ID: 946021916

View in Genome Browser
Species Human (GRCh38)
Location 2:216646213-216646235
Sequence ATGGAGAAGAGGACAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 876
Summary {0: 1, 1: 0, 2: 4, 3: 72, 4: 799}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946021907_946021916 29 Left 946021907 2:216646161-216646183 CCTGTGGGTTCAATTTGTCAGGC 0: 1
1: 0
2: 0
3: 8
4: 73
Right 946021916 2:216646213-216646235 ATGGAGAAGAGGACAGTGGAAGG 0: 1
1: 0
2: 4
3: 72
4: 799
946021909_946021916 7 Left 946021909 2:216646183-216646205 CCTGGAATATCTGAGAGCAGAGT 0: 1
1: 0
2: 1
3: 14
4: 202
Right 946021916 2:216646213-216646235 ATGGAGAAGAGGACAGTGGAAGG 0: 1
1: 0
2: 4
3: 72
4: 799

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946021916 Original CRISPR ATGGAGAAGAGGACAGTGGA AGG Intronic
900001767 1:18385-18407 ATGGAGAAGATCACAGAGGCTGG + Intergenic
900021487 1:188908-188930 ATGGAGAAGATCACAGAGGCTGG + Intergenic
900034611 1:396595-396617 CTAGAGAAAAGGACAGTGAATGG + Intergenic
900055442 1:626483-626505 CTAGAGAAAAGGACAGTGAATGG + Intergenic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900212304 1:1462148-1462170 ATGGAGCAGGCGGCAGTGGAGGG - Intronic
900558857 1:3293795-3293817 ATGGAGAAGCCGACAAAGGATGG - Intronic
900625691 1:3607573-3607595 ATGGAGAAGGTGGCAGGGGAAGG + Intronic
900816321 1:4849236-4849258 ATAGATAAATGGACAGTGGATGG - Intergenic
900913280 1:5617274-5617296 AAGGAGAGGTGCACAGTGGAGGG + Intergenic
901325598 1:8363460-8363482 AAGGGGCAGAGGAAAGTGGATGG + Intronic
901435380 1:9244449-9244471 ATGGAGAAGAGGCAAGTGAGAGG + Intronic
901669859 1:10849835-10849857 ATAGGGAAGTGGACAGTGGAAGG + Intergenic
901773474 1:11543198-11543220 GTGGAGAGGAGGCCTGTGGAAGG - Intergenic
901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG + Intergenic
902231266 1:15029193-15029215 ATGGTGAGGAGGAGGGTGGATGG + Intronic
902417711 1:16251250-16251272 ATGGACAATAGGACAGTTGGGGG - Exonic
902550604 1:17217005-17217027 AAGGAGGAGAGGAGAGGGGAGGG + Intronic
902714900 1:18265885-18265907 CTGGAGAAAATGCCAGTGGAAGG - Intronic
903130013 1:21272923-21272945 AAGGACAAGAGGCCAGTGAAGGG + Intronic
903186849 1:21633898-21633920 AGTGAGAAGAGGGCTGTGGAGGG + Intronic
904807272 1:33140861-33140883 AAGGAGAAGGGGAGAGAGGAGGG - Intergenic
905043496 1:34978616-34978638 ATGGAGAACAGAATAGAGGAAGG - Intergenic
905347732 1:37322614-37322636 CTGGAGAAGAGGACACTTGCTGG - Intergenic
905360881 1:37419558-37419580 AGGGAGAGGATCACAGTGGAGGG - Intergenic
905397694 1:37677639-37677661 ATGGGGAGGAGGACAGTGCCTGG + Intergenic
906783911 1:48597443-48597465 ATGGTGAATAACACAGTGGATGG + Intronic
906947962 1:50311514-50311536 AGGGAGAAGAGGTCAGAGTAGGG + Intergenic
907112129 1:51935791-51935813 AAGGGGAAGAGAACAGAGGAAGG + Intronic
907308204 1:53525282-53525304 ATGGGGAGGAGGAGAGGGGAAGG + Intronic
907378793 1:54067545-54067567 AAGGAAAAGAGGAAAGGGGAAGG - Intronic
907382030 1:54098947-54098969 CTGGAGTAGAGGACACTGGCAGG + Exonic
907423926 1:54366633-54366655 ATGCACAGGAGGACAGTGAAGGG + Intronic
908312234 1:62895898-62895920 ATGGAGATGAGGACATCGGTGGG + Intergenic
908420768 1:63956354-63956376 AAGCTGAAGAGGAAAGTGGATGG + Intronic
908423035 1:63978193-63978215 AAGGAGAAGAGGAAAGTAAACGG + Intronic
909583397 1:77262941-77262963 GGGGAGGAGAGGACAGGGGAGGG - Intergenic
909687566 1:78367979-78368001 AAGGAGAGGAGGGCAGGGGAGGG - Intronic
909855188 1:80520966-80520988 AGGGAGGGGAGGACAGGGGAGGG + Intergenic
910105939 1:83631232-83631254 GTGGAGAAGGGGCCAGAGGAAGG - Intergenic
910211693 1:84800251-84800273 ATGGAGCAGAGGAAGGGGGAAGG + Intergenic
910327219 1:86024086-86024108 AGGGAAATGAGGACAATGGAAGG - Intronic
910359196 1:86397326-86397348 AAGGAGAAGTGCCCAGTGGAGGG - Intergenic
910447929 1:87317689-87317711 ATGTAGGAGTGGACCGTGGAAGG + Intergenic
910660892 1:89671309-89671331 AAGGAGAAAAGGAAAGAGGAAGG + Intronic
910730724 1:90392937-90392959 TTGGGCAAGAGGAGAGTGGAGGG - Intergenic
910806340 1:91192676-91192698 GTGCAGAAGAGGATGGTGGAGGG + Intergenic
910946655 1:92599990-92600012 CTGGAGAAAAGGAAACTGGATGG + Intronic
910948303 1:92617366-92617388 TTGGAGAAGAGGTATGTGGATGG + Intronic
911207956 1:95111683-95111705 ATGGTGCAGTGGACTGTGGAAGG + Intergenic
911718690 1:101166202-101166224 ATAGAGAAGAGGCCAGAGGATGG - Intergenic
912226572 1:107741020-107741042 ATGAAAAAGAGGAGAGAGGAGGG + Intronic
912479647 1:109971738-109971760 ATGGAGAACAGATCAGTGGTTGG - Intergenic
912501452 1:110125218-110125240 TTGGAGAAGGGGGCAGTGGGAGG + Intergenic
912572991 1:110638103-110638125 ATGCCGAAGAGGAGAGGGGAGGG - Intergenic
912823740 1:112887201-112887223 AAGGTGGAGAGGTCAGTGGATGG - Intergenic
913214807 1:116611265-116611287 ATTAAGAAGAGGACAAAGGAAGG + Intronic
913344717 1:117796896-117796918 AAGGAGGACAGGGCAGTGGATGG - Intergenic
913598167 1:120397249-120397271 ATGGAGATGACCTCAGTGGATGG + Intergenic
913705174 1:121413843-121413865 AAGGAGAAGAGGACTGTAGAAGG + Intergenic
914089163 1:144482071-144482093 ATGGAGATGACCTCAGTGGATGG - Intergenic
914309449 1:146452144-146452166 ATGGAGATGACCTCAGTGGATGG + Intergenic
914592662 1:149120993-149121015 ATGGAGATGACCTCAGTGGATGG - Intergenic
914855206 1:151345679-151345701 ATGGAGAGGAGGGAAGTAGAGGG + Intronic
914915468 1:151816545-151816567 ATGGAGAGGAGACCAGAGGATGG + Intronic
915460998 1:156070600-156070622 ATGGTGGGGAGGACAGAGGAAGG - Intergenic
915463279 1:156082055-156082077 AGGGAAAAGAGGAGAGAGGAGGG + Intergenic
915494940 1:156275555-156275577 ATGGATAAGAGGACAGTCTCTGG - Intronic
915595441 1:156894007-156894029 GAGGGGAAGGGGACAGTGGAGGG + Intronic
916001800 1:160623630-160623652 TTGGAAGAGAGGACAGGGGATGG + Intronic
916005427 1:160655065-160655087 ATGGAGAAGAGGCAAGTGGATGG - Intergenic
916005430 1:160655084-160655106 ATGGAGAAGAGGTGGGTGGATGG - Intergenic
916166602 1:161971558-161971580 TTGGGGAAGAGGACAGTCCAGGG - Intergenic
916285417 1:163100176-163100198 ATGGGGAAGAGGTGTGTGGATGG + Intergenic
916575939 1:166066476-166066498 AGGCAGAACAGGATAGTGGAAGG + Intronic
916673337 1:167044702-167044724 ATGGAGGAGATGACAGTGAAAGG - Intergenic
917141166 1:171837592-171837614 ATGATGAGGAGGGCAGTGGAGGG + Intergenic
917176050 1:172236640-172236662 GTAGAGAAGAGGACAGAGGGAGG + Intronic
917490312 1:175493121-175493143 AAGGAGAAGAGGAGAGGAGAGGG - Intronic
917495991 1:175540691-175540713 CTGGGGAAGGGGAGAGTGGATGG - Intronic
917503220 1:175604633-175604655 AAGGAGAGGAGGAGAGAGGATGG - Intronic
917626933 1:176855803-176855825 ACGAAGCAGAGGACAGAGGATGG - Intergenic
917627135 1:176857709-176857731 ATACAGAACAGAACAGTGGAAGG + Intronic
917686328 1:177419766-177419788 AAGGAGAACAGGGCAGAGGAGGG - Intergenic
918210778 1:182349199-182349221 ATGGCAAAGAGGAGCGTGGAAGG + Intergenic
918590760 1:186238296-186238318 ATGGAGAAGTGGAGGGGGGAAGG + Intergenic
919093549 1:193002159-193002181 CTGGAGAACAGGAAAGTGGGAGG + Intergenic
919241860 1:194924860-194924882 TTGGAGAAGAGGTATGTGGATGG + Intergenic
919783909 1:201245077-201245099 ATGGAGATGAGGCCTTTGGAAGG + Intergenic
920032984 1:203048489-203048511 GATGAGAAGAGGACAGGGGAGGG + Intronic
920133753 1:203753260-203753282 ATGGAGGTGAGGAGGGTGGAGGG - Intergenic
920189222 1:204181775-204181797 AAGGAGAAGAGAAAAGAGGAAGG - Intergenic
920266311 1:204726048-204726070 TGGGAGAAGAGGGCTGTGGAGGG + Intergenic
920268872 1:204747782-204747804 CTGCAGAAGAGGAGAGGGGATGG + Intergenic
920628876 1:207631966-207631988 ATTCAACAGAGGACAGTGGAAGG + Intronic
920777010 1:208948711-208948733 AGAGAGAAGAGGAGAGGGGATGG + Intergenic
920837256 1:209522612-209522634 AAGGGGCAGAGGACAGTGAAAGG + Intergenic
920922416 1:210309250-210309272 GGGGAGAAGAGGAGAGGGGAGGG - Intergenic
921627390 1:217392064-217392086 CTGGAGGTGAGGACAGTGAAGGG - Intergenic
921891670 1:220360026-220360048 ATGGAGCAGAGCACAGAAGATGG - Intergenic
