ID: 946019983

View in Genome Browser
Species Human (GRCh38)
Location 2:216634109-216634131
Sequence GCGGAAGTCAGGCCCGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 570
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 545}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946019968_946019983 21 Left 946019968 2:216634065-216634087 CCGAGACCTTGGACCAAATCAAG 0: 1
1: 0
2: 0
3: 11
4: 136
Right 946019983 2:216634109-216634131 GCGGAAGTCAGGCCCGGGGAGGG 0: 1
1: 0
2: 3
3: 21
4: 545
946019973_946019983 15 Left 946019973 2:216634071-216634093 CCTTGGACCAAATCAAGGGGGAC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 946019983 2:216634109-216634131 GCGGAAGTCAGGCCCGGGGAGGG 0: 1
1: 0
2: 3
3: 21
4: 545
946019974_946019983 8 Left 946019974 2:216634078-216634100 CCAAATCAAGGGGGACTGTTGCT 0: 1
1: 0
2: 0
3: 5
4: 96
Right 946019983 2:216634109-216634131 GCGGAAGTCAGGCCCGGGGAGGG 0: 1
1: 0
2: 3
3: 21
4: 545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946019983 Original CRISPR GCGGAAGTCAGGCCCGGGGA GGG Intronic
900229375 1:1548664-1548686 GTGGAAGCCAGGGCAGGGGAGGG - Intronic
902778705 1:18690873-18690895 GGGAAAGTGAGGCCCGAGGAGGG + Intronic
903121208 1:21218027-21218049 GGGGAAGCCAGGCCCCGAGACGG - Intronic
903739749 1:25551980-25552002 GCGGGTGTCAGGGCTGGGGAGGG - Intronic
903762903 1:25711692-25711714 GAGGAAGTGGGGCCCGGGGCAGG - Intronic
905361406 1:37423354-37423376 CAGGAAGCCAGGCCCGGAGATGG - Intergenic
905801712 1:40848350-40848372 GCTGAAGTCACACCAGGGGAAGG - Intergenic
906035681 1:42748987-42749009 GGAGAAGTGAGGCCCCGGGAAGG - Intronic
906244554 1:44263772-44263794 GAGGAAGCAAGGCCAGGGGAGGG - Intronic
906760134 1:48369488-48369510 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
908571974 1:65420268-65420290 GCGGAATTCTGGGCCGGTGAGGG + Intergenic
908898112 1:68923905-68923927 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
909682678 1:78310446-78310468 GCGGCAGCGAGGCCGGGGGAGGG + Intronic
910068448 1:83182584-83182606 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
910311602 1:85830509-85830531 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
910822528 1:91367041-91367063 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
911022984 1:93407663-93407685 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
911213171 1:95164208-95164230 GCGGCAGTGAGGCTGGGGGAGGG - Intronic
911955033 1:104222773-104222795 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
912447408 1:109748505-109748527 GCGGCAGCCAGGCTTGGGGAGGG - Intronic
912521616 1:110249480-110249502 GCTGAAGTCGGGCCGAGGGAGGG - Intronic
912900126 1:113638945-113638967 GCGGCAGTGAGGCTGGGGGAGGG - Intronic
912942603 1:114058549-114058571 ACGGATGTCAGGCTGGGGGATGG - Intergenic
913594101 1:120356880-120356902 GCAAAAGTCAGGGCCGGGCATGG + Intergenic
913933994 1:125015669-125015691 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
914093156 1:144522110-144522132 GCAAAAGTCAGGGCCGGGCATGG - Intergenic
914596690 1:149161034-149161056 GCAAAAGTCAGGGCCGGGCATGG - Intergenic
915875118 1:159604164-159604186 GTGGCAGTGAGGCCGGGGGAGGG + Intergenic
916493639 1:165325926-165325948 GAGGCAGGCAGGCCCGGGGGAGG - Intronic
916523177 1:165584014-165584036 GCTAAACTCAGGCACGGGGAAGG - Intergenic
917379029 1:174383377-174383399 GCGGCAGTGAGGCTGGGGGAGGG - Intronic
917987308 1:180333949-180333971 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
918423540 1:184386931-184386953 GCGGGAGCTAGGCTCGGGGAGGG + Intergenic
919486932 1:198157339-198157361 GCGGGAGTCGGGCCGGGAGAGGG + Intronic
920071310 1:203305244-203305266 GAGAAAGCGAGGCCCGGGGACGG - Intergenic
920359729 1:205406418-205406440 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
921149813 1:212390875-212390897 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
921184575 1:212658436-212658458 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
923400771 1:233614066-233614088 GCGGGAGCCAGGCCCGGGCGGGG + Exonic
1062913128 10:1227115-1227137 GCGGCAGTGAGGCTGGGGGAGGG - Intronic
1063893179 10:10651275-10651297 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1064601270 10:16996014-16996036 GTGGAGGTCAGGATCGGGGAGGG - Intronic
1064702482 10:18036235-18036257 GCGGCAGTGAGGCTGGGGGAGGG - Intronic
1064761691 10:18627812-18627834 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
1064922182 10:20531404-20531426 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
1065276898 10:24094946-24094968 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
1066152856 10:32642357-32642379 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
1066356308 10:34687491-34687513 GCTGAAGCCAGGCATGGGGAAGG - Intronic
1068115776 10:52736088-52736110 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1068256229 10:54515408-54515430 GCGGCAGACAGGCTGGGGGAGGG + Intronic
1068956015 10:62818935-62818957 GCGGAGGGCAGGACCGGGGCTGG + Intronic
1069641981 10:69962110-69962132 GGCGAAGGCAGGGCCGGGGAAGG - Intronic
1070256013 10:74813656-74813678 CCGGGAGGCAGGCGCGGGGAAGG + Intergenic
1070343641 10:75521423-75521445 GCTGCAGTCAGGCAGGGGGAGGG - Intronic
1070807313 10:79278207-79278229 GGGGCAATCAGGCCCAGGGAGGG - Intronic
1070830170 10:79413319-79413341 GCTGGAGTCAGGCGTGGGGAGGG - Intronic
1071244406 10:83746911-83746933 GTGGCAGTGAGGCTCGGGGAGGG - Intergenic
1071448266 10:85769753-85769775 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
1071459308 10:85877036-85877058 GCGGCAGTAAGGCTGGGGGAGGG + Intronic
1071891351 10:90011474-90011496 GCGGCAGCGAGGCTCGGGGAGGG + Intergenic
1071904606 10:90159040-90159062 GCGGCAGTGAGGCTCGGGGAGGG - Intergenic
