ID: 946011174

View in Genome Browser
Species Human (GRCh38)
Location 2:216564709-216564731
Sequence GTAAAGTCCCTGACAACTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 56}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946011173_946011174 0 Left 946011173 2:216564686-216564708 CCACACTTTGATAAGCACTGTCT 0: 1
1: 0
2: 22
3: 152
4: 694
Right 946011174 2:216564709-216564731 GTAAAGTCCCTGACAACTCGAGG 0: 1
1: 0
2: 0
3: 3
4: 56
946011172_946011174 7 Left 946011172 2:216564679-216564701 CCATAGACCACACTTTGATAAGC 0: 1
1: 2
2: 30
3: 251
4: 924
Right 946011174 2:216564709-216564731 GTAAAGTCCCTGACAACTCGAGG 0: 1
1: 0
2: 0
3: 3
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946011174 Original CRISPR GTAAAGTCCCTGACAACTCG AGG Intronic
905483650 1:38280007-38280029 ATAGAATCCCTGACTACTCGTGG - Intergenic
911889329 1:103346908-103346930 GTAGAGTCAGTGACAACTCCTGG + Intergenic
912224130 1:107712740-107712762 GTAAAGTCCCTGACTAATGTTGG + Intronic
912822385 1:112878524-112878546 GTGAAGTCCCTGAAACCTCTGGG + Intergenic
912951809 1:114125435-114125457 ATAAAGTCCCTGAGACCTTGAGG - Intronic
916292628 1:163183359-163183381 GTAAAGTGCCTGACAAATGGTGG - Intronic
922217433 1:223531795-223531817 GAAAAGTGCCTGACACCTTGTGG + Intergenic
1073089575 10:100923282-100923304 GTAATGTCTCTGGCAACTCTAGG + Intronic
1073875186 10:107914622-107914644 GCAAAGTCCCTGAAGACTGGGGG - Intergenic
1076525628 10:131110806-131110828 GTAAAGTGGCTGAGAGCTCGAGG + Intronic
1078291635 11:10016209-10016231 GTAAAGTTCCTTACAACTGCAGG - Intronic
1079768813 11:24432116-24432138 GTTAAGTACTAGACAACTCGGGG - Intergenic
1088188250 11:107197435-107197457 GTAAAGGCCCTGAAACCTCCTGG - Intergenic
1091005176 11:131946607-131946629 GTAAAATCCATGACAACCTGTGG - Intronic
1091099802 11:132861010-132861032 CAAAAGTCCCTGGCAAATCGTGG - Intronic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1102034933 12:109765683-109765705 GCATCGTCCCTGACACCTCGTGG - Intronic
1107438215 13:40400897-40400919 GTAAAAGGCCTGACAACTAGAGG + Intergenic
1107574692 13:41705737-41705759 GTAAAGTTCCTTACAGCTTGGGG + Intronic
1114674459 14:24431077-24431099 GGAAAGTCCCTCAAAACTCAGGG - Intronic
1118366779 14:65102800-65102822 GAAAATCTCCTGACAACTCGCGG - Intergenic
1121783058 14:96634863-96634885 GAAAGGTCCCAGACAACTCAAGG - Intergenic
1124394357 15:29288404-29288426 GTAGAGGCCCTGACAACACCAGG - Intronic
1127198263 15:56614221-56614243 GTAGAGTCCTAGACAACTAGAGG + Intergenic
1137592678 16:49703429-49703451 GTAAAGTCCCTGAAAAATGTAGG - Intronic
1137735815 16:50722400-50722422 GTAAAGCCACTGAAAACTCTTGG + Intronic
1140257064 16:73346462-73346484 ATAAAGTGCATGACAACTTGGGG - Intergenic
1148962028 17:51401440-51401462 GTAATGTCCATGACATCTGGTGG + Intergenic
1163608211 19:18287341-18287363 ATAACGTCCCTCACCACTCGTGG - Intergenic
1164776044 19:30854535-30854557 GCAAAGCACCTGACAACTGGTGG - Intergenic
929021922 2:37561941-37561963 GTAGAGTCCCTGTCAACCCGAGG + Intergenic
929128354 2:38541372-38541394 GTCTAGTCCCTGACAACTGAAGG + Intergenic
931652026 2:64477260-64477282 GTCAAGTCACTGAGAACTGGGGG - Intergenic
931984766 2:67730797-67730819 GTACAGTCACTGACAACCAGGGG + Intergenic
942093694 2:172518184-172518206 GTAAAGTCCATGCCAACCCAAGG + Intergenic
942775658 2:179579038-179579060 GTAAATTACCTGACAAATCTGGG + Intronic
946011174 2:216564709-216564731 GTAAAGTCCCTGACAACTCGAGG + Intronic
948503093 2:238409022-238409044 GTACAGTCCCTGCCAGCTCTCGG + Intergenic
953290053 3:41651211-41651233 TTAAAGTCCCTGAAAATTGGGGG + Intronic
960054009 3:113263621-113263643 GTAAAGTCCATGAAAATTGGGGG + Intronic
962925742 3:139991881-139991903 ATACAGCCCCTGACAACTTGAGG + Intronic
964012795 3:151911135-151911157 GTTAAGTCCCTGACTACTAGTGG + Intergenic
964390698 3:156194677-156194699 TTAAAATCCCTGAAAACTGGGGG - Intronic
964423338 3:156528061-156528083 ATAAACTACCTGACTACTCGAGG - Intronic
968729085 4:2261412-2261434 GAAAAGTCCAGAACAACTCGGGG + Intronic
972326071 4:38016409-38016431 GGTAAGACCGTGACAACTCGAGG - Intronic
981891553 4:149744579-149744601 GTAATGTCCCTGCAAACTTGAGG + Intergenic
991002543 5:61796899-61796921 GTTAAGTCCCTGACATTTCAGGG - Intergenic
991247950 5:64527506-64527528 GTCAATTCCCTGACCACTCTTGG + Intronic
994152105 5:96459397-96459419 GTAAAGTCCCTGTCAAAATGGGG + Intergenic
1003264192 6:4551260-4551282 GTAAAGGCCCTGCAAACTCCTGG - Intergenic
1015082887 6:129249659-129249681 GTAAAGTGCCTGTCAAATGGAGG + Intronic
1023504519 7:40885970-40885992 GTAAAGTCTCTTAAAAGTCGGGG - Intergenic
1049939924 9:535642-535664 GCAAAGGCCCTAACAACTCAGGG - Intronic
1059615271 9:115944000-115944022 GTAAAGTCCATCAAAACTTGAGG + Intergenic
1060109312 9:120895029-120895051 ACAAAGTCCCTGACCAGTCGGGG - Intergenic
1060645733 9:125278194-125278216 GTTAAGTCCCTGAAAAGTGGTGG + Intronic
1187982579 X:24774075-24774097 CTAAAGTCCCTTCCAACTCTAGG + Intronic
1188916750 X:35920414-35920436 ATAAAGTGCCTGATAACTCCAGG + Intronic
1191706458 X:64099294-64099316 GAAAAGTGCCTGACATCTAGTGG - Intergenic