922256968 1:223900800-223900822 CTGAAGAAAAGGACAGTGAATGG + Intergenic
922465614 1:225844212-225844234 AGGGAGGAGAGGTCAGTGGCAGG + Intronic
923350117 1:233096459-233096481 ATGGAGATGATGACTGTGTAGGG + Intronic
923362070 1:233221633-233221655 ATGGGGAAGAGAACAGAGCAAGG + Intronic
923375275 1:233355873-233355895 AAGGAGAAGGGGACAGATGAGGG - Intronic
924247653 1:242100518-242100540 ATGGAGATGAGGAAACAGGACGG - Intronic
924338163 1:243003613-243003635 CTGGAGAAAAGGACAGTGAATGG + Intergenic
1063190103 10:3685687-3685709 ATGAAGAAGAGGAAAATGAAAGG - Intergenic
1063280918 10:4628482-4628504 ATGGAGAGGAGGAGAGGGAAGGG - Intergenic
1063597531 10:7450447-7450469 ATTGAGAAAAGGACAGTAAAGGG + Intergenic
1063659277 10:8022465-8022487 ATGGAGAAAAGGCCAGGGGTAGG + Intergenic
1063802712 10:9598785-9598807 ATGGAGAAATGGACAGGTGAAGG - Intergenic
1063877859 10:10498639-10498661 ATGGGGAAGAGGCTAGAGGAAGG - Intergenic
1063953947 10:11248417-11248439 ATGGAGAGGAGGAGGGTGGAAGG - Intronic
1064332027 10:14402949-14402971 ATGGAGATGGGGACAGAGGGTGG + Intronic
1064577893 10:16764343-16764365 ATGGAGAGGAAGAGAGTGGAAGG - Intronic
1064659372 10:17591114-17591136 ATGGAGAAGAGGAGGCTGGGTGG - Intronic
1064925340 10:20563335-20563357 TAGGAGAGTAGGACAGTGGATGG - Intergenic
1065744137 10:28823336-28823358 ATGGAGAAGAGAAAAATAGAAGG - Intergenic
1065866449 10:29919189-29919211 AGGAAGAAGAGGAGAGAGGAGGG - Intergenic
1066277659 10:33884722-33884744 ATGGAGAAGAGAGAAGTGGATGG - Intergenic
1066523359 10:36247872-36247894 AGGGAGAAGAGGAGAGGGAAGGG - Intergenic
1066778435 10:38912450-38912472 ATGGAGAGGAGTGGAGTGGAGGG + Intergenic
1067012310 10:42726002-42726024 ATGGAGAGGAAGAGAGTGGAAGG + Intergenic
1067229658 10:44397437-44397459 AGGGAGAGGAGGAGAGGGGAGGG + Intergenic
1067251673 10:44592068-44592090 ATTGATAAGAGTACAATGGAAGG + Intergenic
1067309224 10:45096486-45096508 ATGGACAAAAGGAGAGTGGGAGG - Intergenic
1067311288 10:45115891-45115913 ATGGAGAGAAAGAGAGTGGAAGG - Intergenic
1069846366 10:71374600-71374622 ATGGAGATGGGGACAGGGGCAGG - Intergenic
1069861880 10:71476562-71476584 TTGGCCAAGAGGACAGAGGATGG + Intronic
1069957319 10:72060043-72060065 ATCGAGGAGAGGGCACTGGAGGG + Exonic
1070429129 10:76318543-76318565 ATGGAGAAGAGGTCAGAGTCTGG - Intronic
1070575420 10:77673526-77673548 AAGGGGAAGAGGAGAGTGAATGG - Intergenic
1070806290 10:79272962-79272984 CTGGAGAGGATGACAGGGGATGG + Intronic
1071663003 10:87524736-87524758 CTGGAGGAGAGGAAAGAGGATGG + Intronic
1071708024 10:88020529-88020551 AGAAAGCAGAGGACAGTGGATGG + Intergenic
1071847105 10:89531969-89531991 ATGGAAGAGAGGACATTGTATGG - Intronic
1072783725 10:98266985-98267007 AAGGAGAAGGGGACAGAAGAGGG + Intronic
1073058783 10:100720190-100720212 CTGCAGAAGAGGACACAGGAAGG + Intergenic
1073314642 10:102570616-102570638 ATCGAGAAGAGGAAGGGGGAAGG - Intronic
1073747959 10:106491557-106491579 GTGGGCAAGATGACAGTGGAAGG - Intergenic
1073918387 10:108431672-108431694 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1074579563 10:114705844-114705866 GTGGAGAAGACTACAGTGCAAGG + Intergenic
1075170734 10:120111428-120111450 AGGGAGAAGGAGACAGTGAATGG - Intergenic
1075408148 10:122208187-122208209 GTGGAGAAGAGGAGAGTGAGAGG + Intronic
1075455645 10:122583172-122583194 AGGGAGAAGAGGAAAGTGCCAGG + Intronic
1075457768 10:122595875-122595897 AGGGAGAAGAGGAAAGTGCCAGG + Intronic
1075498908 10:122954156-122954178 ATGGAGACGCGGACCGAGGACGG - Exonic
1075627771 10:123974930-123974952 AAGCAGAAGGTGACAGTGGAAGG + Intergenic
1075954446 10:126510036-126510058 ATGGAGCAGAGGACAGAGGGAGG - Intronic
1075974779 10:126685827-126685849 ATGGGGAGGAGGAGATTGGATGG - Intergenic
1076152228 10:128171995-128172017 GGGGAGAAGAGGACAGGGGAGGG - Intergenic
1076482130 10:130791926-130791948 GGGGAGCAGAGGACAGCGGAGGG - Intergenic
1076493346 10:130879148-130879170 ATGGAGCAGAAGGGAGTGGAAGG + Intergenic
1076529705 10:131136174-131136196 AGGGAAGAGAGGACACTGGAGGG + Intronic
1077015581 11:397722-397744 AGTGAGCAGAGGACAGTGGGAGG - Intronic
1077203215 11:1324502-1324524 AAGGAGAAGGAGGCAGTGGAAGG + Intergenic
1077537530 11:3131651-3131673 ATGGATGGGAGGACAGTAGATGG - Intronic
1078144801 11:8715445-8715467 ATGAAAAAGAGGCCAGTGCACGG + Intronic
1078340755 11:10496648-10496670 TGGGAGAGGAGGACAGAGGAGGG + Intronic
1078369856 11:10735681-10735703 CGGGAGGAGAGGACAGAGGACGG - Intergenic
1078399418 11:11010843-11010865 AAGGAGAAAAGGAGAGGGGAGGG + Intergenic
1079024236 11:16933393-16933415 AGGCAGGAGAGGACAGTGGCTGG + Intronic
1079279748 11:19076563-19076585 ATAGGGATGAGGAAAGTGGATGG + Intergenic
1079345973 11:19652558-19652580 AGGGAGAAAAGGGCAGTGGTGGG - Intronic
1079387319 11:19992084-19992106 TAGGAGAAGAGGAAAGGGGATGG - Intronic
1080749282 11:35138149-35138171 GTGGAGAAGAGGATGGTGGATGG + Intergenic
1081262485 11:40977903-40977925 AGGGAGAAGAGGACATGTGAAGG + Intronic
1081716798 11:45256232-45256254 GTGGAGAAGAGGAGGGAGGAAGG - Intronic
1082061532 11:47865204-47865226 ATGGAGAAGGGAACAGGGTAAGG - Intergenic
1082671779 11:56043675-56043697 ATGGGGAAGAGGTATGTGGATGG + Intergenic
1083323605 11:61862423-61862445 AGGGAGGAGAGCAGAGTGGAGGG + Intronic
1083627302 11:64078285-64078307 CTGGAGAAGAGGCCAGGGCAGGG - Intronic
1083721373 11:64605251-64605273 ATGCAGAATCGGGCAGTGGAGGG + Intergenic
1084297088 11:68219622-68219644 AAGAAGAAGAGGAGAGAGGAAGG - Intergenic
1084662593 11:70555169-70555191 ATGGAGGAGTGGACAGTCGGTGG - Intronic
1084996772 11:72987692-72987714 ATGAACATGAGCACAGTGGAGGG - Intronic
1085187009 11:74584097-74584119 ATGACGAAGAAGACAGAGGAGGG + Intronic
1085284335 11:75350347-75350369 ATGGAAACGAGGAGAGGGGAGGG + Intronic
1085993816 11:81886221-81886243 ATGACCAAAAGGACAGTGGAAGG + Intergenic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1087043061 11:93820401-93820423 ATGGAGTTGAGGACTGTGGATGG - Exonic
1087346185 11:96973769-96973791 ATTGGGAAGAGGAAAGGGGAAGG + Intergenic
1087415094 11:97844785-97844807 ATGGAGATGAGCCGAGTGGAAGG + Intergenic
1088423611 11:109675832-109675854 ATGGAGAAGAAGTCTGGGGAGGG + Intergenic
1089317140 11:117599918-117599940 AGGTGGAAGAGCACAGTGGAAGG + Intronic
1089404354 11:118185214-118185236 AGGGAGAAAAGGACACTGGTTGG + Intergenic
1089453651 11:118613329-118613351 ATGGTGAAGAGGAGAATGAAAGG + Exonic
1089780997 11:120873201-120873223 AAGGAGAGGAGGGCAGAGGAGGG - Intronic
1090119112 11:124005762-124005784 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1090925963 11:131250794-131250816 ATGGAGACGATGACATGGGATGG - Intergenic
1090956670 11:131519206-131519228 TGGGAGAAGAGGGCAGTGGAAGG - Intronic
1091374845 12:18490-18512 ATGGAGAAGATCACAGAGGCTGG + Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091467528 12:698220-698242 AGGCAGAAGAGGACAAAGGAAGG - Intergenic
1092084449 12:5744174-5744196 ATAGAGAAGAAGACGGTGGCAGG + Exonic
1092749368 12:11704289-11704311 AAGGAGAAGAAGGAAGTGGAGGG + Intronic
1093115220 12:15201211-15201233 ATGGAAGAGAGGACAAGGGAGGG + Intronic
1093253116 12:16832731-16832753 ATGGAGAATGGGCCAATGGATGG + Intergenic
1093779762 12:23121736-23121758 ACGGAGAAGAGGACAGGGGCAGG + Intergenic
1094269504 12:28596961-28596983 TGGGAGAAGAGAATAGTGGAAGG - Intergenic
1096982916 12:55738573-55738595 AGGGAGACTAGGACAGTGGGCGG + Intergenic
1096997197 12:55846007-55846029 ATGGAGGAGAGGTGAGGGGAGGG + Intergenic
1098390774 12:69967545-69967567 ATGGAGGAGAGGTAAATGGAGGG - Intergenic
1098432601 12:70436022-70436044 ATGGAGAAGAGAAAAGTAAAGGG + Intergenic
1098831817 12:75373397-75373419 TTGGAGAAGAGGTATGTGGATGG - Intronic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1100659355 12:96679870-96679892 CTGGACAAGAGGAAAGTGAAAGG - Intronic
1100728898 12:97441756-97441778 ATGGAGGAGAGGAGAGAGGGAGG + Intergenic
1101469608 12:104984252-104984274 ATGGGGAATAGGAAAGGGGATGG + Intergenic