1072405421 10:95147793-95147815 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1072859079 10:98983926-98983948 GCAGCAGCCAGGCTCGGGGAGGG + Intronic
1073435586 10:103513863-103513885 GGGGCAGTGAGGCCGGGGGAGGG + Intronic
1076888751 10:133274113-133274135 GCTGGAGCCAGGCCCGGGCAGGG + Intronic
1077090306 11:775386-775408 GGGGGATGCAGGCCCGGGGATGG - Intronic
1077102917 11:830127-830149 GCGGAGGTGAGGGCCGGGGTGGG + Exonic
1077334493 11:1997366-1997388 GGGGAAGCGAGGCCTGGGGAGGG + Intergenic
1077788549 11:5412720-5412742 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
1077834618 11:5914901-5914923 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
1078310079 11:10232015-10232037 GCGGCAGTGAGGCTGGGGGAGGG - Intronic
1078689005 11:13560547-13560569 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
1078799995 11:14633725-14633747 GCGGCAGTTAGGCTGGGGGAGGG - Intronic
1079232313 11:18659210-18659232 GCGGCAGCGAGGCTCGGGGAGGG + Intergenic
1079516189 11:21272336-21272358 GCAGCAGTGAGGCCGGGGGAGGG + Intronic
1079598680 11:22285224-22285246 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1080059225 11:27939486-27939508 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1080082565 11:28238318-28238340 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
1080254026 11:30268850-30268872 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1080363504 11:31544429-31544451 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
1081427450 11:42940750-42940772 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1082574591 11:54787132-54787154 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1082744315 11:56945729-56945751 GTGGCAGTGAGGCCGGGGGAGGG - Intergenic
1082877094 11:57999747-57999769 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1083009908 11:59387355-59387377 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1083494780 11:63041993-63042015 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1083572821 11:63769153-63769175 GCGGGAGGCAGCCCCGGGCAGGG - Intergenic
1083679322 11:64343958-64343980 GGGACAGTCAGGCCCAGGGAGGG - Intronic
1084786977 11:71448250-71448272 GCGCAGGTGAGGCCAGGGGAAGG - Intronic
1084786996 11:71448322-71448344 GCGCAAGCGAGGCCAGGGGAAGG - Exonic
1084904365 11:72334640-72334662 GGGGAGGTCAGGCCAGGGCACGG - Intronic
1084957061 11:72697183-72697205 TCGGAGGTCAGGCCTAGGGAGGG + Exonic
1085162439 11:74360834-74360856 GCCGCAGTGAGGCCGGGGGAGGG + Intronic
1085247989 11:75119711-75119733 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
1087451587 11:98330486-98330508 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
1087580136 11:100040683-100040705 GCGGCAGTGAGGCTGGGGGAGGG - Intronic
1087712180 11:101567047-101567069 GCTGAAGTCTGGCTCGGGGCGGG + Intronic
1088004637 11:104926050-104926072 GCGGAAGCCTGGCTGGGGGAGGG - Intergenic
1088958813 11:114639179-114639201 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1089692991 11:120198152-120198174 GCTGGAGGCAGGCCTGGGGAGGG + Intergenic
1090690333 11:129174346-129174368 GCGGCAGCAAGGCTCGGGGAGGG + Intronic
1091005254 11:131947434-131947456 CAGGAAGACAGTCCCGGGGAGGG - Intronic
1091052305 11:132383839-132383861 GCGGCAGTGAGGCTGGGGGATGG + Intergenic
1091289619 11:134430572-134430594 GCGAAACTGAGGCCCGGAGAGGG + Intergenic
1202817476 11_KI270721v1_random:52548-52570 GGGGAAGCGAGGCCTGGGGAGGG + Intergenic
1093571239 12:20668253-20668275 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
1094008924 12:25785701-25785723 GCAGAAGTCAGGGCTGGGGGGGG + Intergenic
1094451646 12:30588773-30588795 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1094785995 12:33848547-33848569 GCGGCAGCGAGGCTCGGGGAGGG + Intergenic
1094877962 12:34672662-34672684 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
1095388016 12:41672863-41672885 GCGGCAGCTAGGCTCGGGGAGGG + Intergenic
1096781349 12:53994137-53994159 GCCGAAGTCAGGCCGTGGGCCGG - Intronic
1098057323 12:66521935-66521957 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
1098186348 12:67900627-67900649 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1099146120 12:79045208-79045230 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
1099235702 12:80080387-80080409 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
1099514813 12:83584685-83584707 GCGGAAGCCAGGCTGGGGGAGGG + Intergenic
1099643213 12:85318021-85318043 GCGGAAGACAGGCTGGGGGAGGG - Intergenic
1100563837 12:95775615-95775637 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
1101524869 12:105519571-105519593 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1102371081 12:112382544-112382566 GCGGAGGTCAGGCCGAGGGCAGG - Intergenic
1102461768 12:113104266-113104288 GCGGATGTGAGACACGGGGATGG + Exonic
1103742302 12:123099109-123099131 GGGGAACTCAGCCCCTGGGATGG - Intronic
1104323039 12:127770222-127770244 GCGGAAGTCAGCCACGGGGTTGG - Intergenic
1106112328 13:26787753-26787775 GGGGAAGGCAGTCCAGGGGAAGG - Intergenic
1106867689 13:33985091-33985113 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1107433050 13:40356707-40356729 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1107486164 13:40829235-40829257 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1107973746 13:45669780-45669802 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1111765014 13:92517112-92517134 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
1111782991 13:92752894-92752916 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
1112331204 13:98478270-98478292 GGGGAGGACAGGCTCGGGGAGGG - Intronic
