ID: 946017542

View in Genome Browser
Species Human (GRCh38)
Location 2:216615977-216615999
Sequence TGTTCTTTAAGACCACCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946017542_946017545 -3 Left 946017542 2:216615977-216615999 CCATCAGGTGGTCTTAAAGAACA No data
Right 946017545 2:216615997-216616019 ACACAGGGCATCCCATATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946017542 Original CRISPR TGTTCTTTAAGACCACCTGA TGG (reversed) Intergenic
No off target data available for this crispr