1102452769 12:113053986-113054008 ATGGATAAGTGGATGGTGGATGG + Intergenic
1102514528 12:113437419-113437441 ATGGATAGATGGACAGTGGATGG + Intronic
1102527307 12:113521030-113521052 ATGGAGAAAAAGACATTTGAAGG + Intergenic
1102730639 12:115105929-115105951 AAGGTGAAGAGGGCTGTGGATGG - Intergenic
1102810274 12:115818410-115818432 CTTGAGAAGAGGAGAGAGGAAGG - Intergenic
1102920746 12:116789620-116789642 ATGGATGGGAGGAGAGTGGATGG + Intronic
1102920817 12:116789918-116789940 ATGGATGGGAGGAGAGTGGATGG + Intronic
1103175453 12:118859473-118859495 ATTGAGAACTGGATAGTGGAAGG - Intergenic
1103318446 12:120075803-120075825 AGAAAGAAGAGGACAGTAGATGG - Intronic
1103420567 12:120778580-120778602 ATGGAGAACAGCTCAGTGGTTGG - Intronic
1103562487 12:121799957-121799979 CTGGAGGAGAGGAAGGTGGAGGG + Intronic
1103848027 12:123913050-123913072 ATGGGGAAAAGGACCGTGGTGGG - Intronic
1104057643 12:125242790-125242812 ATGGAGCAGTGGGCAGTGGGAGG - Intronic
1104184189 12:126413266-126413288 AAGAAGAAAAGGAAAGTGGAAGG + Intergenic
1104190792 12:126480137-126480159 ATGGAGAAGAGGAGAAGGGGAGG + Intergenic
1104356377 12:128090242-128090264 GTGGAAAAGGGGACAGTGGTTGG + Intergenic
1104544506 12:129698743-129698765 AGGGGGAAGAGGAGAGGGGAGGG + Intronic
1104678601 12:130732702-130732724 GTGGGGAAGAGCACAGTGGTGGG - Intergenic
1106319349 13:28623816-28623838 ATGGGGAAGAGGAGAATTGAAGG + Intergenic
1106413630 13:29528050-29528072 ATGGAGAAGGGAACAGCAGAGGG - Intronic
1106544519 13:30718487-30718509 ATGGAGAAAAGGATGGAGGAAGG - Intronic
1107349486 13:39499403-39499425 AGGGAGGAGAGGACTGAGGAAGG - Intronic
1107481027 13:40786458-40786480 ATGGAGAGGAGAAATGTGGAAGG + Intergenic
1107944151 13:45402274-45402296 GGGGACAAGAGGACTGTGGAAGG - Exonic
1108164858 13:47681835-47681857 ATGGTGAAGTAGACAGAGGAGGG + Intergenic
1108443209 13:50477527-50477549 ATGGAAATGAGGAAAGGGGAAGG + Intronic
1108747301 13:53408889-53408911 CAGGAGGAGAGGACAGTGGCAGG - Intergenic
1109034617 13:57240388-57240410 ATGGAGAAGACAAGAGTTGATGG + Intergenic
1110369826 13:74727482-74727504 AGGGAGGAGAGGAGAGGGGAGGG + Intergenic
1110869507 13:80433974-80433996 ATGGTGAACAGGACAGTCTATGG - Intergenic
1111499787 13:89103123-89103145 AGAGAGAAAAGGACAGTTGACGG + Intergenic
1112515991 13:100053657-100053679 CTGGAGTTGAGGACAGTGGGTGG - Intergenic
1112554455 13:100453507-100453529 ATGGAGAAAAAGAAAGTGCAGGG + Intronic
1112863279 13:103862021-103862043 ATGGAGAAGAGATTAGTGGTGGG - Intergenic
1112982620 13:105404538-105404560 ATGGAGAGAGGGACAGGGGAAGG + Intergenic
1112985672 13:105446434-105446456 ATGGATTGGAGGACAGTGGCAGG - Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113614488 13:111671025-111671047 AGGGAGGAGGGGACAGGGGACGG - Intronic
1113619956 13:111755939-111755961 AGGGAGGAGGGGACAGGGGACGG - Intergenic
1113726155 13:112603849-112603871 AGGGAGAAGAGGGCAGAGGGAGG + Intergenic
1114524281 14:23358832-23358854 CTAGAGAAGGGGACAGGGGAGGG - Intronic
1115801276 14:36996691-36996713 ATGGAGAAAAAAAAAGTGGATGG + Intronic
1116531374 14:45977607-45977629 TTGGAGAAGAGGCATGTGGATGG - Intergenic
1116923716 14:50610541-50610563 ATGGAGAAGTTGACAGTGAAAGG + Intronic
1117069442 14:52043474-52043496 GGGGAGAAGGGGACAGAGGAGGG + Intronic
1117214066 14:53531841-53531863 ATGGAGAAAAGGACAAAGGGAGG - Intergenic
1117255748 14:53975754-53975776 ATGAAAAAGAGGCCAGAGGAGGG - Intergenic
1117571711 14:57055510-57055532 ACAGTGAAGGGGACAGTGGATGG + Intergenic
1117713527 14:58557357-58557379 ATTGTGAGGTGGACAGTGGAAGG + Intergenic
1118334971 14:64845454-64845476 ATGGAGATGAGGAGACTGGCAGG - Intronic
1118472760 14:66090438-66090460 ATAGAGAGCAGGACAATGGAAGG + Intergenic
1118723412 14:68609751-68609773 CTGGAGAAGAGGAAGGTGAAAGG - Intronic
1118925037 14:70184504-70184526 AAAGAGGAGAGGAGAGTGGAGGG - Intronic
1119505281 14:75167437-75167459 AAGGAGAAAAGGACAGTGGTGGG - Intronic
1119924159 14:78475743-78475765 ATCAAGAAGAGGACATTTGATGG + Intronic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120040604 14:79748657-79748679 ATAAAGAAGAGGCCAGTGGCGGG + Intronic
1120530532 14:85625738-85625760 AAGGGGAAGAGGACAGTAGAAGG - Exonic
1120898436 14:89555392-89555414 ATGGAGAAGACTACTGTTGAGGG - Intronic
1121908079 14:97765727-97765749 AGGGAGGAGAGGGAAGTGGAAGG - Intergenic
1122029898 14:98904717-98904739 ATGGATAAATAGACAGTGGATGG - Intergenic
1122098253 14:99386986-99387008 ATGGACAAGGGGAGACTGGAAGG + Intergenic
1122503978 14:102219905-102219927 GTGGAGAGTGGGACAGTGGAGGG + Intronic
1122576638 14:102747165-102747187 ATGGAGGAGAGGGGAGGGGAGGG - Intergenic
1122633591 14:103119365-103119387 AGGAAGAAGAGGGCAGTCGAAGG - Intergenic
1122801273 14:104230824-104230846 ATGGAGATGAGGCCTGAGGAGGG + Intergenic
1122971721 14:105154963-105154985 ATGGGGAGGGGGTCAGTGGAAGG - Intronic
1122983194 14:105200691-105200713 ATGGAGAAGGGCCCAGAGGATGG - Intergenic
1123464114 15:20501629-20501651 ATGGAGAACAGATCAGTGGTTGG + Intergenic
1123653951 15:22498793-22498815 ATGGAGAACAGATCAGTGGTTGG - Intergenic
1124075278 15:26438151-26438173 AGGGAGAAGTGGACACTGAAAGG - Intergenic
1124164304 15:27310144-27310166 ATGGAGAAGTGATCAGTGGTTGG + Intronic
1124819874 15:33034247-33034269 CTGGAGAAGATGACCGTGGGTGG - Intronic
1125468106 15:39975039-39975061 ATAGGGAAGAGGACAGTGTAGGG - Intronic
1126193443 15:45903541-45903563 AAGGAGAAGAGGAGAAAGGAAGG - Intergenic
1126634085 15:50765277-50765299 GTGGAAAAGAGGAGGGTGGAAGG + Intronic
1127959457 15:63880063-63880085 TTGGTGATGAGGACAGTGGCTGG + Intergenic
1128079103 15:64845607-64845629 ATGGAGAAGGGGACAACTGAAGG - Intronic
1128220877 15:65967720-65967742 AAGGAGAAGAGGACGGTGACTGG + Intronic
1128504230 15:68255229-68255251 AGGGAGAAGAGGACATAGAAAGG - Intronic
1128548343 15:68582011-68582033 GTGGAGAAGAGGAAAGCAGATGG + Intronic
1128797988 15:70478818-70478840 CTGGAGAACGGGACAGAGGAGGG + Intergenic
1129819617 15:78589421-78589443 AGGAAGAAGAGCACTGTGGAGGG + Intronic
1130789481 15:87137544-87137566 ATGGAAAAGAGTAAAGAGGATGG + Intergenic
1130899736 15:88198342-88198364 ATGGCTCAGAGGACACTGGAGGG - Intronic
1130981499 15:88814876-88814898 CAGGAGAGGAGGACAGGGGATGG - Intronic
1131111037 15:89765654-89765676 AGGGAGAAGAGGGGAGGGGAGGG + Intronic
1131131018 15:89900259-89900281 AGGAAGCAGGGGACAGTGGAAGG + Exonic
1132082552 15:98879448-98879470 ATGGAGAATAAAACAGTGGAAGG - Intronic
1132451744 15:101972555-101972577 ATGGAGAAGATCACAGAGGCTGG - Intergenic
1132455148 16:18074-18096 ATGGAGAAGATCACAGAGGCTGG + Intronic
1132772130 16:1569547-1569569 AGGGAGAGGAGGGGAGTGGAGGG - Intronic
1133039434 16:3052541-3052563 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133043277 16:3072174-3072196 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133111586 16:3551137-3551159 GTGGAGAATAGGTGAGTGGATGG - Intronic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133477748 16:6139785-6139807 ATGGGGAACAGGACAGGAGAAGG - Intronic
1133588011 16:7214472-7214494 ATGGAGATGGAGGCAGTGGATGG - Intronic
1133922416 16:10165664-10165686 AGAGAGAAGAGGAGAGGGGAGGG + Intronic
1133942487 16:10321993-10322015 AGAGAGAAGAGGACGTTGGAGGG - Intergenic
1134031432 16:10995541-10995563 ATGGAAGAGAGGGCAGGGGAGGG - Intronic
1134569380 16:15278458-15278480 AGAGAGAAGAGGAAAATGGAGGG - Intergenic
1134814757 16:17196700-17196722 AGGGTGAAAAGGAAAGTGGATGG - Intronic
1134856043 16:17520118-17520140 ATGGAGAAGGAGGCAGGGGAAGG + Intergenic
1134934441 16:18234386-18234408 AGAGAGAAGAGGAAAATGGAGGG - Intergenic
1136083831 16:27870562-27870584 AGGGAAGAGAGGAGAGTGGAGGG - Intronic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137549189 16:49425266-49425288 GTGGGGAAGGGGACAGTGGCTGG - Intergenic
1138050827 16:53775531-53775553 AAGGACAGGAGCACAGTGGAAGG - Intronic