1112745463 13:102522435-102522457 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1112980839 13:105382814-105382836 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1113206817 13:107926267-107926289 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1114170008 14:20262746-20262768 GAGGAAGTCAGGGTGGGGGAGGG + Intronic
1114171844 14:20280465-20280487 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
1114422278 14:22594357-22594379 AAGGAAGTCAGCCCCGGGAAAGG + Intergenic
1114751558 14:25210124-25210146 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
1115723172 14:36184968-36184990 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1115977955 14:39017597-39017619 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1116038351 14:39656295-39656317 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1116042591 14:39703300-39703322 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
1116156719 14:41214924-41214946 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1116322831 14:43492594-43492616 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1116331081 14:43598318-43598340 GCAGAAGCCAGGCTGGGGGAGGG + Intergenic
1116570396 14:46508977-46508999 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1116667330 14:47795044-47795066 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1117577344 14:57112629-57112651 GCGGCAGCGAGGCTCGGGGAGGG + Intergenic
1118483357 14:66189436-66189458 GTGGAAGTGAGGCTGGGGGAGGG - Intergenic
1118736032 14:68702594-68702616 GCAGAAGGAAGGCCAGGGGAGGG + Intronic
1119419975 14:74502747-74502769 GGGGAAGGCAGGCTCAGGGACGG + Exonic
1119421532 14:74510392-74510414 GCTGAAGTGAGCCCGGGGGATGG - Intronic
1119726940 14:76927091-76927113 GCAGAAGTCAGGCCCAGAGAAGG - Intergenic
1120371308 14:83639728-83639750 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1122376804 14:101266615-101266637 GCGGCAGCGAGGCCGGGGGAGGG + Intergenic
1122636518 14:103132168-103132190 CTGGGAGTCAGGCGCGGGGATGG - Intronic
1123136457 14:106031809-106031831 ACGGGAGTCAGGCTGGGGGACGG + Intergenic
1124152434 15:27193431-27193453 GCGGCAGTGAGGCTGGGGGAGGG - Intronic
1124669269 15:31623472-31623494 GCGGCAGTGAGGCTGGGGGAGGG - Intronic
1124729510 15:32183843-32183865 GCGGCAGTGAGGCTAGGGGAGGG + Intergenic
1124999326 15:34754552-34754574 CTGGAAGTGCGGCCCGGGGAGGG - Exonic
1126493495 15:49265283-49265305 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
1126922255 15:53541047-53541069 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
1126933853 15:53684614-53684636 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
1127021104 15:54749672-54749694 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1127193733 15:56561817-56561839 GCTGAAGCCTGGCCGGGGGAGGG + Intergenic
1128389628 15:67174306-67174328 GCTGAAGTCATGCCAGTGGATGG + Intronic
1129171912 15:73813062-73813084 GAGGAACTCAGACCCAGGGAGGG + Intergenic
1129796512 15:78381658-78381680 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1130190501 15:81730698-81730720 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1130922266 15:88357484-88357506 GCGGCAGTGAGGCTAGGGGAGGG + Intergenic
1131038860 15:89243939-89243961 GCGGAAGTGAGCCGCGGGGGCGG + Intronic
1131283646 15:91040201-91040223 GAGGAAGCCAGGCCTGGGGATGG - Intergenic
1132216707 15:100068186-100068208 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
1132621892 16:871687-871709 GCCGGGGTCATGCCCGGGGAAGG + Intronic
1132870092 16:2112107-2112129 GCAAGAGCCAGGCCCGGGGAGGG + Intronic
1133045876 16:3088068-3088090 CAGGAAGCCAGGCCTGGGGAAGG - Intergenic
1133155567 16:3872890-3872912 GTGGGAGGCAGGCCCTGGGATGG - Intronic
1133250318 16:4476502-4476524 GCGGAAGGAAGGCCCCGGGAGGG - Intronic
1133802156 16:9092437-9092459 GCGGGAGGGAGGCCCGGGGTTGG + Intronic
1134253541 16:12592172-12592194 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1134313467 16:13097221-13097243 GAGGAATTGAGGCCCAGGGAAGG + Intronic
1134765098 16:16750749-16750771 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1135864852 16:26091943-26091965 GCAGAAGTCAAGCCCCAGGAGGG - Intronic
1136230496 16:28882900-28882922 GGGGAAGCCAGGCCCGGGAGGGG - Intronic
1136604653 16:31325231-31325253 GAAGAAGACAGGCCGGGGGATGG - Intronic
1136652835 16:31687626-31687648 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1136745660 16:32587958-32587980 GCGGCAGCGAGGCTCGGGGAGGG - Intergenic
1136771148 16:32842390-32842412 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1136872934 16:33824773-33824795 GCTGCAGCCACGCCCGGGGAAGG + Intergenic
1136899427 16:34019092-34019114 GCGGCAGTGAGGCTGGGGGAAGG + Intergenic
1137001047 16:35231329-35231351 GCGGTAGTGAGGCTGGGGGAGGG - Intergenic
1138785081 16:59836408-59836430 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1139435709 16:66935404-66935426 GTGGTAGGCAGGCCCGGGCACGG - Exonic
1139438096 16:66948452-66948474 GTGGTAGGCAGGCCCGGGCACGG - Intergenic
1139468114 16:67164852-67164874 GAGGAAGGCAGGCACGGGGCTGG - Exonic
1139505499 16:67396323-67396345 GGGGAAAGCAGGCCCGGGAAGGG + Intronic
1140054137 16:71510890-71510912 GCGGCAGCAAGGCTCGGGGAGGG - Intronic
1141047340 16:80727502-80727524 GTGGAAGCGAGGCTCGGGGAGGG + Intronic
1141815148 16:86404689-86404711 GCGGAAGTCAGTTCGGGGGGGGG - Intergenic
1141973378 16:87497198-87497220 GCAGGAGTCAGGCCAAGGGAAGG - Intergenic
1203047788 16_KI270728v1_random:847163-847185 GCGGCAGCGAGGCTCGGGGAGGG - Intergenic
1203073571 16_KI270728v1_random:1104503-1104525 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1203099236 16_KI270728v1_random:1291281-1291303 GCTGCAGCCACGCCCGGGGAAGG - Intergenic
1143257589 17:5573250-5573272 GCGGCAGTGAGGCGGGGGGAGGG + Intronic
