ID: 946014061

View in Genome Browser
Species Human (GRCh38)
Location 2:216589740-216589762
Sequence CTGTGGTTCTGGCTCTCACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946014061_946014069 -5 Left 946014061 2:216589740-216589762 CCCCGTGAGAGCCAGAACCACAG No data
Right 946014069 2:216589758-216589780 CACAGGTCGGGAAGAGTGTTTGG No data
946014061_946014070 7 Left 946014061 2:216589740-216589762 CCCCGTGAGAGCCAGAACCACAG No data
Right 946014070 2:216589770-216589792 AGAGTGTTTGGACTCAGCCCTGG No data
946014061_946014071 8 Left 946014061 2:216589740-216589762 CCCCGTGAGAGCCAGAACCACAG No data
Right 946014071 2:216589771-216589793 GAGTGTTTGGACTCAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946014061 Original CRISPR CTGTGGTTCTGGCTCTCACG GGG (reversed) Intergenic
No off target data available for this crispr