1139422206 16:66855786-66855808 GGGGAGAAAGGGACAGTGGAGGG + Intronic
1139640817 16:68290280-68290302 AAGGAGAATAGGAAAGAGGAAGG - Intronic
1140027236 16:71301732-71301754 ATGGAGAAGAGGAGGCTGGTAGG + Intergenic
1140486801 16:75299971-75299993 GGGGAGAAGAGGACAGAGGTAGG + Intronic
1141157127 16:81605164-81605186 AGGGAGAACAGAACAGTGCACGG + Intronic
1141313208 16:82935210-82935232 ATGGAGAAGTGCAGAGTGAAGGG + Intronic
1141771067 16:86089909-86089931 GCTGAGAAGAGGACTGTGGAGGG - Intergenic
1141936174 16:87239715-87239737 AAGGAGGAGGGGACAATGGAAGG + Intronic
1142234513 16:88915448-88915470 GTGGAGGAGGGGAGAGTGGAGGG + Intronic
1142254530 16:89007252-89007274 AGGGAGAAGAGGGGAGTGGGAGG - Intergenic
1142727792 17:1829515-1829537 TTAGAGAAGAGGACAGTGTGTGG - Intronic
1143100042 17:4499696-4499718 TTGGAGAGGAGGACAACGGATGG - Intronic
1143272408 17:5685525-5685547 ATGGTGAAGAGGAGGCTGGAGGG + Intergenic
1143445204 17:7005234-7005256 CTGGAGAGGAGGAGATTGGAGGG - Intronic
1143473931 17:7192468-7192490 ATGGAGAAAGGAACCGTGGAGGG + Intronic
1143572537 17:7769025-7769047 AAGAAGCAGAGGACAGTGGCAGG - Intronic
1143818632 17:9541293-9541315 ATGTGGAAGAGGAGAATGGAGGG + Intronic
1143900336 17:10169699-10169721 ATGGAGAAGAGGTCTGGGGATGG - Intronic
1144077481 17:11732467-11732489 GTGGAGAGGAGGAGAGGGGAGGG - Intronic
1145278997 17:21454988-21455010 AAGGAGAAGAGGGGAGGGGAGGG - Intergenic
1146063005 17:29616899-29616921 AGGGAGAACAGGGCACTGGATGG - Intronic
1146212510 17:30953424-30953446 ATTGTTAAGAGGACAGTGAAAGG + Intronic
1146529105 17:33592785-33592807 ACAGAGGAGAGGGCAGTGGAAGG - Intronic
1146543199 17:33715711-33715733 ATGGAAAAGATGCCATTGGAAGG - Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146599766 17:34204522-34204544 TTGGAGCAGAGGACAGTAGCAGG - Intergenic
1146646273 17:34579368-34579390 ATGGACACGTGGACAGAGGAGGG + Exonic
1146655525 17:34632570-34632592 AAGGGGAGGAGGCCAGTGGAAGG - Intronic
1147646941 17:42039796-42039818 ATGGTGAAGATCGCAGTGGATGG - Intronic
1147951527 17:44110506-44110528 ATGCAGCAGAGTACAGCGGAGGG + Intronic
1148217937 17:45844075-45844097 ATGGAGAGGAAGAAAGTGAAGGG - Intergenic
1148481854 17:47965102-47965124 ATGGAAAAGAGGTGAATGGATGG + Intergenic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148749029 17:49934296-49934318 CTGGAGGAGAGAACAGAGGATGG - Intergenic
1149089064 17:52755980-52756002 TTGGTGAAGAGAACAGTGAAGGG - Intergenic
1149586426 17:57790744-57790766 GTGGAGAAGAAGAAAGTGGGTGG - Intergenic
1149772705 17:59333265-59333287 ATGGAGCTGGGGACAGGGGATGG - Intronic
1150481884 17:65517129-65517151 GTGGTCAGGAGGACAGTGGAAGG - Intergenic
1150715606 17:67570259-67570281 TCAGAGAAGAGGCCAGTGGAAGG + Intronic
1150929888 17:69573114-69573136 GTGGAGGAGAGGAGAGGGGAGGG - Intergenic
1151232214 17:72693224-72693246 TGGGACAAGAGGACAGTGGGAGG - Intronic
1151359107 17:73577934-73577956 ATGCAGAAGAGGACGGCAGAAGG + Intronic
1151855566 17:76719078-76719100 ACGGTTAAGAGAACAGTGGAGGG - Intronic
1152293999 17:79456236-79456258 TAGGAGAAGAGGACAGAGCAAGG - Intronic
1152519069 17:80844934-80844956 AGGGAAGAGAGGATAGTGGATGG + Intronic
1152798451 17:82320207-82320229 ATGGAGCAAAGGCCAGAGGAGGG - Intergenic
1152879323 17:82806434-82806456 GAGGAGAACAGGGCAGTGGATGG - Intronic
1203212040 17_KI270730v1_random:86701-86723 ATGGAGAGGAGTGGAGTGGAGGG + Intergenic
1153427074 18:4976751-4976773 ATGGTGAAGAGGTCAGATGATGG - Intergenic
1153997018 18:10451828-10451850 ATGGAGAAGAGGAAACTCAAAGG - Intergenic
1154309875 18:13259180-13259202 AGGGAGAGGAGGAGAGGGGAGGG - Intronic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156128373 18:33936519-33936541 ATTGAAAAGAACACAGTGGAGGG - Intronic
1156339202 18:36196105-36196127 AGGGAGAAGAAGCCAGTGCAGGG + Intronic
1156391383 18:36653595-36653617 ATGGAGATGAGGGCAGAGGGAGG + Intronic
1156472206 18:37384384-37384406 CTGGGGATGAGGACAGGGGAGGG + Intronic
1156519357 18:37708727-37708749 ATAGAGAAGTGGAGAGAGGAAGG - Intergenic
1156673704 18:39502000-39502022 GTGGAGAAAAGAAGAGTGGAGGG + Intergenic
1157113870 18:44845311-44845333 AGGGAAATGAGGAGAGTGGAAGG - Intronic
1157338471 18:46757752-46757774 AGGGGGAAGAGGACTGTGGCGGG - Intronic
1157576778 18:48748978-48749000 GGGGAGAAGGGGCCAGTGGAGGG - Intronic
1157678420 18:49584575-49584597 ATGGAGAAAATGCCAGAGGAGGG - Intronic
1157966068 18:52209754-52209776 GTGGAGAAGAGGAGGGTGAAAGG - Intergenic
1158146473 18:54319725-54319747 ATGGAGATGATGACAGGGCAAGG + Intronic
1158283205 18:55850404-55850426 AGGGAGAAGAGGACAAAGAAAGG - Intergenic
1160346311 18:78135187-78135209 GTGCATAAGAGGCCAGTGGAAGG - Intergenic
1160403651 18:78629536-78629558 CTAGAGATGAGGACAGAGGACGG + Intergenic
1160448687 18:78947160-78947182 GGGAAGAAGAGGACAGAGGAAGG + Intergenic
1160975495 19:1790449-1790471 GTGGCGAAGTGGGCAGTGGAGGG - Intronic
1161044558 19:2128315-2128337 ATGGAGAAGAGTCTAGTGGCCGG + Intronic
1161214298 19:3085727-3085749 AAGTAGAAGAGGAGAGGGGAGGG - Intergenic
1161500814 19:4614436-4614458 ATGGAGATGAGGACAGGGGGTGG + Intergenic
1161754230 19:6119806-6119828 AGGGAGAAGGGGACAGAGAAAGG - Intronic
1161943779 19:7421902-7421924 AGGGAGAAGGGGACAGAGGTGGG - Intronic
1162576293 19:11500943-11500965 TTGGAGAAGTGGACAGGAGAGGG - Intronic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1165374205 19:35430076-35430098 GTGGAGAGGAGGACACTGAAGGG + Intergenic
1166312895 19:41973024-41973046 GTGGAGAAGAGCACAATGCAGGG - Intronic
1166332954 19:42089241-42089263 AAGGAGGAGAGGAGAGAGGAAGG + Intronic
1167084688 19:47301146-47301168 AGGGAGGAGAGGAGAGGGGAAGG - Intronic
1167112815 19:47471937-47471959 GAGGAGAAGAGGAGAGGGGAGGG + Exonic
1167239640 19:48335918-48335940 AAAGAGAAGAGGAGAGGGGAAGG + Intronic
1167698281 19:51027398-51027420 AGGGAGAAGCGGGCAGGGGAAGG - Intronic
1167821720 19:51934396-51934418 ATGGAGGAGAGGAAAGGGGGTGG - Intronic
1168562169 19:57393664-57393686 ATAGAGGAGAGGAGAGGGGAGGG + Intronic
925727356 2:6886199-6886221 AAGGAGCAGAGGAAATTGGAGGG + Intronic
925842588 2:8006566-8006588 ATGGAGGAGAAGAGAGAGGAGGG - Intergenic
925882367 2:8363505-8363527 ATGGAGAAGAGGAAAACAGAAGG + Intergenic
926119899 2:10236215-10236237 ATGGAGAAGAGGGAAGAGGGTGG - Intergenic
927471321 2:23379645-23379667 AGAGGGCAGAGGACAGTGGAGGG + Intergenic
928075772 2:28263162-28263184 AAGGAGAGGAGGAGAGGGGAGGG + Intronic
928180324 2:29064115-29064137 AAGGAGGAGAGGACAGAGGACGG + Exonic
928388346 2:30888732-30888754 AAGGAGAAGAGGAGGGTGCAGGG + Intergenic
928713726 2:34036266-34036288 CTTGAGAAGAGGACAGTTGTGGG - Intergenic
929350320 2:40943063-40943085 ATGGATAAGAAGAAAGTGGAAGG + Intergenic
929385709 2:41403722-41403744 AGGGAGAAAAGGAAAGGGGAAGG + Intergenic
929414630 2:41734903-41734925 ATTGAAAGCAGGACAGTGGAGGG + Intergenic
929444564 2:41992108-41992130 GTGGAGGAGAGGAGAGAGGAAGG + Intergenic
929755499 2:44760877-44760899 ATGGAGAAGAGGACAATGAATGG + Intronic
930364667 2:50424255-50424277 AGGAAGAGGAGGACAGGGGAAGG + Intronic
930472104 2:51829824-51829846 AAGGAGAAGAGAAGAGGGGAGGG - Intergenic
931083233 2:58799523-58799545 ATTGAGAGGAGGTCAGTGAAAGG + Intergenic
931142836 2:59482549-59482571 ATGGAGAAGAGGAAAGATTATGG + Intergenic
932227343 2:70053006-70053028 ATGGAGGAGAGGACATGGTAGGG - Intergenic
932592785 2:73077095-73077117 ATGGAGATTAGGAGAGTGGTAGG - Intronic
933473131 2:82753017-82753039 ATGGAGAAGAGGGAAGTGGAGGG + Intergenic
934295768 2:91741887-91741909 ATTAAGAAGAGGACAAAGGAAGG - Intergenic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
935941639 2:108245081-108245103 ATGGAGAAGAAAACAGTAGAGGG + Intergenic
936567955 2:113595022-113595044 ATGGAGAAGATCACAGAGGCTGG - Intergenic
936765663 2:115845547-115845569 ATGGGGAAGAGGAAAATAGAAGG - Intronic
936811616 2:116409032-116409054 ATGGCCAAGATGACAGTGGTAGG + Intergenic