1143527277 17:7479766-7479788 GCGGGGGTCAGTCCTGGGGAAGG - Intronic
1143628907 17:8126030-8126052 GCGGAGGTGCGGGCCGGGGACGG - Intergenic
1144836288 17:18158277-18158299 GCGGAAGTCAACCCCGGGCAAGG + Intronic
1145716611 17:27029016-27029038 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1147260855 17:39209205-39209227 GAGGAAGCCAGGGCAGGGGAGGG + Intergenic
1147774969 17:42894276-42894298 GAAGAAGGCAGGCCCTGGGATGG + Intergenic
1150150906 17:62808248-62808270 GCGGAAAGCAGCCTCGGGGAAGG - Exonic
1150389769 17:64783598-64783620 GCAGGAGTCTGGCCTGGGGAGGG - Intergenic
1151499635 17:74480557-74480579 GCAGACCTCAGGCACGGGGATGG + Intronic
1152353803 17:79797383-79797405 CCGGAAGTGACGCCAGGGGAAGG + Intronic
1153105546 18:1521801-1521823 GCGGCAGCCAGGCTTGGGGAGGG - Intergenic
1154401570 18:14043295-14043317 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1155597968 18:27510427-27510449 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1155675290 18:28422129-28422151 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
1155898019 18:31353557-31353579 GCGGCAGTGAGGCTGGGGGAGGG - Intronic
1156224480 18:35090439-35090461 GAGGAACTCAGGGCCGGGCATGG + Intronic
1156294873 18:35780410-35780432 AAGGAAGTCAGTCCTGGGGATGG + Intergenic
1156678963 18:39566010-39566032 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1157452871 18:47801272-47801294 CCGGTGGTCAGGCCAGGGGAGGG - Intergenic
1157701218 18:49762474-49762496 GCGGAAGCTTGGCCCGGGGGTGG + Intergenic
1157706659 18:49813402-49813424 GCGGAGGCCTGGCCTGGGGAGGG + Intronic
1158100183 18:53821319-53821341 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1158834500 18:61316299-61316321 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1159051213 18:63422617-63422639 GCGGAAGTCGGGCTCGGCGCAGG + Intergenic
1160299279 18:77665563-77665585 GGGGAAGTCAGGACAGTGGAAGG + Intergenic
1160628289 18:80228302-80228324 GCGGAGGGGAGGCCAGGGGAGGG + Intronic
1160875647 19:1295226-1295248 GGGGAAGTCAGGCCGGGGAATGG - Intronic
1160921746 19:1523989-1524011 GCGCAGGTCCAGCCCGGGGAGGG - Intergenic
1161681595 19:5682365-5682387 GGGGTGGTCAGGCCCGGGGTAGG + Intronic
1161776897 19:6268438-6268460 TAGGAAGACAGCCCCGGGGAGGG + Intronic
1163641708 19:18465889-18465911 GGGGCAGTCAGGCTGGGGGATGG + Exonic
1163974885 19:20841424-20841446 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
1164429903 19:28178001-28178023 GCGGCAGTGAGGCTGGGGGAAGG + Intergenic
1164695056 19:30237285-30237307 GCGAAAGTCTGTCCCGGGGAAGG - Intronic
1165549733 19:36573661-36573683 CCGGAAGCCCGGGCCGGGGAGGG + Intronic
1165742098 19:38210707-38210729 GCGGGAGCCGGGCCGGGGGAAGG - Intergenic
1165742508 19:38212151-38212173 GCTGAAGTCAGGCCCGGGTCCGG + Intronic
1165901928 19:39173249-39173271 GCCGACATCAGGCCCGGAGAGGG - Exonic
1166054327 19:40279483-40279505 GCTGAAGAGAGGCCCGGGGAGGG + Intronic
1166446605 19:42863245-42863267 GTGGCAGTGAGGCTCGGGGAGGG - Intronic
1166499841 19:43332486-43332508 GCAGAGGTCAGCCCTGGGGAGGG - Intergenic
1166584576 19:43934535-43934557 TCAGAAGTCAGGGCAGGGGAAGG + Exonic
925602785 2:5626251-5626273 GCAAAAGTCAGGGCCGGGCATGG + Intergenic
925918627 2:8624574-8624596 GCTGAACACAGCCCCGGGGAAGG + Intergenic
926075851 2:9942174-9942196 GCGCAAGGCAGGGCGGGGGATGG - Intergenic
926101917 2:10123177-10123199 GCGGGAGGCAGCCCTGGGGAGGG - Intronic
926121114 2:10241571-10241593 GCGGAAGTTTGGCCAAGGGAGGG - Intergenic
926140365 2:10364543-10364565 GAGGCCGTCAGGGCCGGGGAGGG - Intronic
926658771 2:15439935-15439957 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
927283892 2:21336357-21336379 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
927334757 2:21908905-21908927 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
927867213 2:26597805-26597827 GTGGAAATGAGGCCTGGGGAAGG + Intronic
929137379 2:38637680-38637702 GAGGAAGGCAGGCCTGGGGGCGG + Intergenic
930489071 2:52045112-52045134 GCGGCAGTGAGGCTTGGGGAGGG - Intergenic
930803063 2:55462564-55462586 GCGGCAGCCTGGCTCGGGGAGGG + Intergenic
930972927 2:57419125-57419147 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
930987594 2:57609254-57609276 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
931109256 2:59092448-59092470 GCGGCAGTAAGGCTTGGGGAGGG - Intergenic
931818648 2:65929902-65929924 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
931843378 2:66177589-66177611 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
931846224 2:66206736-66206758 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
931864163 2:66391547-66391569 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
932990603 2:76781340-76781362 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
932991705 2:76796221-76796243 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
933579014 2:84104053-84104075 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
933590291 2:84225158-84225180 GCAGCAGTGAGGCTCGGGGAGGG + Intergenic
934649594 2:96083395-96083417 GGGGAAGTCAGGCCTGGCGCCGG + Intergenic
934806436 2:97231346-97231368 GCGGCAGTGAGGCTGGGGGAGGG - Intronic
935450249 2:103200975-103200997 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
936945180 2:117923549-117923571 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
937064056 2:119004041-119004063 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
937244989 2:120486769-120486791 GCTCAAGCCAGGCCCAGGGAAGG - Intergenic
937592308 2:123629133-123629155 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
939239373 2:139538534-139538556 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
939807229 2:146788820-146788842 GCGGCAGTGAGGCTGGGGGAAGG + Intergenic
