCACATAGGGAAGTAATGGAAGG - Intergenic
1199853486 X:151741350-151741372 CTCCATAGGTGGAAAATGGAAGG - Intronic
1200282640 X:154790933-154790955 ACACTTATGGAGACAATGGAAGG + Intronic