937703899 2:124895796-124895818 ATAGAGAATAAGACAGTGGGAGG + Intronic
937800460 2:126075754-126075776 TTGGAGAAGAGGTATGTGGATGG + Intergenic
938189154 2:129258805-129258827 ATGTAGAGGAGGAGTGTGGAGGG + Intergenic
938457128 2:131473834-131473856 ATGGACAACAGGAAAGGGGAAGG - Intronic
939382615 2:141455556-141455578 ATGGAGATGGGGACAGGGGTAGG + Intronic
939527786 2:143319176-143319198 ATGCACAAGAGGGGAGTGGAAGG - Intronic
939582258 2:143964646-143964668 AAGGAGAAGATGGAAGTGGAGGG + Intronic
939853708 2:147331050-147331072 AGGGAGGGGAGGAGAGTGGACGG + Intergenic
939915446 2:148036587-148036609 ATGGAGAAAAAGCCAGTTGATGG - Intronic
940163837 2:150745371-150745393 AAGGAGAAGAGCAAAGTTGAAGG + Intergenic
940306494 2:152232691-152232713 GTGGAGATGGGGAAAGTGGATGG - Intergenic
940333756 2:152503247-152503269 GTGGAGTGGAGGTCAGTGGATGG + Intronic
940911181 2:159211461-159211483 AAGGAAAAGAGGGCAGGGGAGGG - Intronic
940985064 2:160044447-160044469 AGAGAGAAAAGGACGGTGGAAGG - Intronic
941616324 2:167724712-167724734 AGCGAGAAGATGACAGTGGCTGG + Intergenic
941699723 2:168591840-168591862 TTAGAGAAGGGGACTGTGGAGGG + Intronic
942692540 2:178601429-178601451 ATTGAGAAGAGGACTATTGATGG - Exonic
942848146 2:180450978-180451000 AAGGAAAAGAGAACAGTGGTAGG - Intergenic
942979406 2:182061286-182061308 AAGGAGAGGAGGACAGAGGTGGG - Intronic
943900355 2:193426108-193426130 AAGGACAAGAAGACATTGGAGGG + Intergenic
944394862 2:199255342-199255364 GTGCAGAACAGGGCAGTGGAGGG - Intergenic
944460670 2:199946330-199946352 ATGGGGAACAAGACAGTGAAGGG - Intronic
944687140 2:202127543-202127565 ATGGAGAAGGGGACACTAGAAGG + Intronic
945417385 2:209590875-209590897 ATGAAGAGGAGGACAGTAGCAGG - Intronic
945547278 2:211170947-211170969 AGGGAGAAGAGGAGCGTGAATGG + Intergenic
945769847 2:214029540-214029562 ATGCAAAAGATGACAATGGATGG + Intronic
946021916 2:216646213-216646235 ATGGAGAAGAGGACAGTGGAAGG + Intronic
946158733 2:217823276-217823298 ATAGACAATAGGACAGTGTATGG + Intronic
946158895 2:217824119-217824141 ATAGACAACAGGACAGTGAATGG + Intronic
946175714 2:217920994-217921016 AGAGGGAAGAGGAGAGTGGAGGG + Intronic
946321169 2:218955367-218955389 AGGGAGATCAGGACAGAGGATGG + Intergenic
946353242 2:219169121-219169143 ATGGAGAAGAGAAGGGTGAATGG + Intronic
947224057 2:227823041-227823063 ATGGAGAAGTGGAAGATGGAAGG + Intergenic
947268521 2:228307597-228307619 ATGGAGATGAAAACAGTAGAGGG + Intergenic
947357543 2:229312536-229312558 ATGGAGAAGAGGACAGCAGGAGG - Intergenic
947621517 2:231594041-231594063 GTGGAGCAGAGGACCGTGGAGGG + Exonic
948182827 2:235996280-235996302 CTGGAGAGGTGGGCAGTGGACGG - Intronic
948322520 2:237082062-237082084 ATGGAGAAGAAGACTTTGAAAGG + Intergenic
948607725 2:239146729-239146751 GTGGAGCAGAGGCCTGTGGAAGG - Intronic
948640026 2:239369831-239369853 AAGGAGCTGAGGACAGTGCAGGG + Intronic
1168947169 20:1770740-1770762 GTGGAGAAGAGGGCAGGGTAAGG + Intergenic
1169038088 20:2470199-2470221 ATGGAGAGGAGGGCGGAGGAGGG - Intronic
1169381308 20:5109921-5109943 AGGGAGAAGAGGGCAGAGAATGG + Intronic
1169411690 20:5376303-5376325 AAGGATATGAGGACAGTGGGTGG + Intergenic
1169571204 20:6908050-6908072 ATGGGGGAGGGGACACTGGATGG + Intergenic
1169724232 20:8712010-8712032 AAGGAGAAAAGGACAGGGCACGG + Intronic
1169849678 20:10035378-10035400 CTGGAGAAGAGAGGAGTGGAGGG - Intronic
1169973275 20:11294877-11294899 GTGGAGAAGAGGACAGAGTCTGG - Intergenic
1170214321 20:13875692-13875714 AAAGAGATGAGGACAGAGGAAGG - Intronic
1170737067 20:19021720-19021742 TTGGAGCAGTGGACAGTGGGTGG + Intergenic
1170907537 20:20529246-20529268 AAAGAGAAGAGGACTGAGGAAGG - Intronic
1171054571 20:21893854-21893876 GTGGGGGAGAGGAAAGTGGAAGG - Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171118443 20:22547525-22547547 GTGGGGAAGAGGGCAGTGGAAGG + Intergenic
1171265838 20:23771827-23771849 ATGGCAAAGAGGACTGTGCAGGG + Intergenic
1172073101 20:32273073-32273095 ATGGAAAAGAGGACACAGTATGG + Intergenic
1173350704 20:42242834-42242856 ATGGAGAAGAAGCCATTGAAGGG + Intronic
1173467287 20:43293433-43293455 AGGCAGAAGAGGACAGTGTGGGG - Intergenic
1174208933 20:48861581-48861603 CTGGACAAAATGACAGTGGAGGG + Intergenic
1175361692 20:58416350-58416372 TTGAAGAAGAGGTCAGTGTAAGG + Intronic
1175449055 20:59046979-59047001 AAAGAGAAGAAGACAGTTGAAGG - Intergenic
1175629241 20:60519312-60519334 ATGGAGAAGAAGTCAGTAAAAGG - Intergenic
1175935126 20:62510636-62510658 ATGGAGAGGTGGAGGGTGGAGGG - Intergenic
1176084639 20:63290382-63290404 ATGGGGAAGACGAAAGTGGCGGG + Intergenic
1176191006 20:63809543-63809565 AGGGAGAAGAGGGGAGAGGAAGG - Intronic
1176521197 21:7825787-7825809 GGGGAGAAGAGGGCAGTGGGTGG + Exonic
1176529004 21:7943684-7943706 ATGGAGAGGAATAAAGTGGAAGG - Intergenic
1176636552 21:9249055-9249077 ATGGAGTGGAGTAGAGTGGAAGG + Intergenic
1176754282 21:10714266-10714288 ATGGAAAAGAGTAGAATGGAGGG - Intergenic
1177332318 21:19680133-19680155 ATGGAGACGAAAACAGTAGAGGG - Intergenic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1177698900 21:24610778-24610800 ATTGAGAAGAGAACTGTGGTAGG - Intergenic
1177860265 21:26444531-26444553 ATGCAGAAGAGGACATTAGCAGG + Intergenic
1178072361 21:28982725-28982747 ATGGAGCAGAGCACAATGTATGG - Intronic
1178075117 21:29008456-29008478 ATTGAAAAGAAGACAATGGAGGG - Exonic
1178084077 21:29095088-29095110 AGGGAGCAGAGGAGAGGGGAGGG + Intronic
1178286260 21:31327971-31327993 AAGGAGATGAAGACAGAGGAGGG - Intronic
1178655217 21:34455799-34455821 GGGGAGAAGAGGGCAGTGGGTGG + Intergenic
1178887676 21:36496656-36496678 ATGGAGAAGAAAGCAGAGGAAGG + Intronic
1179356336 21:40664122-40664144 ATGGATAAGAGGACATTTGCAGG - Intronic
1179915658 21:44476556-44476578 ATGGAGATGAGGATATAGGATGG + Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180104243 21:45607551-45607573 AGGGAGGAGAGGACAGAGGCAGG + Intergenic
1181997422 22:26893713-26893735 ACAGAGAAGAGGAGAGGGGAAGG + Intergenic
1182017863 22:27055942-27055964 CTGGAGAAGAGTAGAGTGGCAGG + Intergenic
1182048531 22:27295904-27295926 ATGGATAAATGGACAGTGGATGG + Intergenic
1182650783 22:31849444-31849466 AAGGAGAAGTGCAGAGTGGAGGG + Intronic
1182990068 22:34759182-34759204 ATGGATAGGAAGAAAGTGGAAGG + Intergenic
1183258817 22:36780969-36780991 TTGGATAAGAGGGGAGTGGAGGG + Intergenic
1183601902 22:38844574-38844596 GTGGAGAAGAGGCCAGTGTTGGG + Intergenic
1183828994 22:40408201-40408223 ATGGCAGAGAGGACAGAGGAGGG + Intronic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1184665425 22:45986555-45986577 ATGGAGCAGAGGAAAGGGGGAGG + Intergenic
1203298630 22_KI270736v1_random:61560-61582 ATGGAGTAGAGAGGAGTGGAGGG + Intergenic
1203308925 22_KI270736v1_random:128916-128938 ATGGAGAGGAGGGGAGTGGATGG + Intergenic
949740636 3:7229644-7229666 CTGGAGAAGAAAACAGTGGTAGG + Intronic
950078074 3:10201436-10201458 ATGGAGGGGAGGAAAGTGGTGGG - Intronic
950260224 3:11537986-11538008 ATGTAGAAGAGGCCAGGGAAAGG + Intronic
952157741 3:30661437-30661459 AGGGTGAAAAGCACAGTGGAAGG + Intronic
952592088 3:34968329-34968351 ATAGAGTAGATGACAGTTGAGGG + Intergenic
952871249 3:37903171-37903193 ATGGAGGAGAGGACTTGGGAAGG + Intronic
952987088 3:38795139-38795161 ATAGAGAACAGGAGAGAGGAGGG - Intergenic
953090826 3:39724461-39724483 AGGGAGATGAGGAGAATGGAAGG - Intergenic
953206277 3:40832784-40832806 ATGGAGCAGAGGAGAGAGAAGGG - Intergenic
953749965 3:45601464-45601486 ATGAAGGCGAGGACAGGGGAGGG - Intronic
954672651 3:52299030-52299052 AGAGAGAAGAGGAGAGGGGAGGG + Intergenic
954707880 3:52490675-52490697 ATGGAGAAAGGGACAGAGGGAGG - Intronic
954742180 3:52761972-52761994 ATGGAGATCAGTACACTGGAAGG + Intronic
955144238 3:56300193-56300215 AGGGAGCAGAGGAGAATGGAGGG + Intronic
955300214 3:57771172-57771194 AGGGAGGAGAGGAGAGGGGAGGG - Intronic
955555696 3:60134939-60134961 ATGGAGTAGAGGAAAGAGAAAGG + Intronic