939924334 2:148154519-148154541 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
940095167 2:149966153-149966175 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
940720746 2:157279532-157279554 GCGGCAGCCTGGCTCGGGGAGGG - Intronic
941553151 2:166941152-166941174 GCGGCAGTGAGGCTGGGGGAGGG - Intronic
942723628 2:178982869-178982891 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
942991964 2:182212821-182212843 GCGGCAGGGAGGCCAGGGGAGGG + Intronic
943549328 2:189319599-189319621 GCAGCAGCCAGGCTCGGGGAGGG + Intergenic
943652422 2:190471524-190471546 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
943882954 2:193171123-193171145 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
944077070 2:195744292-195744314 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
944257648 2:197640322-197640344 GCGGCAGTGAGGCTGGGGGAGGG - Intronic
944615155 2:201451945-201451967 ACGGGAGGCAGGCCCGGGAAGGG + Intronic
945822705 2:214684190-214684212 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
946019983 2:216634109-216634131 GCGGAAGTCAGGCCCGGGGAGGG + Intronic
946245378 2:218384271-218384293 GAGGAAGCCAGGCCCCGTGAAGG - Exonic
947395923 2:229686612-229686634 GCAGAAGACAGGCCTGGGTAGGG - Intronic
948196875 2:236103192-236103214 GCGGAGGTGAGGCCGGAGGATGG - Intronic
948211543 2:236196750-236196772 GAGGAAGTTTGGCCCGAGGATGG + Intronic
948427404 2:237896446-237896468 GAGGAAGCCAGGCCCAGGGAGGG + Intronic
1168800915 20:642691-642713 CGGGGGGTCAGGCCCGGGGAAGG + Intergenic
1169283657 20:4289438-4289460 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1170693853 20:18639519-18639541 GTGGAAGTCAGGACTGGAGAAGG + Intronic
1171185209 20:23120039-23120061 GCGGCAGGCAGGCCTGGGCAGGG - Intergenic
1171281442 20:23902561-23902583 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1171454624 20:25260912-25260934 GCGGCAGTGAGGCTTGGGGAGGG + Intronic
1171763360 20:29233453-29233475 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1171941384 20:31333129-31333151 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1172106356 20:32519462-32519484 GCTGAAGTCAGGCCCGAGGATGG - Intronic
1172444953 20:34988026-34988048 GGGAAAGGGAGGCCCGGGGAGGG - Intronic
1173874894 20:46364223-46364245 GCGAAACTGAGGCCCGGGGAGGG + Intronic
1175394920 20:58651274-58651296 GCTGCAGTCAGATCCGGGGATGG + Exonic
1177116321 21:17090933-17090955 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1179292852 21:40033579-40033601 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
1180078399 21:45474987-45475009 GGGCAAGACAGGCCAGGGGAGGG - Intronic
1180504922 22:15985678-15985700 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1180885350 22:19239651-19239673 TCGGCATCCAGGCCCGGGGAGGG - Intronic
1181047886 22:20224166-20224188 GCGGTGGTCAGGCCCGGGGATGG + Intergenic
1181531817 22:23521522-23521544 GGGGAGGTCAGGCTCCGGGAGGG + Intergenic
1182165022 22:28164078-28164100 GCGGAAGCGAGGCTGGGGGAGGG + Intronic
1182209594 22:28663701-28663723 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
1185227782 22:49662983-49663005 GCGGAAGCCAGAGCTGGGGAGGG + Intergenic
1185284491 22:49994220-49994242 GCGGAGGTCAGGCCAGGTGAGGG - Intergenic
1203333738 22_KI270739v1_random:36368-36390 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
949154293 3:809794-809816 GCGGCAGCGAGGCCGGGGGAGGG + Intergenic
949926710 3:9047669-9047691 GCGGAGGCCAGGCCCTTGGAGGG + Intronic
950299874 3:11867712-11867734 GCGGCAGCCAGGCTCGGGGAGGG - Intergenic
950416742 3:12873183-12873205 GTGAAAGCCAGGCCTGGGGAAGG - Intergenic
951071185 3:18330868-18330890 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
951532385 3:23710001-23710023 GAGGAAGTCAGGGCCTGGGCAGG - Intergenic
951818577 3:26783514-26783536 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
952099450 3:29994334-29994356 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
952936907 3:38405813-38405835 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
953919638 3:46943097-46943119 GGGGAAGGCAGGCCCTGGGGTGG + Intronic
954331259 3:49891591-49891613 GCGCAAGTCAGGCACAGGGCAGG + Intronic
954492698 3:50922263-50922285 GAGGCAGTGAGGCCAGGGGAGGG - Intronic
955427458 3:58806997-58807019 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
955481603 3:59395575-59395597 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
955975558 3:64476213-64476235 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
956242719 3:67148061-67148083 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
956455979 3:69420950-69420972 GAGGAAGTCAGGGACGGAGAGGG + Intronic
956795598 3:72716056-72716078 GCGGCAGTGAGGCTTGGGGAGGG - Intergenic
957207449 3:77216283-77216305 GCGGCAGTGAGGCTGGGGGAGGG - Intronic
957344579 3:78944946-78944968 GCGGCAGTGAGGCTTGGGGAGGG + Intronic
958512405 3:95065518-95065540 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
958697683 3:97547774-97547796 GCGGCAGTGAGGCTGGGGGAGGG - Intronic
958726347 3:97910335-97910357 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
959103492 3:102040343-102040365 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
959353413 3:105296637-105296659 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
960074797 3:113472212-113472234 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
960557515 3:119045548-119045570 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
960753176 3:120979259-120979281 GCGGCAGTGAGGCTGGGGGAGGG - Intronic
961303428 3:125937055-125937077 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
961664804 3:128488574-128488596 GCGAAGGCCACGCCCGGGGAGGG - Intronic