956289394 3:67646078-67646100 ATGGAGGGGAGGGCAGGGGAGGG + Intronic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956939918 3:74146651-74146673 ATGGAGAAGGGGACAGAGAAGGG - Intergenic
957024001 3:75159143-75159165 ATGGTAAAGAGGAGAATGGATGG - Intergenic
957719644 3:83977571-83977593 ATAGAGAATAGAACAATGGATGG - Intergenic
958023953 3:88028435-88028457 ATGGAGAACTGGAAAGGGGATGG - Intergenic
958667364 3:97158710-97158732 ATGGAGTAGAGGAAAATGCAGGG + Intronic
959856184 3:111161686-111161708 ATGGAGCAGGGTACAGGGGATGG - Intronic
960696625 3:120402702-120402724 ATGGAGAAGAGGGCGGTGGCTGG - Intronic
961211523 3:125129457-125129479 ATGGAGAAGAGTGCAGTGAGGGG + Intronic
961493900 3:127276627-127276649 CTGGAAGAGAGGACAGAGGAGGG - Intergenic
962120664 3:132556958-132556980 AAGGAGCAGAGGAAAGGGGAGGG - Intergenic
962902418 3:139772877-139772899 ATGTAGGAGAGAACAGCGGAAGG - Intergenic
963300061 3:143587538-143587560 ATGGTGGGGAGGACAGTGGTGGG + Intronic
963844194 3:150138965-150138987 ATGGAAAAGAACACAGTAGAGGG - Intergenic
964580760 3:158234665-158234687 AGGGAGAAGAGGATTGGGGAGGG - Intronic
964962035 3:162438778-162438800 GTGGAGAAGAGAACAGTGAGGGG + Intergenic
964990307 3:162802601-162802623 ATAGAGAAGAGGCAAGTGGATGG + Intergenic
965879551 3:173372033-173372055 ATGCAGAAGAGGTCAGCAGATGG + Intergenic
966063969 3:175794686-175794708 ATAGAGCAGAGGACTGTAGAGGG - Intronic
966910100 3:184554873-184554895 AAGGAGAACAGCACAGTGAAAGG - Intronic
967542057 3:190679551-190679573 ATGGAGATGAAAACAGTAGACGG - Intergenic
967713072 3:192731606-192731628 ATGTCAAAGAGGAAAGTGGACGG + Intronic
968740767 4:2330729-2330751 ATGGAAAAGGGGACAGTGCGGGG + Intronic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
969523715 4:7693525-7693547 ATGGGGCAAAGGACAGTGCAGGG - Intronic
969880337 4:10167979-10168001 ATGGGGAAGATGGCAGTGTAAGG + Intergenic
970270174 4:14338159-14338181 ATGAAGAAAAGGACACTGGGAGG + Intergenic
970368835 4:15387947-15387969 AGGGAGAAGAGGAGAGAAGATGG + Intronic
970415784 4:15855601-15855623 ATGGAGAAGAGGGTAGAGAATGG + Intergenic
971116243 4:23648813-23648835 ATAGAGAAGAAAACAGTGGTGGG - Intergenic
971162190 4:24144695-24144717 ATAGAAAAGGGGAAAGTGGAGGG - Intergenic
971374375 4:26044972-26044994 ATGGGAAAGAGGGGAGTGGATGG - Intergenic
971397207 4:26239713-26239735 AAGGAGAAGAGAAGAGGGGAGGG + Intronic
971466404 4:26967799-26967821 AGGGGGAAGAGGAAAGTGGAGGG - Intronic
971476965 4:27081430-27081452 AGGGAGGAGTGGCCAGTGGAGGG - Intergenic
971636645 4:29068717-29068739 AGGGAGAAGGGGAAAGGGGAGGG - Intergenic
972215772 4:36895491-36895513 ATGGAGATGAAAACAGTAGAGGG - Intergenic
972269020 4:37491822-37491844 ATGGATAAGAGGACAGATAAAGG - Intronic
972319705 4:37962239-37962261 CTGGTGAAGAGGACAATGGCTGG - Intronic
972368938 4:38403380-38403402 CTGGAGACCAGGACAGTTGATGG + Intergenic
972492289 4:39599276-39599298 AAGGAGAAGAGTAGGGTGGAAGG + Intronic
972770534 4:42193209-42193231 CAGGAGAGGAGGAAAGTGGAAGG - Intergenic
972790264 4:42364981-42365003 GGGGAGAAGAGGGAAGTGGAGGG - Intergenic
974059860 4:57022336-57022358 AGGGAGAGGAGGACAGGGGCAGG - Intronic
974073434 4:57146698-57146720 AGGGAGGACAGCACAGTGGAGGG - Intergenic
974093202 4:57333986-57334008 AAGTAAAAGAGGACAGTAGATGG - Intergenic
975073754 4:70178389-70178411 AGGGAGGAGAGGAGAATGGAGGG - Intergenic
975617102 4:76257455-76257477 AGAGAGAAGGGGACACTGGAAGG - Intronic
975746539 4:77480757-77480779 ATGGAGAAGAGGCCACTGAAGGG - Intergenic
975940777 4:79643025-79643047 ACTCAGAAGAGGACAGAGGATGG - Intergenic
976053257 4:81032075-81032097 AAGGAGAAAAGGAGAGGGGAAGG - Intronic
976957680 4:90922299-90922321 AAGGAGAAGAGGGAAGGGGAAGG + Intronic
977155816 4:93571916-93571938 ATGGAAAAAAGGATAGTGGATGG + Intronic
978413918 4:108455559-108455581 ACAGAGAAGAGGACTGGGGATGG - Intergenic
978685362 4:111435840-111435862 TTGGAGAAGAGGAATGTGGCTGG - Intergenic
978926087 4:114246476-114246498 ATGGAAAAAAGTACAGAGGAGGG + Intergenic
979238960 4:118431675-118431697 CTGGAGAAAAGGACAGTGAATGG - Intergenic
979307008 4:119158034-119158056 ATGCAGAATGGGAAAGTGGATGG + Exonic
979374328 4:119927639-119927661 ATGCAGAAGAGGACATTAGTGGG - Intergenic
979613131 4:122710615-122710637 ACGGAGCAGGGGACAGTGAAGGG + Intergenic
980204738 4:129702797-129702819 ATGGAAAAGGGGACAGTGAGTGG - Intergenic
980888964 4:138793783-138793805 AAGGAGAAGAGGGGAGGGGAAGG + Intergenic
980999761 4:139817521-139817543 ATGGAGGAGGTGACAGTGAAAGG - Intronic
981367364 4:143918679-143918701 AAAGAGAAGAGAATAGTGGAAGG + Intergenic
981495758 4:145390544-145390566 ATGGAGAAGGGGAGAGAGGGAGG + Intergenic
981934189 4:150221289-150221311 AAGGAGAAGAGGATGGTGGTGGG - Intronic
981966830 4:150613958-150613980 ATGGACACGAGGTCAGAGGAAGG - Intronic
982400710 4:154964723-154964745 ATGCAGAAGACGACAGTTTAGGG - Intergenic
982680710 4:158425628-158425650 ATGGAGAATAGGTTAGTGGCAGG - Intronic
982685769 4:158486926-158486948 GTAGAGAAGATGACAGTTGATGG - Intronic
983205612 4:164907747-164907769 AGGTAGAAGAGGACAGAGCATGG + Intergenic
983351255 4:166592973-166592995 CCAGAGAAGAGGCCAGTGGATGG + Intergenic
983484782 4:168320385-168320407 ATGGCGTTGAAGACAGTGGAAGG + Intergenic
984208006 4:176809907-176809929 CTGGAAAGGAGGAAAGTGGATGG - Intergenic
984628951 4:182040011-182040033 GGGGAGAAGAGGGCAGGGGAGGG + Intergenic
984628982 4:182040086-182040108 GGGGAGAAGAGGGCAGGGGAGGG + Intergenic
984629022 4:182040186-182040208 GGGGAGAAGAGGGCAGGGGAGGG + Intergenic
984629033 4:182040211-182040233 GGGGAGAAGAGGGCAGGGGAGGG + Intergenic
984819337 4:183866510-183866532 ATGAAGAAGAGGATGGTGGAGGG + Intronic
985237498 4:187892012-187892034 ATGGATAAGTAGACAGAGGAAGG + Intergenic
985559897 5:579807-579829 ATCAAGAAGAGGGCTGTGGAGGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986067074 5:4245210-4245232 ATGGAGGAAAGGACAGATGAAGG - Intergenic
986132589 5:4944765-4944787 GTGGAGGAGAGGACTCTGGAGGG - Intergenic
986132602 5:4944810-4944832 GTGGAGGAGAGGACTCTGGAGGG - Intergenic
986132615 5:4944855-4944877 GTGGAGGAGAGGACTCTGGAGGG - Intergenic
986542031 5:8854588-8854610 ATGGTGCTGAGGACAGTGGAGGG - Intergenic
987213648 5:15710303-15710325 AGCAAGGAGAGGACAGTGGAAGG - Intronic
987466172 5:18274900-18274922 TTGGAGAAGAGGTATGTGGATGG - Intergenic
987557446 5:19472635-19472657 ATGGAGAAAAGAACTGGGGAGGG + Intergenic
988894456 5:35657030-35657052 CTGGAGGAGAGGAGAATGGATGG - Intronic
989973599 5:50555054-50555076 AGGGAGAAGAGGACTGTAGAAGG - Intergenic
990788207 5:59447327-59447349 ATGGAGAAAAGGTGAGTGTAGGG + Intronic
991365722 5:65866067-65866089 ATGGGGAAGAAGACAGAAGAGGG + Intronic
991480852 5:67077550-67077572 ATGGTGAGGAGCAAAGTGGATGG - Intronic
991540310 5:67720479-67720501 AGGGAGAAGAGGAGAGGGGAGGG - Intergenic
993367384 5:87050333-87050355 TTGGGGAAGAGGTAAGTGGATGG - Intergenic
993373362 5:87119168-87119190 AGGGAGAAGAGGAAAGCGGAGGG + Intergenic
993692261 5:91016536-91016558 ATGATGCAGAGGACAGTGAATGG - Intronic
994223800 5:97228633-97228655 ATGGAGGAGAGGACAGGAGAGGG + Intergenic
995180231 5:109224151-109224173 ATGGAGAAGAGAACTCTTGAAGG - Intergenic
996695775 5:126393175-126393197 ATGGAAAAGGGGAAAGTGAAGGG - Intronic
997157459 5:131575058-131575080 ATGGAGGATAGGAGAGTGTATGG - Intronic
997428800 5:133823395-133823417 CTGGAGAGGAGGAGAGTGCAGGG - Intergenic
998179761 5:139928347-139928369 TGGGAGAAGAGGACAAGGGAGGG - Intronic
998637451 5:143971755-143971777 ATGGATAAGAAGCCATTGGAGGG + Intergenic
999476812 5:151907808-151907830 ATGGAGAAGATGACCTTGGAAGG + Intronic
999676823 5:154012606-154012628 AGGGACAAAAGGATAGTGGATGG - Intronic
1000187074 5:158869491-158869513 TTGGAGAAGAGGAAATAGGAGGG - Intronic
1000228145 5:159289814-159289836 ATGGAGAAGAATATTGTGGAAGG + Intergenic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1001829462 5:174773442-174773464 ATGCAAAAGAGCAAAGTGGATGG - Intergenic