961713574 3:128844712-128844734 GTGGAAGCCAGGCCTGGGGAGGG + Intergenic
961958788 3:130832238-130832260 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
967339244 3:188378420-188378442 GCGGCAGTGAGGCTGGGGGAGGG - Intronic
968048131 3:195635398-195635420 GCGGAGGTCGGGGCAGGGGACGG - Intergenic
968099271 3:195954222-195954244 GCGGAGGTCGGGGCAGGGGACGG + Intergenic
968306480 3:197654523-197654545 GCGGAGGTCGGGGCAGGGGACGG + Intergenic
968388850 4:171551-171573 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
968603280 4:1520395-1520417 GCGGAAGCCAGGCTCGGGGAGGG + Intergenic
969365181 4:6690084-6690106 GAGGAACTCATGCCCGGGAAGGG - Intergenic
969444232 4:7234976-7234998 GGGGAACTTAGGCCTGGGGAAGG + Intronic
970241600 4:14015047-14015069 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
970982984 4:22123430-22123452 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
971116083 4:23647332-23647354 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
972849025 4:43025684-43025706 GTGGAAGTCAGGGCCGGGCGCGG + Intronic
973332435 4:48923442-48923464 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
973984451 4:56336950-56336972 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
974119789 4:57624846-57624868 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
974673168 4:65057762-65057784 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
974682041 4:65177006-65177028 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
975062420 4:70019236-70019258 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
975150157 4:71012200-71012222 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
975187356 4:71419407-71419429 GCGGCAGTGAGGCTGGGGGAGGG - Intronic
975522323 4:75313863-75313885 GCGGCAGTGAGGCTGGGGGAAGG + Intergenic
975531257 4:75401613-75401635 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
975806516 4:78118526-78118548 GCGGCAGTGAGGCTGGGGGAGGG - Intronic
976574765 4:86656932-86656954 GCGGCAGCGAGGCTCGGGGATGG - Intronic
977333248 4:95664120-95664142 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
978677520 4:111337363-111337385 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
979634849 4:122945356-122945378 GCGGCAGTGAGGCTGGGGGAGGG - Intronic
979999693 4:127473104-127473126 GCGGCAGTGAGGCTTGGGGAGGG + Intergenic
980631934 4:135447954-135447976 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
981100661 4:140826056-140826078 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
981687554 4:147471507-147471529 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
982838858 4:160156896-160156918 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
983066176 4:163212528-163212550 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
984044357 4:174778875-174778897 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
985234931 4:187862479-187862501 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
985588006 5:750922-750944 GCGGGAGGCAGGCTCGGGGAGGG - Intronic
985602675 5:843389-843411 GCGGGAGGCAGGCTCGGGGAGGG - Intronic
985819433 5:2149616-2149638 GCGGGAGACAGGTCCGCGGATGG + Intergenic
986101503 5:4615844-4615866 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
986476081 5:8134845-8134867 GACGGAGGCAGGCCCGGGGAAGG + Intergenic
988253982 5:28799208-28799230 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
989186455 5:38631309-38631331 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
989623001 5:43402944-43402966 GCGGCAGTGAGGCTGGGGGAAGG + Intronic
989794052 5:45445314-45445336 GCGGCAGTGAGGCTAGGGGAGGG + Intronic
989824610 5:45838408-45838430 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
990340059 5:54813377-54813399 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
990911918 5:60860808-60860830 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
990913845 5:60881567-60881589 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
991167596 5:63582211-63582233 GCCGCAGTGAGGCTCGGGGAGGG + Intergenic
991265670 5:64714627-64714649 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
992576464 5:78118607-78118629 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
992675415 5:79101470-79101492 GCGGCAGTGAGGCTGGGGGAGGG - Intronic
994693557 5:103047157-103047179 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
995347763 5:111140230-111140252 GAGGAAGTCAGGCCAGGCGCAGG + Intergenic
996625752 5:125568390-125568412 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
996654843 5:125924124-125924146 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
997080475 5:130732511-130732533 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
997117257 5:131138622-131138644 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
997591272 5:135074049-135074071 TCAGAAGTCAGGCCGGGTGAGGG + Intronic
997744772 5:136289577-136289599 GTGGAAGTGAGGCTGGGGGAGGG + Intronic
997808849 5:136947137-136947159 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
998230227 5:140357111-140357133 GTGGAAGTGAGACCTGGGGAGGG + Intergenic
998241719 5:140452154-140452176 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
999858542 5:155620890-155620912 GCAGAAGCCAGGCCTGGGGGTGG + Intergenic
1000267000 5:159647397-159647419 GATGAAGACAGGCCAGGGGAAGG - Intergenic
1000404590 5:160873939-160873961 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1000544179 5:162578452-162578474 GCGGCAGTGAGGCTGGGGGATGG + Intergenic
1001083455 5:168683744-168683766 GAGGAAGGCAGGCCCGCAGAGGG - Intronic
1002098948 5:176847965-176847987 ATGGAGGTCAGGCCCAGGGAAGG + Intronic
1002661394 5:180792985-180793007 GGGGAGGGCAGGCCAGGGGACGG + Exonic