1002606354 5:180385188-180385210 AGGGGGAAGAAGACGGTGGAGGG + Intergenic
1002739208 5:181422273-181422295 CTAGAGAAAAGGACAGTGAATGG - Intergenic
1002971528 6:2027114-2027136 ATGAAGAAGAGGACCCTGGCTGG + Intronic
1003982781 6:11405075-11405097 ATGGGGAAGGGGATAGGGGAAGG + Intergenic
1004512709 6:16295678-16295700 AAGGAGAGGAGGACAGTGCGGGG + Intergenic
1004710250 6:18162953-18162975 CTGGAGAAGGGGACCGTGGCAGG + Intronic
1005119203 6:22371482-22371504 ATGGAGATGAAAACAGTAGAGGG - Intergenic
1005132029 6:22520463-22520485 AGGGAAAGGAGGACAGGGGAAGG + Intergenic
1005721954 6:28611348-28611370 AGGGAAAAGAGGAAAGTTGAAGG - Intronic
1005952880 6:30644412-30644434 ATGGAGGAAAGGAGAGAGGAAGG - Intronic
1005976198 6:30801627-30801649 GTGGAGAAGTGGGCAGAGGAAGG + Intergenic
1006137297 6:31902709-31902731 ATGGAGTGGAGGAAAGTTGAGGG - Intronic
1006967604 6:38004451-38004473 ATGGAGAGGGGGAGAGGGGAAGG - Intronic
1007120838 6:39379634-39379656 AGTGGGAAGAGGACAGTGAATGG + Intronic
1007412478 6:41673086-41673108 ATGGAAGAGGGGACAGTGGGTGG - Intergenic
1007785588 6:44277503-44277525 AGAGAGGAGAGGGCAGTGGAGGG + Exonic
1008174413 6:48249668-48249690 ATGGAGGAGAGTACAGGAGATGG + Intergenic
1008349319 6:50471309-50471331 ATGAAGAAGAGGAGAGGTGATGG - Intergenic
1008749008 6:54709261-54709283 GGGGAGAAGAGGAGAGGGGAGGG + Intergenic
1008749015 6:54709281-54709303 GGGGAGAAGAGGAGAGGGGAGGG + Intergenic
1009773442 6:68174997-68175019 CTGCACAAGAGGACAGTGTAAGG - Intergenic
1010431639 6:75784463-75784485 ATGGAGAAGAGCAAAGTGAAAGG + Intronic
1010746883 6:79573336-79573358 AGGGAAAAGAGAACAGTGGAAGG - Intergenic
1010943379 6:81946570-81946592 AGAGAGAGGAGGACAGAGGAAGG + Intergenic
1012476987 6:99624518-99624540 ATGGAGATGAACACAGAGGAAGG + Intergenic
1012873290 6:104696523-104696545 CTGCAGAAGAGGAAAGGGGAAGG + Intergenic
1014105427 6:117555449-117555471 ATGGTGAACATGACAGTAGAGGG + Intronic
1014534102 6:122595974-122595996 TTGCAGAAGAGGTAAGTGGATGG - Intronic
1015270568 6:131333854-131333876 GTGGAGAAGAGGACTGTGGTTGG + Intergenic
1015475837 6:133658113-133658135 TTGGAGAAGAGGTATGTGGATGG + Intergenic
1015988549 6:138911573-138911595 AGGGAGAGGAGGACAGGGCAAGG + Intronic
1016307173 6:142696527-142696549 AGGCAGAAGAGGAGAGTGGAGGG - Intergenic
1017194541 6:151685427-151685449 AAGGACAAGAGGCCAGTGGCCGG - Intronic
1018060169 6:160083989-160084011 ATGAAGATGAGGACATTGGGAGG + Exonic
1018072595 6:160178678-160178700 ATGGTGAGGAGGAGAGTAGAAGG - Intronic
1018318813 6:162584890-162584912 AAAGAGAAGAGGAGAGGGGAGGG - Intronic
1019244318 6:170697832-170697854 CTAGAGAAAAGGACAGTGAATGG - Intergenic
1019535328 7:1526293-1526315 AAGGAGAAGAGGGGAGGGGAGGG + Intergenic
1019778510 7:2926213-2926235 ATGGAGAGGCCGACATTGGAGGG - Intronic
1021555187 7:21911853-21911875 ATGGAGATGACGAAAATGGATGG + Intronic
1021629814 7:22633653-22633675 ATGATGAAGAGGAGAGGGGATGG + Intergenic
1022110052 7:27223989-27224011 ATGGAGAAAAGAGCATTGGAAGG - Intergenic
1023086756 7:36578525-36578547 ATGGAAAAATGGAGAGTGGAGGG - Intronic
1023300886 7:38769825-38769847 ATGGAGATGGGGCCAGAGGAGGG - Intronic
1023935112 7:44734234-44734256 AGGGAGGAGAGGGGAGTGGAGGG - Intergenic
1024481388 7:49866951-49866973 ATCGAGAAGAGGACACAGGTGGG - Intronic
1024525296 7:50343271-50343293 ATGGAGAAAAGAAGAGAGGAAGG - Intronic
1025776812 7:64568055-64568077 GTGGAGAAGAGGAGAGGGCAAGG - Intergenic
1026834829 7:73631738-73631760 AGGGAGAAGGGGAGAGAGGAAGG - Intergenic
1027037298 7:74934085-74934107 GTGGAGTAGAGGACAGGAGAAGG - Intergenic
1028150206 7:87363550-87363572 ATGGAGCAGAGTACACAGGAGGG + Intronic
1028237913 7:88383452-88383474 TTGGAGAAGAGGTATGTGGATGG + Intergenic
1028351764 7:89858086-89858108 GTGGAGAGGAAGACAGTGGGGGG - Intergenic
1028887719 7:95952793-95952815 ATGCATAAAAGGACAGAGGAAGG - Intronic
1029304898 7:99611868-99611890 ATAGAGATGAAGCCAGTGGAGGG - Intergenic
1029392567 7:100285394-100285416 GTGGAGTAGAGGACAGGAGAAGG + Intergenic
1029415498 7:100440629-100440651 ATGGGGAGGAGGACAGGGCATGG + Intergenic
1029493615 7:100885405-100885427 ATGGAGAAGTGGAGGGTAGAGGG + Intronic
1029578307 7:101418845-101418867 GTGGAGAGGAGGAAAGAGGAAGG - Intronic
1029578360 7:101419099-101419121 AGGGAGAAGAGGGGAGGGGAGGG - Intronic
1029655888 7:101924156-101924178 ATGGGGAGGAGGACAGAGGATGG + Intronic
1029815211 7:103086890-103086912 ATGGAGAATAAGACAGAAGAGGG + Intronic
1029843344 7:103388588-103388610 GTGGAGGAAATGACAGTGGAAGG + Intronic
1030028211 7:105345172-105345194 AGGGAGGAGAGGAGAGGGGAGGG + Intronic
1030065564 7:105656335-105656357 ATGTAGTTGATGACAGTGGAGGG - Intronic
1030191068 7:106810604-106810626 AAGTAGAATAGGACAGGGGAAGG + Intergenic
1031172818 7:118313041-118313063 ACTGAGAGGAGGACAGGGGAAGG + Intergenic
1031791610 7:126113132-126113154 CTTCAGAAGATGACAGTGGAAGG - Intergenic
1031985071 7:128158906-128158928 AAGGAGGAGAGGCCCGTGGAAGG + Intergenic
1032055516 7:128681461-128681483 AAGGAGGAGAGGAGAGGGGAGGG - Intronic
1032199299 7:129808127-129808149 ATAGAGAAGAGGGAAGGGGAGGG - Intergenic
1032508970 7:132456681-132456703 GAAGAGAAGAGGGCAGTGGAGGG + Intronic
1033068070 7:138175349-138175371 ATGGAGAAAAGGAGAAAGGAAGG + Intergenic
1033134951 7:138776553-138776575 AGGGTGAAGTGGAGAGTGGAGGG - Intronic
1033460340 7:141541754-141541776 ATAGAGGAGAGGTAAGTGGAAGG - Intergenic
1033519830 7:142149354-142149376 AAAGAGAAGAGGCCAGAGGATGG - Intronic
1033559927 7:142521528-142521550 ATGGTGGAGAGGTAAGTGGAGGG + Intergenic
1033682913 7:143613614-143613636 AAGGAGTAGAGAACAGAGGAGGG - Intergenic
1033701698 7:143844028-143844050 AAGGAGTAGAGAACAGAGGAGGG + Intergenic
1034298573 7:149995396-149995418 AGGGAGAGGAGGACAGGGGAAGG + Intergenic
1034405331 7:150899020-150899042 ATGGAGGAGGGGACAGAGAAGGG + Intergenic
1034807441 7:154101382-154101404 AGGGAGAGGAGGACAGGGGAAGG - Intronic
1034867002 7:154650343-154650365 GTGGAGAGGAGGGCAGAGGAGGG + Intronic
1034932333 7:155172360-155172382 TTGGTTAAGAGGCCAGTGGAGGG - Intergenic
1035503807 8:110340-110362 CTAGAGAAAAGGACAGTGAATGG + Intergenic
1035649272 8:1252911-1252933 AGGCAGAGGAGGACAGAGGACGG + Intergenic
1035762794 8:2081628-2081650 ATTGAGAAGAGCACTGGGGAAGG + Intronic
1036130398 8:6104263-6104285 ATGGAGAGGAGGGGAGAGGAAGG + Intergenic
1036279891 8:7391721-7391743 AGGAAGAAAAGGAGAGTGGAAGG - Intergenic
1036341630 8:7920162-7920184 AGGAAGAAAAGGAGAGTGGAAGG + Intergenic
1036556537 8:9864891-9864913 ATGGAGTAGAGCAGAGAGGAAGG - Intergenic
1037069742 8:14629562-14629584 GTGGCTAAGAGGACAGTGGATGG - Intronic
1037219837 8:16504981-16505003 ATGTAGAAGAGGAAAGTTGGTGG + Intronic
1037485479 8:19342848-19342870 ATGGAGAAAGGGAAAGAGGAGGG + Intronic
1037753238 8:21696095-21696117 AAGGAGGAGGGGACAGAGGAGGG - Intronic
1038375962 8:27040756-27040778 TTGGAGAAGAGGCCATTAGAAGG - Intergenic
1038929966 8:32182645-32182667 AGGGAAGAGAGGTCAGTGGAAGG - Intronic
1039227458 8:35403909-35403931 ATGGAGAGAATGTCAGTGGAGGG - Intronic
1039324087 8:36465916-36465938 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1039393313 8:37200665-37200687 ATGGAGGGAAGGAGAGTGGATGG + Intergenic
1039564831 8:38543855-38543877 AGGGAGAATAGGAAAGAGGAGGG + Intergenic
1039893898 8:41702498-41702520 AGGAAGATGAGGACAGAGGAAGG + Intronic
1040453686 8:47574745-47574767 CTTGAGAAGAGGAGAGGGGAGGG + Intronic
1040492776 8:47940447-47940469 ATGGATAAGTTGGCAGTGGAAGG - Intronic
1041636653 8:60153092-60153114 AGGGAGGAGGGGACAGAGGAGGG + Intergenic
1041909451 8:63072858-63072880 AGAGAGAAGAGGAGAGGGGAGGG + Intronic
1042585238 8:70329943-70329965 ATGGAAAAGAGCACAGGAGAGGG + Intronic
1042622133 8:70718000-70718022 ATGGAGATGAGGAATTTGGAGGG - Intronic
1042760415 8:72266446-72266468 ATGGAAAGGAGAACAGTGTAGGG + Intergenic
1042959460 8:74288166-74288188 ATGGAGAAGAGGGCAGATGGAGG + Intronic
1043211687 8:77527376-77527398 CTGGTGAAAAGGACAGTGGGGGG - Intergenic
1043563694 8:81524061-81524083 ATGACGAAGAGGACAATGGAAGG - Intergenic
1043934774 8:86130785-86130807 ATGGGGAAGAGGACAGAGGCAGG - Intronic
1044015838 8:87048096-87048118 GTAGAGAGGAGGACAGTGTAAGG + Intronic
1044916206 8:97115003-97115025 CTGGAAATGAGGACTGTGGATGG - Intronic
1045340237 8:101247422-101247444 ATGGAGAAAAGGACAGTGATAGG - Intergenic
1046978503 8:120310999-120311021 ATGGAGAGGAGAACATTGCAAGG + Intronic
1047501560 8:125445712-125445734 TTGGAGGGGAGGACAGTGGCAGG + Intergenic
1048118609 8:131553802-131553824 ATGAAGAAGAAGGCAGTGGCTGG + Intergenic
1048502860 8:134994503-134994525 AAGGAGAAGATGCCTGTGGAAGG + Intergenic
1048805098 8:138232939-138232961 GTGGTGAAGAGGAAAGTGGGAGG - Intronic
1049283786 8:141763649-141763671 ATGGAGAGATGGGCAGTGGAAGG - Intergenic
1049469240 8:142768140-142768162 GGGGAGAAGAGGAGAGAGGAAGG + Intronic
1049884575 9:18498-18520 ATGGAGAAGATCACAGAGGCTGG + Intergenic
1050729814 9:8696185-8696207 AGAGAGAAGAGGACACGGGATGG + Intronic
1051201077 9:14624663-14624685 ATGGGGAAGAGGATGGTCGATGG + Intronic
1051219338 9:14831943-14831965 ATGGAGATGAAAACAGTAGAGGG - Intronic
1051738145 9:20224651-20224673 AGGGAGAAGAGAAGAGGGGAGGG + Intergenic
1052049564 9:23830020-23830042 ATGTAAAACAGGACAGTGGAAGG - Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1053313298 9:37032938-37032960 GTGGAGGAGAGCACAGTGGGTGG - Intronic
1053670627 9:40358394-40358416 AGGGAGAAGAGGACAGGGAGAGG + Intergenic
1054163504 9:61697853-61697875 ATGGAGGAAAGGACGGTGAATGG - Intergenic
1054513986 9:66017906-66017928 AGGGAGAAGAGGACAGGGAGAGG - Intergenic
1056266485 9:84901760-84901782 ATGGAGAAGAAGCCAGGGGAGGG - Intronic
1056688036 9:88782861-88782883 ATGGGGAAGGGAAGAGTGGAGGG + Intergenic
1056847643 9:90054704-90054726 GTGGAGAACAGGATAGTGGGAGG - Intergenic
1056939912 9:90946182-90946204 ATTGAGAAGAGGGCAGGGGAAGG + Intergenic
1057051721 9:91928851-91928873 ATGTAGATGAGGAAAGTGCAGGG - Intronic
1057075711 9:92137166-92137188 ACAGAGCAGAGGACAGAGGAAGG + Intergenic
1057527698 9:95817230-95817252 AAGGAGAAAAAGACAGTAGAGGG - Intergenic
1058270091 9:102961428-102961450 ATGGTTAAGAGGAAAGTGAAGGG - Intergenic
1058407355 9:104691702-104691724 TTGAAGTAGAGGAAAGTGGAAGG - Intergenic
1058421902 9:104840558-104840580 AGGGAGAAAAGGGCAGTGCAAGG + Intronic
1058719237 9:107748708-107748730 ATGAAGGAGATGACAGAGGATGG - Intergenic
1058936842 9:109777680-109777702 ATGAAGAAGAGACCATTGGAGGG - Intronic
1059232502 9:112734358-112734380 ATTGAGAAAAGAACAGTGGCAGG - Intergenic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059388941 9:113986756-113986778 AATGAGGAGAGGACAGAGGAAGG - Intronic
1059406914 9:114106385-114106407 ATGGAGAAGAGCAAAGTTGGAGG + Intergenic
1059520770 9:114939788-114939810 TTGGAGTAGAAGAAAGTGGAAGG - Intergenic
1059938950 9:119338970-119338992 AAAGAGAGGAGGACAGTGAAAGG + Intronic
1060041266 9:120303749-120303771 ATGGAGAGAAAGCCAGTGGAAGG + Intergenic
1060146134 9:121253929-121253951 AAGGAGAAGAAGAAAGTGAAGGG - Intronic
1060394624 9:123306768-123306790 TGGGAGAAGAGGGCATTGGAAGG + Intergenic
1060428175 9:123524165-123524187 GTGGAGAAGAGGCCACTTGATGG + Intronic
1060725384 9:126002674-126002696 ATGGGGAGGAGGCCAGGGGAGGG + Intergenic
1060797829 9:126524642-126524664 CTGGAGACAGGGACAGTGGAGGG - Intergenic
1060879985 9:127111307-127111329 ATGGTGATAAGGACACTGGAGGG - Intronic
1061214480 9:129213195-129213217 CTGGAGAAGAGGTCAAGGGAGGG - Intergenic
1061458880 9:130720273-130720295 ATAGAGAAGGGGACAGGGAATGG + Intronic
1061498247 9:130987908-130987930 ATGGAGCAGAGCCCAGGGGAGGG + Intergenic
1061660334 9:132125903-132125925 ATGGAGAAGAGAACACAGGAGGG - Intergenic
1061842438 9:133367130-133367152 CTGGAGAAGAGGGGAATGGAGGG + Intronic
1061984737 9:134123970-134123992 CTGGAGAAAACGACACTGGAGGG + Intergenic
1062160927 9:135079323-135079345 AAGAAGAAGAGGACAGAGGCTGG + Intronic
1203726758 Un_GL000216v2:56069-56091 ATGGAGAGGAAGAGAATGGAAGG - Intergenic
1203387948 Un_KI270438v1:71988-72010 ATGGAGAGGAATAGAGTGGAAGG + Intergenic
1203718983 Un_KI270742v1:186057-186079 ATGGAGTGGAGTAGAGTGGAAGG - Intergenic
1203604506 Un_KI270748v1:47058-47080 CTAGAGAAAAGGACAGTGAATGG - Intergenic
1185640654 X:1588149-1588171 AGGGAGCAGAGGAAAGGGGAGGG - Intergenic
1186081016 X:5931974-5931996 ATGGAGAAGAGAAGATGGGAGGG - Intronic
1186436280 X:9545661-9545683 AAGGAGAAGAGGAGAGTGAGGGG - Intronic
1187737327 X:22318073-22318095 AGGGAGAAGAGGAGAGGAGAGGG - Intergenic
1187941946 X:24391191-24391213 ATGGAGGACAGGACAGAGAAGGG + Intergenic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1188006462 X:25019138-25019160 ACCTAGAAGAGGAGAGTGGAAGG + Intergenic
1188860154 X:35245521-35245543 AGGGAGTGGAGGAGAGTGGATGG + Intergenic
1189230769 X:39450895-39450917 ATGGAGGAGGGGAGAGTGGAGGG - Intergenic
1189367718 X:40402005-40402027 AAGGAAAAGAGGACTGTGAATGG + Intergenic
1189575694 X:42350778-42350800 GTGGAGAAAAGCAAAGTGGAGGG + Intergenic
1190198053 X:48336654-48336676 AAGGAGGAGAGGAGAGGGGAGGG + Intergenic
1190664801 X:52687112-52687134 ACGGAGGAGAGGAGAGGGGAGGG + Intronic
1190674621 X:52771307-52771329 ACGGAGGAGAGGAGAGGGGAGGG - Intronic
1190755782 X:53400668-53400690 ATGGAGAGGAGGACAATAGCAGG - Intronic
1190857913 X:54315334-54315356 ATATAGAAGTGGACAGTGTAGGG - Intronic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1190996666 X:55616856-55616878 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1191210545 X:57880417-57880439 GTGGACAACTGGACAGTGGAGGG + Intergenic
1192053211 X:67746106-67746128 AGGGAGAAAGGGAGAGTGGAGGG - Intergenic
1192434620 X:71135508-71135530 GTGGAGCAGAGGAAAGAGGAGGG - Intronic
1192547620 X:72027025-72027047 GAGGAGAAGAGGAAAGTGGTTGG + Intergenic
1192831817 X:74758156-74758178 TTGGGGAAGAGGAGAGTGGGTGG + Intronic
1194579907 X:95659320-95659342 TTGTAGAAGAGTACAGTAGAAGG + Intergenic
1195013469 X:100755574-100755596 ATGGGGAAGAGGTATGTGGATGG - Intergenic
1195094676 X:101492359-101492381 TTGGGGAAGAGGCCATTGGAGGG + Exonic
1195210480 X:102649591-102649613 ATTAAGAAGTGGACACTGGATGG - Intergenic
1195676831 X:107513023-107513045 AGGGAGGAGGGGACAGGGGAGGG + Intergenic
1195943051 X:110180842-110180864 ATGGAGAAGGGAAGTGTGGAAGG - Intronic
1196077959 X:111598200-111598222 AAGGAGAAGAGGAGAATGGCTGG - Intergenic
1196093624 X:111774635-111774657 CTGGAGAAGAGCAAAATGGAGGG - Exonic
1196754199 X:119143595-119143617 CTGGAGAAGAGGAAAGGGGGAGG - Intronic
1197182179 X:123548408-123548430 TTGGGGAAGAGGTCTGTGGATGG + Intergenic
1197198241 X:123725262-123725284 GTTGAGAAGAGAACAGTGGTTGG + Intronic
1197386688 X:125811616-125811638 TTGGGGAAGAGGTCTGTGGATGG - Intergenic
1197591956 X:128420012-128420034 ATGGGGAAGAGGTATGTGGATGG + Intergenic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198003699 X:132469099-132469121 ATAGAGAAGAATACCGTGGATGG + Intronic
1198434590 X:136603833-136603855 ATGGTGAGGTGGACAGAGGAGGG - Intergenic
1199860428 X:151796432-151796454 GTGAAGAAGAGGAAAGAGGAAGG - Intergenic
1200401231 X:156021653-156021675 ATGGAGAAGATCACAGAGGCTGG - Intergenic
1201113253 Y:10816005-10816027 GTGGAGAAGAGTTGAGTGGAGGG - Intergenic
1201122071 Y:10880843-10880865 GTGGATAAGAGTACAGTGGAAGG - Intergenic
1201128769 Y:10936887-10936909 ATGGAGTGGAGTGCAGTGGAGGG - Intergenic
1201131058 Y:10952310-10952332 AAGGAGAAGAGAGGAGTGGAAGG - Intergenic
1201132021 Y:10959665-10959687 ATGGAGTGGAGTAGAGTGGAAGG - Intergenic
1201173151 Y:11290949-11290971 ATGGAGTGGAGTAGAGTGGAAGG - Intergenic
1202028092 Y:20545609-20545631 TTGGAGAGGAGGACAGTATAAGG - Intergenic
1202386715 Y:24333471-24333493 CTGGAGAAAAGGACAGTGAATGG - Intergenic
1202484070 Y:25336657-25336679 CTGGAGAAAAGGACAGTGAATGG + Intergenic