1002922254 6:1581015-1581037 GAGGGAGTCAGGCCTGGGGCGGG + Intergenic
1007721447 6:43887665-43887687 GCAGTGGTCAGGCCTGGGGAAGG + Intergenic
1008163134 6:48102887-48102909 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1008183522 6:48363508-48363530 GCGGCAGCCAGGCTGGGGGAAGG + Intergenic
1009623041 6:66100365-66100387 GAGGAAGGCATGCCTGGGGAGGG - Intergenic
1010137306 6:72570555-72570577 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1010441982 6:75905309-75905331 GCGGCAGTGAGGCTGGGGGAGGG - Intronic
1010679610 6:78783547-78783569 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1011397134 6:86921584-86921606 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1011435183 6:87328839-87328861 GCGGCAGTGAGGCTGGGGGAGGG - Intronic
1012220020 6:96638174-96638196 GCAGCAGCCAGGCCGGGGGAGGG + Intergenic
1012285431 6:97382266-97382288 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
1012854831 6:104489810-104489832 GCGGCAGCGAGGCCGGGGGAGGG + Intergenic
1013197702 6:107860307-107860329 GCGGCAGCCAGGCACGGGGAGGG - Intergenic
1013467593 6:110430885-110430907 CTGGAAGCCAGGCCTGGGGAAGG - Intronic
1014357697 6:120433006-120433028 GCGGCAGCGAGGCTCGGGGAGGG + Intergenic
1015112724 6:129611190-129611212 ACGGAAGTCAGGGCCGGGCGTGG - Intronic
1016226589 6:141746439-141746461 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1017394312 6:153979338-153979360 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1018020892 6:159761816-159761838 GCGGAAGTGAGGCCGGGGTCTGG - Exonic
1018020904 6:159761847-159761869 GCGGAAGTGAGGCCGGGGCGCGG - Exonic
1019437547 7:1029791-1029813 GCCGGAGTCAGGCCTGGGGCTGG + Intronic
1019913224 7:4114264-4114286 GCGGGAGTCAGGTGAGGGGAAGG + Exonic
1020084127 7:5301525-5301547 GCGGCACTGAGGCCAGGGGATGG + Intronic
1020133118 7:5570539-5570561 GCGGGGGTCAGTCCCTGGGAGGG - Intergenic
1020140353 7:5608203-5608225 GGGGAAGCCAGGCCAGGGGCCGG + Intergenic
1020922173 7:14279286-14279308 GCGGCAGCCAGGCGGGGGGAGGG + Intronic
1021047415 7:15940646-15940668 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1021069274 7:16216845-16216867 GCGGCAGCGAGGCCGGGGGAGGG + Intronic
1021201744 7:17735116-17735138 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1021302598 7:18990635-18990657 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
1022531775 7:31071370-31071392 GAGGAATTCAGGCCCAGGGGTGG - Intronic
1022533651 7:31082565-31082587 GAGGAAATGAGGCCCAGGGAGGG + Intronic
1024694285 7:51839049-51839071 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1024916376 7:54504446-54504468 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1024980099 7:55151213-55151235 GCTTAACTCAGGCCCGGGAAAGG + Intronic
1025210156 7:57015671-57015693 GCGGCACTGAGGCCAGGGGACGG - Intergenic
1026836987 7:73646189-73646211 GCCAAAGACAGCCCCGGGGAGGG + Intergenic
1027200869 7:76063177-76063199 GAGGATGCCAGGCCCGGGGGGGG + Intronic
1027639264 7:80713524-80713546 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1027982977 7:85250272-85250294 GCGGCAGCCAGGCCGGGGGGGGG + Intergenic
1028114494 7:86982088-86982110 GCGGCAGCCTGGCTCGGGGAGGG + Intronic
1029128636 7:98313065-98313087 GCTGATGTCAGTCCTGGGGAAGG + Intronic
1029313156 7:99686439-99686461 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
1029375039 7:100172047-100172069 GTGGAGGTGAGGCCCGGGGCGGG - Intronic
1030792175 7:113743318-113743340 GCGGAAGCGAGGCTGGGGGAGGG + Intergenic
1031617140 7:123894916-123894938 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1031922659 7:127613190-127613212 GAGGATGTCAGGCCCAAGGAAGG - Intronic
1031963080 7:128007072-128007094 GCGGATGCCAGGCCTGGAGAAGG + Intronic
1032944256 7:136831606-136831628 GCGGCAGTGAGGCGGGGGGAGGG + Intergenic
1033883960 7:145921440-145921462 GTAGAAGTCAGGGCCGGGCATGG - Intergenic
1034371897 7:150606017-150606039 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1037145001 8:15561591-15561613 GCGGCAGTGAGGCTGGGGGAGGG - Intronic
1037458330 8:19084721-19084743 GCAGAAGGCAGGCCCTGAGACGG - Intronic
1038928970 8:32171780-32171802 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
1039326406 8:36490095-36490117 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1040553980 8:48462928-48462950 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1041912445 8:63103252-63103274 GAGGAAGTCAGCACCGGGAATGG + Intergenic
1041949958 8:63489897-63489919 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1041976283 8:63803000-63803022 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1042087106 8:65121055-65121077 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1043048770 8:75359566-75359588 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1044209647 8:89535648-89535670 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1044272576 8:90264524-90264546 GCGGCAGTGAGGCTGGGGGATGG + Intergenic
1044282777 8:90375855-90375877 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1045450259 8:102317367-102317389 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
1046322237 8:112594422-112594444 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
1046812604 8:118548956-118548978 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
1046879218 8:119290034-119290056 GCGGCAGCCTGGCTCGGGGAGGG - Intergenic
1047840347 8:128745030-128745052 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1048449612 8:134522178-134522200 GAGGATGCCAGGCCCGGGCAGGG + Intronic
1049161825 8:141102910-141102932 GCAGGAGTTAGGACCGGGGAGGG + Intergenic
1049364999 8:142232859-142232881 GCGGAAGTTGGGGTCGGGGAGGG - Intronic
1049899008 9:140067-140089 GCGGCAGCGAGGCTCGGGGAGGG + Intronic
1050047124 9:1558851-1558873 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1050370909 9:4920750-4920772 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1051005098 9:12334419-12334441 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1051203913 9:14664413-14664435 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
1051458748 9:17290596-17290618 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
1052373381 9:27690935-27690957 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1053393720 9:37753782-37753804 GCGGAAGCGAGGCCGGGGGCGGG + Intronic
1053714562 9:40874006-40874028 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1054889365 9:70234429-70234451 GCGGCAGTGAGGCAGGGGGAGGG + Intergenic
1055321746 9:75088820-75088842 TCGGAAGCCAGGCTCGGGGCCGG - Intronic
1055333489 9:75208216-75208238 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
1055476812 9:76670456-76670478 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
1055827552 9:80345297-80345319 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1055860814 9:80747253-80747275 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
1056443861 9:86645652-86645674 GCGGATGCCAGGCCCTGGCAGGG + Intergenic
1058192987 9:101941114-101941136 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1059655920 9:116357503-116357525 GCAGAAAGAAGGCCCGGGGAGGG + Intronic
1060892771 9:127199123-127199145 GCCGAAGACAGGCCCCGGGCAGG + Intronic
1061422962 9:130482055-130482077 GCGGAAGCCAGGGCTGGGGAGGG + Intronic
1061802827 9:133121374-133121396 GCCGAGGTCAGACCCGGGGCGGG + Intronic
1062356517 9:136167005-136167027 ACTGAAGTCAGGGCCGGGCACGG + Intergenic
1062621189 9:137423255-137423277 GCGGAAGTCCGGCCGGGGCGGGG + Exonic
1062716637 9:138013823-138013845 GGGGAGGTCAGTCCCTGGGAAGG + Intronic
1203747012 Un_GL000218v1:45421-45443 GGAGAGGTCAGGACCGGGGAAGG - Intergenic
1186909168 X:14143293-14143315 GAGAAAGGCAGGCCTGGGGAAGG + Intergenic
1187116804 X:16360497-16360519 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1187453217 X:19417476-19417498 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
1188123112 X:26334408-26334430 GCGACAGCCAGGCTCGGGGAGGG + Intergenic
1189049949 X:37634145-37634167 GCGGCAGTGAGGCTGGGGGAGGG - Intronic
1189062459 X:37769030-37769052 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
1190358209 X:49625761-49625783 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1191649326 X:63519539-63519561 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1191704929 X:64084566-64084588 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
1191768353 X:64727429-64727451 GTGGAAGGCAGGCATGGGGACGG - Intergenic
1191834959 X:65454413-65454435 GCGGCAGTGAGGCAGGGGGAGGG + Intronic
1192376723 X:70570118-70570140 GCGGCAGCGAGGCCGGGGGAGGG - Intronic
1192383320 X:70639323-70639345 GCGGCAGTGAGGCTGGGGGAGGG + Intronic
1192716151 X:73644592-73644614 GCGGCAGTGAGGCTGGGGGAGGG - Intronic
1192755148 X:74039646-74039668 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1192877539 X:75247514-75247536 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1192909378 X:75586922-75586944 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1192954310 X:76052501-76052523 GTGGAAGCCAGGCTGGGGGAGGG - Intergenic
1193045239 X:77046645-77046667 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1193088708 X:77471051-77471073 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1193896119 X:87116725-87116747 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1194761745 X:97803623-97803645 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1194924248 X:99805616-99805638 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1195163678 X:102196765-102196787 GAGGAAGTGAGGCTGGGGGAGGG - Intergenic
1195445750 X:104950558-104950580 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
1195517820 X:105797325-105797347 GCGGCAGCCAGGCTTGGGGAGGG + Intergenic
1195639346 X:107156184-107156206 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
1195987442 X:110645723-110645745 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1196473232 X:116052488-116052510 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1196909587 X:120472190-120472212 TCTGAAGTCAGGCCTGGGCATGG + Intergenic
1197226369 X:123960287-123960309 GAGTAAGTCAGGCGCGGGCACGG + Intronic
1197438382 X:126460362-126460384 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1197624120 X:128783072-128783094 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1197649016 X:129044636-129044658 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1197861632 X:130977544-130977566 GCGGAACTGAGGCCCAGTGAGGG - Intergenic
1198057585 X:133010081-133010103 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1198581827 X:138073829-138073851 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1198643217 X:138778721-138778743 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
1199481731 X:148305424-148305446 GCGGCAGTGAGGCTGGGGGAGGG - Intergenic
1199936796 X:152582319-152582341 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1200071437 X:153531292-153531314 TCGTAGGTCAGGCCCGGGGTGGG - Intronic
1201160340 Y:11160435-11160457 GGGGAGGTCAGGACCGGGGGAGG - Intergenic
1201410216 Y:13691754-13691776 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1201739846 Y:17312052-17312074 GCGGCAGTGAGGCTGGGGGAGGG + Intergenic
1201954956 Y:19613408-19613430 GCGGCAGCCAGGCTAGGGGAGGG + Intergenic
1202014505 Y:20386269-20386291 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic